Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Bda01g01644	ATGGCGACGAGGAATAGAACCTTGCTGTTTAAGAAATATAGAGATGCTTTAAAGAGCGTTAGAGTTCCGGCGAGTTCTTCCCTTGCGTCTGGTTCGCCGTCGACTTCTGGCGGTGGCGGAGGTGGTCCGGTTATCGAATTGGTCAGCACCTCGCTTTTGCATCCGAATCGATCTTATGCTCCGCTAAGTACTGAGGATCCGGGTTATTCAAGTAAGGGTGCTCTTACTGTTGGTCTACCTCCAGCTTGGGTGGATGTTTCTGAAGAAATATCAACAAATGTGCAGCGTGCACAAATAAAAATGGCTGAGTTAGCCAAGGCACATGCAAAGGCTTTAATGCCTTCATTTGGAGATGGTAAAGAAGATCAAAGATTAATTGAAGCTCTTACTCAAGAGATTACAGGTCTGATTAAGAAATCAGAGAAGAGACTACAAAGACTTTCTGTAGCAGGACCTTCTGAAGATTCCAATGTCAGAAAAAATGTTCAGCGTTCTCTTGCCACAGACCTTCAAAATCTTTCAATGGAGCTTCGCAAAAAACAATCAACTTACCTCAAGCGGCTCAGGCAGCAAAAGGAGGGTCAAGATGGGATAGACTTAGAGATGAATCTAAATGGAAGTAGATCTACTGCCGAGGATGATGACTTGGATAACATGATATTTAATGAGCATCAGATGGCCAAGCTTAAAAAGAGCGAAGCATTCACAGCAGAAAGAGAGAGAGAAATCCAACAGGCAAGGGAAATAACTTTATTTACTGCTTTATTAGTTGTAGAATCTGTAAATGAGCTTGCTCAGATTATGAAGGATCTTTCAGTTCTTGTTATAGACCAGCAGGGCACAATTGTTGATAGGATTGATTACAACATTCAGAATGTGGCAACAACAGTTGAGGAGGGCCTTAAACAGCTGCAGAAGGCTGAAAGAACACAGAAACAAGGAGGGATGGTTATGTGCGCATCTGTGCTTCTTATCATGTGCTTCATTATGTTGGTTCTCCTGGTTCTCAAGGAAATATTTTTGTGA	1026	42.3	MATRNRTLLFKKYRDALKSVRVPASSSLASGSPSTSGGGGGGPVIELVSTSLLHPNRSYAPLSTEDPGYSSKGALTVGLPPAWVDVSEEISTNVQRAQIKMAELAKAHAKALMPSFGDGKEDQRLIEALTQEITGLIKKSEKRLQRLSVAGPSEDSNVRKNVQRSLATDLQNLSMELRKKQSTYLKRLRQQKEGQDGIDLEMNLNGSRSTAEDDDLDNMIFNEHQMAKLKKSEAFTAEREREIQQAREITLFTALLVVESVNELAQIMKDLSVLVIDQQGTIVDRIDYNIQNVATTVEEGLKQLQKAERTQKQGGMVMCASVLLIMCFIMLVLLVLKEIFL	341

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
1	52440821	52444331	+	Bda003913.1	Bda01g01644	1644

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Bda01g01644	341	SMART	SynN_4	74	189	IPR006011	GO:0016020
Bda01g01644	341	PANTHER	SYNTAXIN-43-LIKE	1	336	-	-
Bda01g01644	341	MobiDBLite	consensus disorder prediction	24	46	-	-
Bda01g01644	341	Gene3D	-	80	299	-	-
Bda01g01644	341	PANTHER	SYNTAXIN	1	336	IPR045242	-
Bda01g01644	341	CDD	SNARE_syntaxin16	237	306	-	-
Bda01g01644	341	ProSiteProfiles	t-SNARE coiled-coil homology domain profile.	276	307	IPR000727	-
Bda01g01644	341	SUPERFAMILY	t-snare proteins	79	300	IPR010989	GO:0016020\|GO:0016192
Bda01g01644	341	Pfam	SNARE domain	281	333	IPR000727	-
Bda01g01644	341	SMART	tSNARE_6	240	307	IPR000727	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Bda01g01644	K08489	STX16; syntaxin 16	-	jre:109011309	529.25

Dupl-types

Select	Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
	Bda01g01638	Bda-Chr1:52304232	Bda01g01644	Bda-Chr1:52440821	0	proximal
	Bda01g01644	Bda-Chr1:52440821	Bda08g01094	Bda-Chr8:24288912	1.40E-165	wgd

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Bda13g01286	.	440	803	SNARE and Associated Proteins	AT3G24350	59.5	1.5e-97	353.2
Bda01g00978	.	1	341	SNARE and Associated Proteins	AT3G24350	61.5	9.0e-95	344.0
Bda11g01860	.	1	294	SNARE and Associated Proteins	AT2G18260	55.0	5.7e-82	301.2
Bda14g01003	.	1	290	SNARE and Associated Proteins	AT2G18260	55.0	1.4e-80	296.6
Bda06g00929	.	1	293	SNARE and Associated Proteins	AT2G18260	51.8	1.6e-76	283.1
Bda05g01127	.	22	278	SNARE and Associated Proteins	AT3G11820	78.6	1.9e-109	392.5
Bda03g00658	.	19	279	SNARE and Associated Proteins	AT3G11820	74.3	2.6e-106	382.1
Bda01g00422	.	19	279	SNARE and Associated Proteins	AT3G11820	71.6	1.9e-101	365.9
Bda01g00430	.	19	279	SNARE and Associated Proteins	AT3G11820	71.6	1.9e-101	365.9
Bda09g01276	.	31	281	SNARE and Associated Proteins	AT3G11820	66.1	5.7e-93	337.8
Bda03g00659	.	19	238	SNARE and Associated Proteins	AT3G11820	57.1	5.3e-67	251.5
Bda02g00552	.	31	159	SNARE and Associated Proteins	AT3G11820	56.6	6.8e-38	154.8
Bda03g00658	.	1	279	SNARE and Associated Proteins	AT3G52400	62.5	5.4e-89	324.7
Bda01g00422	.	1	279	SNARE and Associated Proteins	AT3G52400	61.2	8.6e-87	317.4
Bda01g00430	.	1	279	SNARE and Associated Proteins	AT3G52400	61.2	8.6e-87	317.4
Bda05g01127	.	29	278	SNARE and Associated Proteins	AT3G52400	66.4	2.1e-85	312.8
Bda09g01276	.	1	281	SNARE and Associated Proteins	AT3G52400	56.0	2.0e-80	296.2
Bda09g01276	.	1	299	SNARE and Associated Proteins	AT4G03330	67.9	3.0e-107	385.2
Bda03g00658	.	1	279	SNARE and Associated Proteins	AT4G03330	56.1	1.3e-78	290.0
Bda05g01127	.	1	282	SNARE and Associated Proteins	AT4G03330	53.4	2.9e-78	288.9
Bda01g00422	.	1	284	SNARE and Associated Proteins	AT4G03330	52.4	3.6e-76	282.0
Bda01g00430	.	1	284	SNARE and Associated Proteins	AT4G03330	52.4	3.6e-76	282.0
Bda02g00552	.	1	159	SNARE and Associated Proteins	AT4G03330	63.6	3.7e-49	192.2
Bda03g00659	.	1	201	SNARE and Associated Proteins	AT4G03330	52.6	1.4e-48	190.3
Bda09g01276	.	1	303	SNARE and Associated Proteins	AT1G61290	77.2	1.5e-122	436.0
Bda03g00658	.	1	279	SNARE and Associated Proteins	AT1G61290	59.1	3.5e-84	308.5
Bda05g01127	.	1	277	SNARE and Associated Proteins	AT1G61290	58.6	2.3e-83	305.8
Bda01g00422	.	1	294	SNARE and Associated Proteins	AT1G61290	54.7	4.8e-81	298.1
Bda01g00430	.	1	294	SNARE and Associated Proteins	AT1G61290	54.7	4.8e-81	298.1
Bda02g00552	.	1	159	SNARE and Associated Proteins	AT1G61290	74.2	2.7e-60	229.2
Bda09g01276	.	1	303	SNARE and Associated Proteins	AT1G11250	75.6	4.3e-119	424.5
Bda03g00658	.	1	279	SNARE and Associated Proteins	AT1G11250	60.9	3.0e-88	322.0
Bda05g01127	.	1	278	SNARE and Associated Proteins	AT1G11250	59.4	1.2e-87	320.1
Bda01g00422	.	1	284	SNARE and Associated Proteins	AT1G11250	57.7	3.5e-84	308.5
Bda01g00430	.	1	284	SNARE and Associated Proteins	AT1G11250	57.7	3.5e-84	308.5
Bda02g00552	.	1	159	SNARE and Associated Proteins	AT1G11250	70.4	1.2e-55	213.8
Bda06g00358	.	1	307	SNARE and Associated Proteins	AT3G03800	63.2	3.4e-95	345.1
Bda06g00358	.	1	204	SNARE and Associated Proteins	AT5G08080	62.3	7.1e-58	220.7
Bda06g01261	BCT	1	263	SNARE and Associated Proteins	AT5G16830	63.2	5.9e-78	287.7
Bda06g01264	.	1	263	SNARE and Associated Proteins	AT5G16830	63.2	2.3e-77	285.8
Bda08g00639	BCT	1	263	SNARE and Associated Proteins	AT5G16830	62.5	9.5e-76	280.4
Bda08g00639	BCT	1	274	SNARE and Associated Proteins	AT5G46860	70.4	5.3e-84	307.8
Bda06g01264	.	1	263	SNARE and Associated Proteins	AT5G46860	70.0	5.9e-83	304.3
Bda06g01261	BCT	1	263	SNARE and Associated Proteins	AT5G46860	69.6	6.5e-82	300.8
Bda08g00639	BCT	1	257	SNARE and Associated Proteins	AT4G17730	66.5	1.1e-76	283.5
Bda06g01264	.	1	257	SNARE and Associated Proteins	AT4G17730	64.2	5.8e-75	277.7
Bda06g01261	BCT	1	257	SNARE and Associated Proteins	AT4G17730	64.2	2.2e-74	275.8
Bda01g01045	.	1	184	SNARE and Associated Proteins	AT4G17730	54.0	1.2e-43	173.7
Bda13g01915	.	1	176	SNARE and Associated Proteins	AT4G17730	53.1	4.2e-41	165.2
Bda08g00639	BCT	65	256	SNARE and Associated Proteins	AT1G32270	58.3	3.2e-49	192.6
Bda06g01261	BCT	65	256	SNARE and Associated Proteins	AT1G32270	58.3	4.2e-49	192.2
Bda06g01264	.	65	256	SNARE and Associated Proteins	AT1G32270	58.3	4.2e-49	192.2
Bda14g00262	.	1	337	SNARE and Associated Proteins	AT5G05760	65.5	2.0e-112	402.5
Bda13g01286	.	440	803	SNARE and Associated Proteins	AT3G24350	59.5	1.5e-97	353.2
Bda01g00978	.	1	341	SNARE and Associated Proteins	AT3G24350	61.5	9.0e-95	344.0
Bda01g01644	.	1	341	SNARE and Associated Proteins	AT5G26980	75.4	2.6e-125	445.3
Bda01g01638	.	1	341	SNARE and Associated Proteins	AT5G26980	75.4	2.6e-125	445.3
Bda08g01094	.	16	263	SNARE and Associated Proteins	AT5G26980	78.6	7.3e-96	347.4
Bda01g01644	.	1	339	SNARE and Associated Proteins	AT4G02195	63.9	2.6e-101	365.5
Bda01g01638	.	1	339	SNARE and Associated Proteins	AT4G02195	63.9	2.6e-101	365.5
Bda08g01094	.	16	261	SNARE and Associated Proteins	AT4G02195	67.6	6.4e-84	307.8
Bda01g01644	.	1	339	SNARE and Associated Proteins	AT3G05710	75.2	4.8e-127	451.1
Bda01g01638	.	1	339	SNARE and Associated Proteins	AT3G05710	75.2	4.8e-127	451.1
Bda08g01094	.	17	261	SNARE and Associated Proteins	AT3G05710	82.0	4.5e-101	364.8
Bda09g00411	BCT,CCT	1	232	SNARE and Associated Proteins	AT1G16240	72.4	6.2e-89	323.9
Bda05g00693	CCT	1	234	SNARE and Associated Proteins	AT1G16240	60.3	9.7e-74	273.5
Bda07g00381	BCT,CCT	1	195	SNARE and Associated Proteins	AT1G16240	70.8	5.9e-71	264.2
Bda09g00411	BCT,CCT	1	232	SNARE and Associated Proteins	AT1G79590	70.4	2.8e-85	312.0
Bda05g00693	CCT	1	233	SNARE and Associated Proteins	AT1G79590	61.4	1.9e-73	272.7
Bda07g00381	BCT,CCT	1	195	SNARE and Associated Proteins	AT1G79590	69.7	1.3e-71	266.5
Bda09g00403	.	63	264	SNARE and Associated Proteins	AT1G28490	67.3	7.6e-67	250.4
Bda07g00367	.	55	226	SNARE and Associated Proteins	AT1G28490	60.6	2.8e-53	205.3
Bda02g00767	.	1	286	SNARE and Associated Proteins	AT3G09740	56.4	1.6e-80	296.2
Bda02g00767	.	1	286	SNARE and Associated Proteins	AT3G45280	56.4	1.1e-78	290.0
Bda02g00767	.	1	286	SNARE and Associated Proteins	AT3G61450	52.3	9.8e-75	276.9
Bda14g00163	.	65	263	SNARE and Associated Proteins	AT1G51740	65.5	1.3e-65	246.5

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0003497	3	1	2	2	1	1	2	1	1	1	1	1	2	1	1	2	1	2	2	1	1	1	1	1	1	1	1	4	4	2	46

Transcriptome

Select	Gene	Chr	Type	da1	da2	da3	da4	da5	da6	da7	da8	da9	da10
	Bda01g01644	Bda_Chr01	FPKM	9.718931	11.850315	13.268156	14.380983	0.856586	0.994593	0.893248	2.62889	2.671695