Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Bda03g00659 ATGAACGACTTGCTTTCTTCCACCTCCTTCCCTCGGGAAGAACACGTCATCGAGATGACGGACCCGGCGGCGTCTTCTCAGGGTCTCGGCAAATTCTTCAAATACGTCGAGGCCATTAAAGAAGATCTTAGAGAGCTGGAGTGCCGCCGTGTAAATCTCCAGAGCTCTCACGAGAAGAGCAAAACTCTCCACAACGCTAAGGCGGTGAAAGAGCTGAGGTCGAACATGGACGCTGACGTCTCGCTGGCTCTGAGTAAGGCGAAGCTAATCAAGGCCCAGCTCGAGGCTCTCGACTGGTCCAACGCCGCAATTCGAAGCTGTCCTGGGTGCGGCCCGGGATCGTCGTCGGACCGGACGCGGACCTCCGTTGTGAACGGGCTGAGAAAGAATTTGAAGGATTCGATGGAGAACTTCAGCGCTCTGAGGCAGAAGATCTCGTCGGAGTACAGAGAGACTGTACAGCGGAGATATTTCACCGTCACCGGCGAAAATCCCGATGACAAGACTGTTGATCTTTTGATCTCCTTAGGCGAACGCGAGACGTTCTTACAGAAAGCGATACAACAGCAAGTTAGAGGGAGTATTCTGGACACCATAATTGAGAAGAGCACCAGGTGTTCTTTGGACCAGGAGCAAGGGGGAGGGAGGATTTTTATACACAGGACGAGGGTCCACCAGAAGAGCACCAGAAAATGGACTGTTATAGCCATTATTATTTTGCTTATAATCATCTTGATCATCGTTCTCAGCCTTCGGCCATGGAAATAG 768 51.56 MNDLLSSTSFPREEHVIEMTDPAASSQGLGKFFKYVEAIKEDLRELECRRVNLQSSHEKSKTLHNAKAVKELRSNMDADVSLALSKAKLIKAQLEALDWSNAAIRSCPGCGPGSSSDRTRTSVVNGLRKNLKDSMENFSALRQKISSEYRETVQRRYFTVTGENPDDKTVDLLISLGERETFLQKAIQQQVRGSILDTIIEKSTRCSLDQEQGGGRIFIHRTRVHQKSTRKWTVIAIIILLIIILIIVLSLRPWK 255
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
3 5600504 5601364 - Bda016640.1 Bda03g00659 3918

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Bda03g00659 255 Pfam SNARE domain 220 248 IPR000727 -
Bda03g00659 255 Coils Coil 124 144 - -
Bda03g00659 255 PANTHER SYNTAXIN OF PLANTS 122 PROTEIN 9 205 - -
Bda03g00659 255 PANTHER SYNTAXIN OF PLANTS 122 PROTEIN 221 250 - -
Bda03g00659 255 SMART SynN_4 24 150 IPR006011 GO:0016020
Bda03g00659 255 CDD SynN 29 186 IPR006011 GO:0016020
Bda03g00659 255 PANTHER SYNTAXIN 9 205 IPR045242 -
Bda03g00659 255 Coils Coil 36 56 - -
Bda03g00659 255 Gene3D - 25 207 - -
Bda03g00659 255 PANTHER SYNTAXIN 221 250 IPR045242 -
Bda03g00659 255 Pfam Syntaxin 31 205 IPR006011 GO:0016020
Bda03g00659 255 SUPERFAMILY t-snare proteins 29 199 IPR010989 GO:0016020|GO:0016192
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bda03g00659 K08486 STX1B_2_3; syntaxin 1B/2/3 - csv:101208931 303.908
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Bda03g00659 Bda-Chr3:5600504 Bda05g01127 Bda-Chr5:59493476 8.79E-93 dispersed
Bda03g00658 Bda-Chr3:5593717 Bda03g00659 Bda-Chr3:5600504 6.62E-139 tandem
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bda13g01286 . 440 803 SNARE and Associated Proteins AT3G24350 59.5 1.5e-97 353.2
Bda01g00978 . 1 341 SNARE and Associated Proteins AT3G24350 61.5 9.0e-95 344.0
Bda11g01860 . 1 294 SNARE and Associated Proteins AT2G18260 55.0 5.7e-82 301.2
Bda14g01003 . 1 290 SNARE and Associated Proteins AT2G18260 55.0 1.4e-80 296.6
Bda06g00929 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 1.6e-76 283.1
Bda05g01127 . 22 278 SNARE and Associated Proteins AT3G11820 78.6 1.9e-109 392.5
Bda03g00658 . 19 279 SNARE and Associated Proteins AT3G11820 74.3 2.6e-106 382.1
Bda01g00422 . 19 279 SNARE and Associated Proteins AT3G11820 71.6 1.9e-101 365.9
Bda01g00430 . 19 279 SNARE and Associated Proteins AT3G11820 71.6 1.9e-101 365.9
Bda09g01276 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 5.7e-93 337.8
Bda03g00659 . 19 238 SNARE and Associated Proteins AT3G11820 57.1 5.3e-67 251.5
Bda02g00552 . 31 159 SNARE and Associated Proteins AT3G11820 56.6 6.8e-38 154.8
Bda03g00658 . 1 279 SNARE and Associated Proteins AT3G52400 62.5 5.4e-89 324.7
Bda01g00422 . 1 279 SNARE and Associated Proteins AT3G52400 61.2 8.6e-87 317.4
Bda01g00430 . 1 279 SNARE and Associated Proteins AT3G52400 61.2 8.6e-87 317.4
Bda05g01127 . 29 278 SNARE and Associated Proteins AT3G52400 66.4 2.1e-85 312.8
Bda09g01276 . 1 281 SNARE and Associated Proteins AT3G52400 56.0 2.0e-80 296.2
Bda09g01276 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 3.0e-107 385.2
Bda03g00658 . 1 279 SNARE and Associated Proteins AT4G03330 56.1 1.3e-78 290.0
Bda05g01127 . 1 282 SNARE and Associated Proteins AT4G03330 53.4 2.9e-78 288.9
Bda01g00422 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 3.6e-76 282.0
Bda01g00430 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 3.6e-76 282.0
Bda02g00552 . 1 159 SNARE and Associated Proteins AT4G03330 63.6 3.7e-49 192.2
Bda03g00659 . 1 201 SNARE and Associated Proteins AT4G03330 52.6 1.4e-48 190.3
Bda09g01276 . 1 303 SNARE and Associated Proteins AT1G61290 77.2 1.5e-122 436.0
Bda03g00658 . 1 279 SNARE and Associated Proteins AT1G61290 59.1 3.5e-84 308.5
Bda05g01127 . 1 277 SNARE and Associated Proteins AT1G61290 58.6 2.3e-83 305.8
Bda01g00422 . 1 294 SNARE and Associated Proteins AT1G61290 54.7 4.8e-81 298.1
Bda01g00430 . 1 294 SNARE and Associated Proteins AT1G61290 54.7 4.8e-81 298.1
Bda02g00552 . 1 159 SNARE and Associated Proteins AT1G61290 74.2 2.7e-60 229.2
Bda09g01276 . 1 303 SNARE and Associated Proteins AT1G11250 75.6 4.3e-119 424.5
Bda03g00658 . 1 279 SNARE and Associated Proteins AT1G11250 60.9 3.0e-88 322.0
Bda05g01127 . 1 278 SNARE and Associated Proteins AT1G11250 59.4 1.2e-87 320.1
Bda01g00422 . 1 284 SNARE and Associated Proteins AT1G11250 57.7 3.5e-84 308.5
Bda01g00430 . 1 284 SNARE and Associated Proteins AT1G11250 57.7 3.5e-84 308.5
Bda02g00552 . 1 159 SNARE and Associated Proteins AT1G11250 70.4 1.2e-55 213.8
Bda06g00358 . 1 307 SNARE and Associated Proteins AT3G03800 63.2 3.4e-95 345.1
Bda06g00358 . 1 204 SNARE and Associated Proteins AT5G08080 62.3 7.1e-58 220.7
Bda06g01261 BCT 1 263 SNARE and Associated Proteins AT5G16830 63.2 5.9e-78 287.7
Bda06g01264 . 1 263 SNARE and Associated Proteins AT5G16830 63.2 2.3e-77 285.8
Bda08g00639 BCT 1 263 SNARE and Associated Proteins AT5G16830 62.5 9.5e-76 280.4
Bda08g00639 BCT 1 274 SNARE and Associated Proteins AT5G46860 70.4 5.3e-84 307.8
Bda06g01264 . 1 263 SNARE and Associated Proteins AT5G46860 70.0 5.9e-83 304.3
Bda06g01261 BCT 1 263 SNARE and Associated Proteins AT5G46860 69.6 6.5e-82 300.8
Bda08g00639 BCT 1 257 SNARE and Associated Proteins AT4G17730 66.5 1.1e-76 283.5
Bda06g01264 . 1 257 SNARE and Associated Proteins AT4G17730 64.2 5.8e-75 277.7
Bda06g01261 BCT 1 257 SNARE and Associated Proteins AT4G17730 64.2 2.2e-74 275.8
Bda01g01045 . 1 184 SNARE and Associated Proteins AT4G17730 54.0 1.2e-43 173.7
Bda13g01915 . 1 176 SNARE and Associated Proteins AT4G17730 53.1 4.2e-41 165.2
Bda08g00639 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 3.2e-49 192.6
Bda06g01261 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 4.2e-49 192.2
Bda06g01264 . 65 256 SNARE and Associated Proteins AT1G32270 58.3 4.2e-49 192.2
Bda14g00262 . 1 337 SNARE and Associated Proteins AT5G05760 65.5 2.0e-112 402.5
Bda13g01286 . 440 803 SNARE and Associated Proteins AT3G24350 59.5 1.5e-97 353.2
Bda01g00978 . 1 341 SNARE and Associated Proteins AT3G24350 61.5 9.0e-95 344.0
Bda01g01644 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.6e-125 445.3
Bda01g01638 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.6e-125 445.3
Bda08g01094 . 16 263 SNARE and Associated Proteins AT5G26980 78.6 7.3e-96 347.4
Bda01g01644 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bda01g01638 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bda08g01094 . 16 261 SNARE and Associated Proteins AT4G02195 67.6 6.4e-84 307.8
Bda01g01644 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.8e-127 451.1
Bda01g01638 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.8e-127 451.1
Bda08g01094 . 17 261 SNARE and Associated Proteins AT3G05710 82.0 4.5e-101 364.8
Bda09g00411 BCT,CCT 1 232 SNARE and Associated Proteins AT1G16240 72.4 6.2e-89 323.9
Bda05g00693 CCT 1 234 SNARE and Associated Proteins AT1G16240 60.3 9.7e-74 273.5
Bda07g00381 BCT,CCT 1 195 SNARE and Associated Proteins AT1G16240 70.8 5.9e-71 264.2
Bda09g00411 BCT,CCT 1 232 SNARE and Associated Proteins AT1G79590 70.4 2.8e-85 312.0
Bda05g00693 CCT 1 233 SNARE and Associated Proteins AT1G79590 61.4 1.9e-73 272.7
Bda07g00381 BCT,CCT 1 195 SNARE and Associated Proteins AT1G79590 69.7 1.3e-71 266.5
Bda09g00403 . 63 264 SNARE and Associated Proteins AT1G28490 67.3 7.6e-67 250.4
Bda07g00367 . 55 226 SNARE and Associated Proteins AT1G28490 60.6 2.8e-53 205.3
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G09740 56.4 1.6e-80 296.2
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G45280 56.4 1.1e-78 290.0
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G61450 52.3 9.8e-75 276.9
Bda14g00163 . 65 263 SNARE and Associated Proteins AT1G51740 65.5 1.3e-65 246.5
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002313 5 3 2 3 3 1 2 1 1 2 1 2 2 2 2 2 2 2 3 1 3 2 2 2 3 1 2 3 2 0 62
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Bda03g00659 Bda_Chr03 FPKM 8.009919 9.028008 0.0 0.0 0.616188 0.280537 0.0 0.221352 0.0