Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Bda01g01638	ATGGCGACGAGGAATAGAACCTTGCTGTTTAAGAAATATAGAGATGCTTTAAAGAGCGTTAGAGTTCCGGCGAGTTCTTCCCTTGCGTCTGGTTCGCCGTCGACTTCTGGCGGTGGCGGAGGTGGTCCGGTTATCGAATTGGTCAGCACCTCGCTTTTGCATCCGAATCGATCTTATGCTCCGCTAAGTACTGAGGATCCGGGTTATTCAAGTAAGGGTGCTCTTACTGTTGGTCTACCTCCAGCTTGGGTGGATGTTTCTGAAGAAATATCAACAAATGTGCAGCGTGCACAAATAAAAATGGCTGAGTTAGCCAAGGCACATGCAAAGGCTTTAATGCCTTCATTTGGAGATGGTAAAGAAGATCAAAGATTAATTGAAGCTCTTACTCAAGAGATTACAGGTCTGATTAAGAAATCAGAGAAGAGACTACAAAGACTTTCTGTAGCAGGACCTTCTGAAGATTCCAATGTCAGAAAAAATGTTCAGCGTTCTCTTGCCACAGACCTTCAAAATCTTTCAATGGAGCTTCGCAAAAAACAATCAACTTACCTCAAGCGGCTCAGGCAGCAAAAGGAGGGTCAAGATGGGATAGACTTAGAGATGAATCTAAATGGAAGTAGATCTACTGCCGAGGATGATGACTTGGATAACATGATATTTAATGAGCATCAGATGGCCAAGCTTAAAAAGAGCGAAGCATTCACAGCAGAAAGAGAGAGAGAAATCCAACAGGCAAGGGAAATAACTTTATTTACTGCTTTATTAGTTGTAGAATCTGTAAATGAGCTTGCTCAGATTATGAAGGATCTTTCAGTTCTTGTTATAGACCAGCAGGGCACAATTGTTGATAGGATTGATTACAACATTCAGAATGTGGCAACAACAGTTGAGGAGGGCCTTAAACAGCTGCAGAAGGCTGAAAGAACACAGAAACAAGGAGGGATGGTTATGTGCGCATCTGTGCTTCTTATCATGTGCTTCATTATGTTGGTTCTCCTGGTTCTCAAGGAAATATTTTTG	1023	42.33	MATRNRTLLFKKYRDALKSVRVPASSSLASGSPSTSGGGGGGPVIELVSTSLLHPNRSYAPLSTEDPGYSSKGALTVGLPPAWVDVSEEISTNVQRAQIKMAELAKAHAKALMPSFGDGKEDQRLIEALTQEITGLIKKSEKRLQRLSVAGPSEDSNVRKNVQRSLATDLQNLSMELRKKQSTYLKRLRQQKEGQDGIDLEMNLNGSRSTAEDDDLDNMIFNEHQMAKLKKSEAFTAEREREIQQAREITLFTALLVVESVNELAQIMKDLSVLVIDQQGTIVDRIDYNIQNVATTVEEGLKQLQKAERTQKQGGMVMCASVLLIMCFIMLVLLVLKEIFL	341

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
1	52304232	52307741	+	Bda032965	Bda01g01638	1638

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Bda01g01638	341	SMART	SynN_4	74	189	IPR006011	GO:0016020
Bda01g01638	341	PANTHER	SYNTAXIN-43-LIKE	1	336	-	-
Bda01g01638	341	MobiDBLite	consensus disorder prediction	24	46	-	-
Bda01g01638	341	Gene3D	-	80	299	-	-
Bda01g01638	341	PANTHER	SYNTAXIN	1	336	IPR045242	-
Bda01g01638	341	CDD	SNARE_syntaxin16	237	306	-	-
Bda01g01638	341	ProSiteProfiles	t-SNARE coiled-coil homology domain profile.	276	307	IPR000727	-
Bda01g01638	341	SUPERFAMILY	t-snare proteins	79	300	IPR010989	GO:0016020\|GO:0016192
Bda01g01638	341	Pfam	SNARE domain	281	333	IPR000727	-
Bda01g01638	341	SMART	tSNARE_6	240	307	IPR000727	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Bda01g01638	K08489	STX16; syntaxin 16	-	jre:109011309	529.25

Dupl-types

Select	Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
	Bda01g01638	Bda-Chr1:52304232	Bda08g01094	Bda-Chr8:24288912	1.40E-165	dispersed
	Bda01g01638	Bda-Chr1:52304232	Bda01g01644	Bda-Chr1:52440821	0	proximal

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi14g133	.	.	.	.	.	.	.	.	.	.	Cma05g01087	Cma12g01045	Car05g00958	Car12g01004	.	Cpe07g00878	Cpe11g00890	.	.	.	.	.	.	.	Cla02g01497	Cam02g1577	Cec02g1601	Cco02g1642	Clacu02g1560	Cmu02g1513	Cre02g1836	Cone10ag0804	Cone3ag0826	.	.	.	Csa02g00478	.	Cme05g01576	.	.	Bda01g01638	.	.	.	.	Bma05g00265	Sed11g0396	Cmo05g01102	Cmo12g01056	.	.	.	.	.	.	Bhi06g01461	Tan08g0631	Cmetu05g1168	.	Hepe08g2281	.	.	.	.	.	.	.	.	.	Lsi11g00612	.	Chy05g01060	.

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Bda13g01286	.	440	803	SNARE and Associated Proteins	AT3G24350	59.5	1.5e-97	353.2
Bda01g00978	.	1	341	SNARE and Associated Proteins	AT3G24350	61.5	9.0e-95	344.0
Bda11g01860	.	1	294	SNARE and Associated Proteins	AT2G18260	55.0	5.7e-82	301.2
Bda14g01003	.	1	290	SNARE and Associated Proteins	AT2G18260	55.0	1.4e-80	296.6
Bda06g00929	.	1	293	SNARE and Associated Proteins	AT2G18260	51.8	1.6e-76	283.1
Bda05g01127	.	22	278	SNARE and Associated Proteins	AT3G11820	78.6	1.9e-109	392.5
Bda03g00658	.	19	279	SNARE and Associated Proteins	AT3G11820	74.3	2.6e-106	382.1
Bda01g00422	.	19	279	SNARE and Associated Proteins	AT3G11820	71.6	1.9e-101	365.9
Bda01g00430	.	19	279	SNARE and Associated Proteins	AT3G11820	71.6	1.9e-101	365.9
Bda09g01276	.	31	281	SNARE and Associated Proteins	AT3G11820	66.1	5.7e-93	337.8
Bda03g00659	.	19	238	SNARE and Associated Proteins	AT3G11820	57.1	5.3e-67	251.5
Bda02g00552	.	31	159	SNARE and Associated Proteins	AT3G11820	56.6	6.8e-38	154.8
Bda03g00658	.	1	279	SNARE and Associated Proteins	AT3G52400	62.5	5.4e-89	324.7
Bda01g00422	.	1	279	SNARE and Associated Proteins	AT3G52400	61.2	8.6e-87	317.4
Bda01g00430	.	1	279	SNARE and Associated Proteins	AT3G52400	61.2	8.6e-87	317.4
Bda05g01127	.	29	278	SNARE and Associated Proteins	AT3G52400	66.4	2.1e-85	312.8
Bda09g01276	.	1	281	SNARE and Associated Proteins	AT3G52400	56.0	2.0e-80	296.2
Bda09g01276	.	1	299	SNARE and Associated Proteins	AT4G03330	67.9	3.0e-107	385.2
Bda03g00658	.	1	279	SNARE and Associated Proteins	AT4G03330	56.1	1.3e-78	290.0
Bda05g01127	.	1	282	SNARE and Associated Proteins	AT4G03330	53.4	2.9e-78	288.9
Bda01g00422	.	1	284	SNARE and Associated Proteins	AT4G03330	52.4	3.6e-76	282.0
Bda01g00430	.	1	284	SNARE and Associated Proteins	AT4G03330	52.4	3.6e-76	282.0
Bda02g00552	.	1	159	SNARE and Associated Proteins	AT4G03330	63.6	3.7e-49	192.2
Bda03g00659	.	1	201	SNARE and Associated Proteins	AT4G03330	52.6	1.4e-48	190.3
Bda09g01276	.	1	303	SNARE and Associated Proteins	AT1G61290	77.2	1.5e-122	436.0
Bda03g00658	.	1	279	SNARE and Associated Proteins	AT1G61290	59.1	3.5e-84	308.5
Bda05g01127	.	1	277	SNARE and Associated Proteins	AT1G61290	58.6	2.3e-83	305.8
Bda01g00422	.	1	294	SNARE and Associated Proteins	AT1G61290	54.7	4.8e-81	298.1
Bda01g00430	.	1	294	SNARE and Associated Proteins	AT1G61290	54.7	4.8e-81	298.1
Bda02g00552	.	1	159	SNARE and Associated Proteins	AT1G61290	74.2	2.7e-60	229.2
Bda09g01276	.	1	303	SNARE and Associated Proteins	AT1G11250	75.6	4.3e-119	424.5
Bda03g00658	.	1	279	SNARE and Associated Proteins	AT1G11250	60.9	3.0e-88	322.0
Bda05g01127	.	1	278	SNARE and Associated Proteins	AT1G11250	59.4	1.2e-87	320.1
Bda01g00422	.	1	284	SNARE and Associated Proteins	AT1G11250	57.7	3.5e-84	308.5
Bda01g00430	.	1	284	SNARE and Associated Proteins	AT1G11250	57.7	3.5e-84	308.5
Bda02g00552	.	1	159	SNARE and Associated Proteins	AT1G11250	70.4	1.2e-55	213.8
Bda06g00358	.	1	307	SNARE and Associated Proteins	AT3G03800	63.2	3.4e-95	345.1
Bda06g00358	.	1	204	SNARE and Associated Proteins	AT5G08080	62.3	7.1e-58	220.7
Bda06g01261	BCT	1	263	SNARE and Associated Proteins	AT5G16830	63.2	5.9e-78	287.7
Bda06g01264	.	1	263	SNARE and Associated Proteins	AT5G16830	63.2	2.3e-77	285.8
Bda08g00639	BCT	1	263	SNARE and Associated Proteins	AT5G16830	62.5	9.5e-76	280.4
Bda08g00639	BCT	1	274	SNARE and Associated Proteins	AT5G46860	70.4	5.3e-84	307.8
Bda06g01264	.	1	263	SNARE and Associated Proteins	AT5G46860	70.0	5.9e-83	304.3
Bda06g01261	BCT	1	263	SNARE and Associated Proteins	AT5G46860	69.6	6.5e-82	300.8
Bda08g00639	BCT	1	257	SNARE and Associated Proteins	AT4G17730	66.5	1.1e-76	283.5
Bda06g01264	.	1	257	SNARE and Associated Proteins	AT4G17730	64.2	5.8e-75	277.7
Bda06g01261	BCT	1	257	SNARE and Associated Proteins	AT4G17730	64.2	2.2e-74	275.8
Bda01g01045	.	1	184	SNARE and Associated Proteins	AT4G17730	54.0	1.2e-43	173.7
Bda13g01915	.	1	176	SNARE and Associated Proteins	AT4G17730	53.1	4.2e-41	165.2
Bda08g00639	BCT	65	256	SNARE and Associated Proteins	AT1G32270	58.3	3.2e-49	192.6
Bda06g01261	BCT	65	256	SNARE and Associated Proteins	AT1G32270	58.3	4.2e-49	192.2
Bda06g01264	.	65	256	SNARE and Associated Proteins	AT1G32270	58.3	4.2e-49	192.2
Bda14g00262	.	1	337	SNARE and Associated Proteins	AT5G05760	65.5	2.0e-112	402.5
Bda13g01286	.	440	803	SNARE and Associated Proteins	AT3G24350	59.5	1.5e-97	353.2
Bda01g00978	.	1	341	SNARE and Associated Proteins	AT3G24350	61.5	9.0e-95	344.0
Bda01g01644	.	1	341	SNARE and Associated Proteins	AT5G26980	75.4	2.6e-125	445.3
Bda01g01638	.	1	341	SNARE and Associated Proteins	AT5G26980	75.4	2.6e-125	445.3
Bda08g01094	.	16	263	SNARE and Associated Proteins	AT5G26980	78.6	7.3e-96	347.4
Bda01g01644	.	1	339	SNARE and Associated Proteins	AT4G02195	63.9	2.6e-101	365.5
Bda01g01638	.	1	339	SNARE and Associated Proteins	AT4G02195	63.9	2.6e-101	365.5
Bda08g01094	.	16	261	SNARE and Associated Proteins	AT4G02195	67.6	6.4e-84	307.8
Bda01g01644	.	1	339	SNARE and Associated Proteins	AT3G05710	75.2	4.8e-127	451.1
Bda01g01638	.	1	339	SNARE and Associated Proteins	AT3G05710	75.2	4.8e-127	451.1
Bda08g01094	.	17	261	SNARE and Associated Proteins	AT3G05710	82.0	4.5e-101	364.8
Bda09g00411	BCT,CCT	1	232	SNARE and Associated Proteins	AT1G16240	72.4	6.2e-89	323.9
Bda05g00693	CCT	1	234	SNARE and Associated Proteins	AT1G16240	60.3	9.7e-74	273.5
Bda07g00381	BCT,CCT	1	195	SNARE and Associated Proteins	AT1G16240	70.8	5.9e-71	264.2
Bda09g00411	BCT,CCT	1	232	SNARE and Associated Proteins	AT1G79590	70.4	2.8e-85	312.0
Bda05g00693	CCT	1	233	SNARE and Associated Proteins	AT1G79590	61.4	1.9e-73	272.7
Bda07g00381	BCT,CCT	1	195	SNARE and Associated Proteins	AT1G79590	69.7	1.3e-71	266.5
Bda09g00403	.	63	264	SNARE and Associated Proteins	AT1G28490	67.3	7.6e-67	250.4
Bda07g00367	.	55	226	SNARE and Associated Proteins	AT1G28490	60.6	2.8e-53	205.3
Bda02g00767	.	1	286	SNARE and Associated Proteins	AT3G09740	56.4	1.6e-80	296.2
Bda02g00767	.	1	286	SNARE and Associated Proteins	AT3G45280	56.4	1.1e-78	290.0
Bda02g00767	.	1	286	SNARE and Associated Proteins	AT3G61450	52.3	9.8e-75	276.9
Bda14g00163	.	65	263	SNARE and Associated Proteins	AT1G51740	65.5	1.3e-65	246.5

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0003497	3	1	2	2	1	1	2	1	1	1	1	1	2	1	1	2	1	2	2	1	1	1	1	1	1	1	1	4	4	2	46

Transcriptome

Select	Gene	Chr	Type	da1	da2	da3	da4	da5	da6	da7	da8	da9	da10
	Bda01g01638	Bda_Chr01	FPKM	6.258197	9.404503	9.246527	13.57828	23.668566	28.491966	29.905466	13.936921	12.472294