Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Bda06g01261 ATGAGTTTTCAAGATATCGAGGCGGGTCGGCCCTTTGCTTATTCGAGGCGGGATGCAATCAATGGCAAGCAGGACCCGACACAGGCCGTCGCTTCTGGTATATTTCAGATCAACACCGCTGTCGCCACCTTTCTGAGGCTCGTCAATACTCTGGGAACTCCGAAGGACACCCCCGAGCTCCGAGAAAAGCTGCATAAGACGAGGCTTCATATTGGACAGTTGGTGAAAGATACTTCTGCAAGACTAAAACAAGCTAGTGAAATAGATCATCAAACTGAAGTTAAAGCCAGCAAGAAAATTGCTGATGCAAAGCTCGCTAAAGACTTTCAAGCCGTGCTGAAAGAATTTCAAAAGGGTCAACGACTTGCAGCCGAGAGAGAAACTGCATATACTCCTTTTGTTCCTCAAGCGGTTCTCCCTTCTAGCTACACGGCCAGCGAGATCGATGTACGATCAGATAAGAATCCCGAACAGCGTGCACTCCTTGTTGAATCTAGGAGACAAGAAGTACTGCATTTGGACAACGAAATTTCGTTTAACGAGGCAATAATCGAGGAAAGAGAGCAAGGGATCGAAGAAATACAACAGCAAATTGGGGAAGTGAATGAGATTTTCAAAGATTTAGCAGTTCTGGTGCATGAGCAGGGAGCCATGATTGACGATATTGGATCCAACATCGAGAGTTCCCACGCTGCAACTTCGCAAGCAACTTCCCAACTCGTGAAAGCCGCGAAGACCCAAAGATCAAATTCATCACTGTCCTGCTTGCTGTTGGTGATCTTTGGGATATTGCTTCTCATTGTTATCATACTCGTCGCTGCTTGA 825 46.42 MSFQDIEAGRPFAYSRRDAINGKQDPTQAVASGIFQINTAVATFLRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSARLKQASEIDHQTEVKASKKIADAKLAKDFQAVLKEFQKGQRLAAERETAYTPFVPQAVLPSSYTASEIDVRSDKNPEQRALLVESRRQEVLHLDNEISFNEAIIEEREQGIEEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIESSHAATSQATSQLVKAAKTQRSNSSLSCLLLVIFGILLLIVIILVAA 274
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
6 43102901 43106337 + Bda023101.1 Bda06g01261 8843

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Bda06g01261 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020|GO:0016192
Bda06g01261 274 PANTHER SYNTAXIN 7 273 IPR045242 -
Bda06g01261 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Bda06g01261 274 PANTHER SYNTAXIN OF PLANTS PROTEIN 7 273 - -
Bda06g01261 274 Gene3D - 20 134 - -
Bda06g01261 274 SMART tSNARE_6 176 243 IPR000727 -
Bda06g01261 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484|GO:0006886|GO:0016020
Bda06g01261 274 Pfam Syntaxin-like protein 31 130 IPR006011 GO:0016020
Bda06g01261 274 Gene3D - 174 274 - -
Bda06g01261 274 CDD SNARE_Qa 184 242 - -
Bda06g01261 274 Pfam SNARE domain 218 269 IPR000727 -
Bda06g01261 274 SMART SynN_4 16 128 IPR006011 GO:0016020
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bda06g01261 - - K08488 bhj:120089793 414.846
       

WGDs- Genes


Select Gene_1 Gene_2 Event_name
Bda06g01261 Bda08g00639 BCT
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Bda06g01261 Bda-Chr6:43102901 Bda13g01915 Bda-Chr13:43552402 1.24E-80 dispersed
Bda06g01261 Bda-Chr6:43102901 Bda06g01264 Bda-Chr6:43152956 0 proximal
Bda06g01261 Bda-Chr6:43102901 Bda08g00639 Bda-Chr8:6575545 2.61E-175 wgd
       

Deco-Alignment


Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bda13g01286 . 440 803 SNARE and Associated Proteins AT3G24350 59.5 1.5e-97 353.2
Bda01g00978 . 1 341 SNARE and Associated Proteins AT3G24350 61.5 9.0e-95 344.0
Bda11g01860 . 1 294 SNARE and Associated Proteins AT2G18260 55.0 5.7e-82 301.2
Bda14g01003 . 1 290 SNARE and Associated Proteins AT2G18260 55.0 1.4e-80 296.6
Bda06g00929 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 1.6e-76 283.1
Bda05g01127 . 22 278 SNARE and Associated Proteins AT3G11820 78.6 1.9e-109 392.5
Bda03g00658 . 19 279 SNARE and Associated Proteins AT3G11820 74.3 2.6e-106 382.1
Bda01g00422 . 19 279 SNARE and Associated Proteins AT3G11820 71.6 1.9e-101 365.9
Bda01g00430 . 19 279 SNARE and Associated Proteins AT3G11820 71.6 1.9e-101 365.9
Bda09g01276 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 5.7e-93 337.8
Bda03g00659 . 19 238 SNARE and Associated Proteins AT3G11820 57.1 5.3e-67 251.5
Bda02g00552 . 31 159 SNARE and Associated Proteins AT3G11820 56.6 6.8e-38 154.8
Bda03g00658 . 1 279 SNARE and Associated Proteins AT3G52400 62.5 5.4e-89 324.7
Bda01g00422 . 1 279 SNARE and Associated Proteins AT3G52400 61.2 8.6e-87 317.4
Bda01g00430 . 1 279 SNARE and Associated Proteins AT3G52400 61.2 8.6e-87 317.4
Bda05g01127 . 29 278 SNARE and Associated Proteins AT3G52400 66.4 2.1e-85 312.8
Bda09g01276 . 1 281 SNARE and Associated Proteins AT3G52400 56.0 2.0e-80 296.2
Bda09g01276 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 3.0e-107 385.2
Bda03g00658 . 1 279 SNARE and Associated Proteins AT4G03330 56.1 1.3e-78 290.0
Bda05g01127 . 1 282 SNARE and Associated Proteins AT4G03330 53.4 2.9e-78 288.9
Bda01g00422 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 3.6e-76 282.0
Bda01g00430 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 3.6e-76 282.0
Bda02g00552 . 1 159 SNARE and Associated Proteins AT4G03330 63.6 3.7e-49 192.2
Bda03g00659 . 1 201 SNARE and Associated Proteins AT4G03330 52.6 1.4e-48 190.3
Bda09g01276 . 1 303 SNARE and Associated Proteins AT1G61290 77.2 1.5e-122 436.0
Bda03g00658 . 1 279 SNARE and Associated Proteins AT1G61290 59.1 3.5e-84 308.5
Bda05g01127 . 1 277 SNARE and Associated Proteins AT1G61290 58.6 2.3e-83 305.8
Bda01g00422 . 1 294 SNARE and Associated Proteins AT1G61290 54.7 4.8e-81 298.1
Bda01g00430 . 1 294 SNARE and Associated Proteins AT1G61290 54.7 4.8e-81 298.1
Bda02g00552 . 1 159 SNARE and Associated Proteins AT1G61290 74.2 2.7e-60 229.2
Bda09g01276 . 1 303 SNARE and Associated Proteins AT1G11250 75.6 4.3e-119 424.5
Bda03g00658 . 1 279 SNARE and Associated Proteins AT1G11250 60.9 3.0e-88 322.0
Bda05g01127 . 1 278 SNARE and Associated Proteins AT1G11250 59.4 1.2e-87 320.1
Bda01g00422 . 1 284 SNARE and Associated Proteins AT1G11250 57.7 3.5e-84 308.5
Bda01g00430 . 1 284 SNARE and Associated Proteins AT1G11250 57.7 3.5e-84 308.5
Bda02g00552 . 1 159 SNARE and Associated Proteins AT1G11250 70.4 1.2e-55 213.8
Bda06g00358 . 1 307 SNARE and Associated Proteins AT3G03800 63.2 3.4e-95 345.1
Bda06g00358 . 1 204 SNARE and Associated Proteins AT5G08080 62.3 7.1e-58 220.7
Bda06g01261 BCT 1 263 SNARE and Associated Proteins AT5G16830 63.2 5.9e-78 287.7
Bda06g01264 . 1 263 SNARE and Associated Proteins AT5G16830 63.2 2.3e-77 285.8
Bda08g00639 BCT 1 263 SNARE and Associated Proteins AT5G16830 62.5 9.5e-76 280.4
Bda08g00639 BCT 1 274 SNARE and Associated Proteins AT5G46860 70.4 5.3e-84 307.8
Bda06g01264 . 1 263 SNARE and Associated Proteins AT5G46860 70.0 5.9e-83 304.3
Bda06g01261 BCT 1 263 SNARE and Associated Proteins AT5G46860 69.6 6.5e-82 300.8
Bda08g00639 BCT 1 257 SNARE and Associated Proteins AT4G17730 66.5 1.1e-76 283.5
Bda06g01264 . 1 257 SNARE and Associated Proteins AT4G17730 64.2 5.8e-75 277.7
Bda06g01261 BCT 1 257 SNARE and Associated Proteins AT4G17730 64.2 2.2e-74 275.8
Bda01g01045 . 1 184 SNARE and Associated Proteins AT4G17730 54.0 1.2e-43 173.7
Bda13g01915 . 1 176 SNARE and Associated Proteins AT4G17730 53.1 4.2e-41 165.2
Bda08g00639 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 3.2e-49 192.6
Bda06g01261 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 4.2e-49 192.2
Bda06g01264 . 65 256 SNARE and Associated Proteins AT1G32270 58.3 4.2e-49 192.2
Bda14g00262 . 1 337 SNARE and Associated Proteins AT5G05760 65.5 2.0e-112 402.5
Bda13g01286 . 440 803 SNARE and Associated Proteins AT3G24350 59.5 1.5e-97 353.2
Bda01g00978 . 1 341 SNARE and Associated Proteins AT3G24350 61.5 9.0e-95 344.0
Bda01g01644 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.6e-125 445.3
Bda01g01638 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.6e-125 445.3
Bda08g01094 . 16 263 SNARE and Associated Proteins AT5G26980 78.6 7.3e-96 347.4
Bda01g01644 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bda01g01638 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bda08g01094 . 16 261 SNARE and Associated Proteins AT4G02195 67.6 6.4e-84 307.8
Bda01g01644 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.8e-127 451.1
Bda01g01638 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.8e-127 451.1
Bda08g01094 . 17 261 SNARE and Associated Proteins AT3G05710 82.0 4.5e-101 364.8
Bda09g00411 BCT,CCT 1 232 SNARE and Associated Proteins AT1G16240 72.4 6.2e-89 323.9
Bda05g00693 CCT 1 234 SNARE and Associated Proteins AT1G16240 60.3 9.7e-74 273.5
Bda07g00381 BCT,CCT 1 195 SNARE and Associated Proteins AT1G16240 70.8 5.9e-71 264.2
Bda09g00411 BCT,CCT 1 232 SNARE and Associated Proteins AT1G79590 70.4 2.8e-85 312.0
Bda05g00693 CCT 1 233 SNARE and Associated Proteins AT1G79590 61.4 1.9e-73 272.7
Bda07g00381 BCT,CCT 1 195 SNARE and Associated Proteins AT1G79590 69.7 1.3e-71 266.5
Bda09g00403 . 63 264 SNARE and Associated Proteins AT1G28490 67.3 7.6e-67 250.4
Bda07g00367 . 55 226 SNARE and Associated Proteins AT1G28490 60.6 2.8e-53 205.3
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G09740 56.4 1.6e-80 296.2
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G45280 56.4 1.1e-78 290.0
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G61450 52.3 9.8e-75 276.9
Bda14g00163 . 65 263 SNARE and Associated Proteins AT1G51740 65.5 1.3e-65 246.5
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45
       

Transcriptome


Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Bda06g01261 Bda_Chr06 FPKM 1.968285 2.116813 1.919876 1.657064 30.317932 30.952713 30.833033 1.73618 1.461806