Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Bda06g00929 ATGAATGATCTTATGACCAAATCATTTCTGAGCTATGTAGAACTAAAGAAACAAGCAATGAAGGATTTGGAAGCTGGGCCAGACATCGAGATGGGGAAGCTTGACCCTGCAGATGAACAAAATCTCTCGCACTTTTTTGAAGAAGTTTCTGCGATCAAAGCAAGCATGGAAGAGATTACTAATCTTCTCTTCGACCTTCAAAACCTGAACGAAGAGGCGAAATCCATTTGTAATGCCAATGTACTTAGTGGAGTCCGAGAAAAAATCAACTCAGACATGGTCGAGGTTCTTCGAAAGGCAAAGAATATCAAAACGAAGCTTGGATTTCTTGATCAATCCAATATCGCCAATCGAAAAGTATCAAAATCTTACAAAGAAGGAAGCCCAGTTGATAGAACGAGAATTTCTGTTACGAATGGGCTGAGAATTAAACTGAGAGATATGATGAATGATTTTCAAGCATTGAGAGAGCAGATTCTGAAGGATCACAAAGAGGGTCTAAAGAGGAGGTATTTTGCTGCAACTGGAGAAGAAGCTAGCGAGGAAGCCATAGAAAGGATGATTTCGGTAGGTGGGAAAGAGAAGATCTTTGAAGGGAAGAAAGAGTTGTTAATGGAGAATGAGGAGAGAGAAGAAGCTTTGAAGGAGATACAGAGGAGCTTGAAGGAGCTTCATCAGGTTTTTCTTGATATGGCTGTTCTGGTAGAAACTCAAGGAGAGCATATGAATAATATTGAGCAGAATATGAGTTGGGCTGGAGCTCATATCCAGGATGGAACAAAGGAGCTGTTGGATGCCAAGAAATTGAAGAGCAGAGCTCAATGGACTTACTGGATTGTAGCTCTGGTTTTAATTCTGCTGTTCATTTGCCTGATTTCTACCTTGGTTTTCTGA 894 40.6 MNDLMTKSFLSYVELKKQAMKDLEAGPDIEMGKLDPADEQNLSHFFEEVSAIKASMEEITNLLFDLQNLNEEAKSICNANVLSGVREKINSDMVEVLRKAKNIKTKLGFLDQSNIANRKVSKSYKEGSPVDRTRISVTNGLRIKLRDMMNDFQALREQILKDHKEGLKRRYFAATGEEASEEAIERMISVGGKEKIFEGKKELLMENEEREEALKEIQRSLKELHQVFLDMAVLVETQGEHMNNIEQNMSWAGAHIQDGTKELLDAKKLKSRAQWTYWIVALVLILLFICLISTLVF 297
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
6 25095255 25096148 + Bda022551.1 Bda06g00929 8511

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Bda06g00929 297 PANTHER SYNTAXIN 4 293 IPR045242 -
Bda06g00929 297 Coils Coil 52 72 - -
Bda06g00929 297 CDD SNARE_syntaxin1-like 208 263 - -
Bda06g00929 297 CDD SynN 42 192 IPR006011 GO:0016020
Bda06g00929 297 SUPERFAMILY t-snare proteins 41 259 IPR010989 GO:0016020|GO:0016192
Bda06g00929 297 Pfam Syntaxin 45 239 IPR006011 GO:0016020
Bda06g00929 297 Gene3D - 37 167 - -
Bda06g00929 297 SMART SynN_4 37 164 IPR006011 GO:0016020
Bda06g00929 297 Gene3D - 197 296 - -
Bda06g00929 297 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 204 266 IPR000727 -
Bda06g00929 297 PANTHER SYNTAXIN-112 4 293 - -
Bda06g00929 297 SMART tSNARE_6 199 266 IPR000727 -
Bda06g00929 297 Coils Coil 200 227 - -
Bda06g00929 297 ProSitePatterns Syntaxin / epimorphin family signature. 210 249 IPR006012 GO:0005484|GO:0006886|GO:0016020
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bda06g00929 K08486 STX1B_2_3; syntaxin 1B/2/3 - csin:114258522 410.994
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Bda06g00358 Bda-Chr6:5725017 Bda06g00929 Bda-Chr6:25095255 1.85E-55 dispersed
Bda06g00929 Bda-Chr6:25095255 Bda11g01860 Bda-Chr11:53717274 8.95E-117 dispersed
Bda13g01915 Bda-Chr13:43552402 Bda06g00929 Bda-Chr6:25095255 1.46E-07 dispersed
Bda06g00929 Bda-Chr6:25095255 Bda14g01003 Bda-Chr14:8450716 4.15E-128 transposed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bda13g01286 . 440 803 SNARE and Associated Proteins AT3G24350 59.5 1.5e-97 353.2
Bda01g00978 . 1 341 SNARE and Associated Proteins AT3G24350 61.5 9.0e-95 344.0
Bda11g01860 . 1 294 SNARE and Associated Proteins AT2G18260 55.0 5.7e-82 301.2
Bda14g01003 . 1 290 SNARE and Associated Proteins AT2G18260 55.0 1.4e-80 296.6
Bda06g00929 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 1.6e-76 283.1
Bda05g01127 . 22 278 SNARE and Associated Proteins AT3G11820 78.6 1.9e-109 392.5
Bda03g00658 . 19 279 SNARE and Associated Proteins AT3G11820 74.3 2.6e-106 382.1
Bda01g00422 . 19 279 SNARE and Associated Proteins AT3G11820 71.6 1.9e-101 365.9
Bda01g00430 . 19 279 SNARE and Associated Proteins AT3G11820 71.6 1.9e-101 365.9
Bda09g01276 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 5.7e-93 337.8
Bda03g00659 . 19 238 SNARE and Associated Proteins AT3G11820 57.1 5.3e-67 251.5
Bda02g00552 . 31 159 SNARE and Associated Proteins AT3G11820 56.6 6.8e-38 154.8
Bda03g00658 . 1 279 SNARE and Associated Proteins AT3G52400 62.5 5.4e-89 324.7
Bda01g00422 . 1 279 SNARE and Associated Proteins AT3G52400 61.2 8.6e-87 317.4
Bda01g00430 . 1 279 SNARE and Associated Proteins AT3G52400 61.2 8.6e-87 317.4
Bda05g01127 . 29 278 SNARE and Associated Proteins AT3G52400 66.4 2.1e-85 312.8
Bda09g01276 . 1 281 SNARE and Associated Proteins AT3G52400 56.0 2.0e-80 296.2
Bda09g01276 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 3.0e-107 385.2
Bda03g00658 . 1 279 SNARE and Associated Proteins AT4G03330 56.1 1.3e-78 290.0
Bda05g01127 . 1 282 SNARE and Associated Proteins AT4G03330 53.4 2.9e-78 288.9
Bda01g00422 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 3.6e-76 282.0
Bda01g00430 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 3.6e-76 282.0
Bda02g00552 . 1 159 SNARE and Associated Proteins AT4G03330 63.6 3.7e-49 192.2
Bda03g00659 . 1 201 SNARE and Associated Proteins AT4G03330 52.6 1.4e-48 190.3
Bda09g01276 . 1 303 SNARE and Associated Proteins AT1G61290 77.2 1.5e-122 436.0
Bda03g00658 . 1 279 SNARE and Associated Proteins AT1G61290 59.1 3.5e-84 308.5
Bda05g01127 . 1 277 SNARE and Associated Proteins AT1G61290 58.6 2.3e-83 305.8
Bda01g00422 . 1 294 SNARE and Associated Proteins AT1G61290 54.7 4.8e-81 298.1
Bda01g00430 . 1 294 SNARE and Associated Proteins AT1G61290 54.7 4.8e-81 298.1
Bda02g00552 . 1 159 SNARE and Associated Proteins AT1G61290 74.2 2.7e-60 229.2
Bda09g01276 . 1 303 SNARE and Associated Proteins AT1G11250 75.6 4.3e-119 424.5
Bda03g00658 . 1 279 SNARE and Associated Proteins AT1G11250 60.9 3.0e-88 322.0
Bda05g01127 . 1 278 SNARE and Associated Proteins AT1G11250 59.4 1.2e-87 320.1
Bda01g00422 . 1 284 SNARE and Associated Proteins AT1G11250 57.7 3.5e-84 308.5
Bda01g00430 . 1 284 SNARE and Associated Proteins AT1G11250 57.7 3.5e-84 308.5
Bda02g00552 . 1 159 SNARE and Associated Proteins AT1G11250 70.4 1.2e-55 213.8
Bda06g00358 . 1 307 SNARE and Associated Proteins AT3G03800 63.2 3.4e-95 345.1
Bda06g00358 . 1 204 SNARE and Associated Proteins AT5G08080 62.3 7.1e-58 220.7
Bda06g01261 BCT 1 263 SNARE and Associated Proteins AT5G16830 63.2 5.9e-78 287.7
Bda06g01264 . 1 263 SNARE and Associated Proteins AT5G16830 63.2 2.3e-77 285.8
Bda08g00639 BCT 1 263 SNARE and Associated Proteins AT5G16830 62.5 9.5e-76 280.4
Bda08g00639 BCT 1 274 SNARE and Associated Proteins AT5G46860 70.4 5.3e-84 307.8
Bda06g01264 . 1 263 SNARE and Associated Proteins AT5G46860 70.0 5.9e-83 304.3
Bda06g01261 BCT 1 263 SNARE and Associated Proteins AT5G46860 69.6 6.5e-82 300.8
Bda08g00639 BCT 1 257 SNARE and Associated Proteins AT4G17730 66.5 1.1e-76 283.5
Bda06g01264 . 1 257 SNARE and Associated Proteins AT4G17730 64.2 5.8e-75 277.7
Bda06g01261 BCT 1 257 SNARE and Associated Proteins AT4G17730 64.2 2.2e-74 275.8
Bda01g01045 . 1 184 SNARE and Associated Proteins AT4G17730 54.0 1.2e-43 173.7
Bda13g01915 . 1 176 SNARE and Associated Proteins AT4G17730 53.1 4.2e-41 165.2
Bda08g00639 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 3.2e-49 192.6
Bda06g01261 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 4.2e-49 192.2
Bda06g01264 . 65 256 SNARE and Associated Proteins AT1G32270 58.3 4.2e-49 192.2
Bda14g00262 . 1 337 SNARE and Associated Proteins AT5G05760 65.5 2.0e-112 402.5
Bda13g01286 . 440 803 SNARE and Associated Proteins AT3G24350 59.5 1.5e-97 353.2
Bda01g00978 . 1 341 SNARE and Associated Proteins AT3G24350 61.5 9.0e-95 344.0
Bda01g01644 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.6e-125 445.3
Bda01g01638 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.6e-125 445.3
Bda08g01094 . 16 263 SNARE and Associated Proteins AT5G26980 78.6 7.3e-96 347.4
Bda01g01644 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bda01g01638 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bda08g01094 . 16 261 SNARE and Associated Proteins AT4G02195 67.6 6.4e-84 307.8
Bda01g01644 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.8e-127 451.1
Bda01g01638 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.8e-127 451.1
Bda08g01094 . 17 261 SNARE and Associated Proteins AT3G05710 82.0 4.5e-101 364.8
Bda09g00411 BCT,CCT 1 232 SNARE and Associated Proteins AT1G16240 72.4 6.2e-89 323.9
Bda05g00693 CCT 1 234 SNARE and Associated Proteins AT1G16240 60.3 9.7e-74 273.5
Bda07g00381 BCT,CCT 1 195 SNARE and Associated Proteins AT1G16240 70.8 5.9e-71 264.2
Bda09g00411 BCT,CCT 1 232 SNARE and Associated Proteins AT1G79590 70.4 2.8e-85 312.0
Bda05g00693 CCT 1 233 SNARE and Associated Proteins AT1G79590 61.4 1.9e-73 272.7
Bda07g00381 BCT,CCT 1 195 SNARE and Associated Proteins AT1G79590 69.7 1.3e-71 266.5
Bda09g00403 . 63 264 SNARE and Associated Proteins AT1G28490 67.3 7.6e-67 250.4
Bda07g00367 . 55 226 SNARE and Associated Proteins AT1G28490 60.6 2.8e-53 205.3
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G09740 56.4 1.6e-80 296.2
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G45280 56.4 1.1e-78 290.0
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G61450 52.3 9.8e-75 276.9
Bda14g00163 . 65 263 SNARE and Associated Proteins AT1G51740 65.5 1.3e-65 246.5
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002433 5 3 5 4 2 1 2 1 2 2 1 1 2 1 2 1 1 3 2 1 2 3 2 2 1 1 1 2 1 4 61
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Bda06g00929 Bda_Chr06 FPKM 0.903414 1.164913 0.997894 1.020345 3.291497 3.579903 3.202954 2.389898 2.977837