Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Bda09g00403 ATGCCTTCAGCTCAAGATCCATTCTACGTTGTGAAGGATGAAATCCAAGAATCTATTGATAAGTTGCAACAAACTTTTCACCGATGGGAGCTCATTTCTGATTTAGGAGAGCGATCAAAACTTACAAATGAGCTGCTTGCTAGCTGTGATAGTATTGAGTGGCAGGTAACCCATATATCTTCCACTCTATCAAGTACATTTTTATGGTGGAAGGTAGATGAATTAGACAAGGCTATAGCTGTTGCTGTCAGAGATCCGGCTTGGTATGGAATTGATGAAGTGGAGCTTGAAAAACGGAGAAGATGGACCAGTACAGCTCGCGCTCAGGTTGGCTCTGTGAAAAAGGCGGTGAAAACTGGGAAGGAGCTGCATGGTATTGGCAATACAACCACAAATATGAATGGAATACGTCGAGAACTGTTGAGACTGCCTAATTCTAATGAAGGAGACCGGGCCAACCAGTACGATGTTCAAGTTAATGATGATTTCATAGCTTCCGAATCAGATCGGCAGTTGCTTCTCATAAAGCGACAAGATGAAGAATTGGATGAGCTCAGTGCCAGCGTGGAGAGAATTGGAGGAGTTGGGCTAACAATACATGATGAACTCCTTGCCCAGGAGAAAATTATTGATGACTTAGGAACGGAACTGGATAGTACATCAAATCGTCTTGACTTTGTTCAGAAAAAAGTAGCCGTGGTCATGAAGAAGGCTGGTCTTAAGGGGCAGATAATGATGATTGCGTTTTTAGTGGTTTTGTTCATAATTCTCTTTGTGCTGGTGTTTTTAACTTAG 795 42.26 MPSAQDPFYVVKDEIQESIDKLQQTFHRWELISDLGERSKLTNELLASCDSIEWQVTHISSTLSSTFLWWKVDELDKAIAVAVRDPAWYGIDEVELEKRRRWTSTARAQVGSVKKAVKTGKELHGIGNTTTNMNGIRRELLRLPNSNEGDRANQYDVQVNDDFIASESDRQLLLIKRQDEELDELSASVERIGGVGLTIHDELLAQEKIIDDLGTELDSTSNRLDFVQKKVAVVMKKAGLKGQIMMIAFLVVLFIILFVLVFLT 264
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
9 5049766 5052269 - Bda030983.2 Bda09g00403 12653

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Bda09g00403 264 Pfam Syntaxin 6, N-terminal 6 114 IPR015260 GO:0016020|GO:0048193
Bda09g00403 264 PANTHER SYNTAXIN-61 1 263 - -
Bda09g00403 264 Coils Coil 210 230 - -
Bda09g00403 264 SUPERFAMILY SNARE fusion complex 171 234 - -
Bda09g00403 264 SUPERFAMILY t-snare proteins 5 117 IPR010989 GO:0016020|GO:0016192
Bda09g00403 264 Gene3D - 2 63 - -
Bda09g00403 264 Gene3D - 64 120 - -
Bda09g00403 264 SMART tSNARE_6 167 234 IPR000727 -
Bda09g00403 264 PANTHER SYNTAXIN 1 263 IPR045242 -
Bda09g00403 264 CDD SNARE_Qc 175 232 - -
Bda09g00403 264 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 172 234 IPR000727 -
Bda09g00403 264 Pfam SNARE domain 209 260 IPR000727 -
Bda09g00403 264 Gene3D - 179 241 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bda09g00403 K08500 SYP6; syntaxin of plants SYP6 - qsu:112025744 342.813
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Bda09g00403 Bda-Chr9:5049766 Bda09g00411 Bda-Chr9:5111043 2.37E-06 proximal
Bda07g00367 Bda-Chr7:4669492 Bda09g00403 Bda-Chr9:5049766 3.07E-135 wgd
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bda13g01286 . 440 803 SNARE and Associated Proteins AT3G24350 59.5 1.5e-97 353.2
Bda01g00978 . 1 341 SNARE and Associated Proteins AT3G24350 61.5 9.0e-95 344.0
Bda11g01860 . 1 294 SNARE and Associated Proteins AT2G18260 55.0 5.7e-82 301.2
Bda14g01003 . 1 290 SNARE and Associated Proteins AT2G18260 55.0 1.4e-80 296.6
Bda06g00929 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 1.6e-76 283.1
Bda05g01127 . 22 278 SNARE and Associated Proteins AT3G11820 78.6 1.9e-109 392.5
Bda03g00658 . 19 279 SNARE and Associated Proteins AT3G11820 74.3 2.6e-106 382.1
Bda01g00422 . 19 279 SNARE and Associated Proteins AT3G11820 71.6 1.9e-101 365.9
Bda01g00430 . 19 279 SNARE and Associated Proteins AT3G11820 71.6 1.9e-101 365.9
Bda09g01276 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 5.7e-93 337.8
Bda03g00659 . 19 238 SNARE and Associated Proteins AT3G11820 57.1 5.3e-67 251.5
Bda02g00552 . 31 159 SNARE and Associated Proteins AT3G11820 56.6 6.8e-38 154.8
Bda03g00658 . 1 279 SNARE and Associated Proteins AT3G52400 62.5 5.4e-89 324.7
Bda01g00422 . 1 279 SNARE and Associated Proteins AT3G52400 61.2 8.6e-87 317.4
Bda01g00430 . 1 279 SNARE and Associated Proteins AT3G52400 61.2 8.6e-87 317.4
Bda05g01127 . 29 278 SNARE and Associated Proteins AT3G52400 66.4 2.1e-85 312.8
Bda09g01276 . 1 281 SNARE and Associated Proteins AT3G52400 56.0 2.0e-80 296.2
Bda09g01276 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 3.0e-107 385.2
Bda03g00658 . 1 279 SNARE and Associated Proteins AT4G03330 56.1 1.3e-78 290.0
Bda05g01127 . 1 282 SNARE and Associated Proteins AT4G03330 53.4 2.9e-78 288.9
Bda01g00422 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 3.6e-76 282.0
Bda01g00430 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 3.6e-76 282.0
Bda02g00552 . 1 159 SNARE and Associated Proteins AT4G03330 63.6 3.7e-49 192.2
Bda03g00659 . 1 201 SNARE and Associated Proteins AT4G03330 52.6 1.4e-48 190.3
Bda09g01276 . 1 303 SNARE and Associated Proteins AT1G61290 77.2 1.5e-122 436.0
Bda03g00658 . 1 279 SNARE and Associated Proteins AT1G61290 59.1 3.5e-84 308.5
Bda05g01127 . 1 277 SNARE and Associated Proteins AT1G61290 58.6 2.3e-83 305.8
Bda01g00422 . 1 294 SNARE and Associated Proteins AT1G61290 54.7 4.8e-81 298.1
Bda01g00430 . 1 294 SNARE and Associated Proteins AT1G61290 54.7 4.8e-81 298.1
Bda02g00552 . 1 159 SNARE and Associated Proteins AT1G61290 74.2 2.7e-60 229.2
Bda09g01276 . 1 303 SNARE and Associated Proteins AT1G11250 75.6 4.3e-119 424.5
Bda03g00658 . 1 279 SNARE and Associated Proteins AT1G11250 60.9 3.0e-88 322.0
Bda05g01127 . 1 278 SNARE and Associated Proteins AT1G11250 59.4 1.2e-87 320.1
Bda01g00422 . 1 284 SNARE and Associated Proteins AT1G11250 57.7 3.5e-84 308.5
Bda01g00430 . 1 284 SNARE and Associated Proteins AT1G11250 57.7 3.5e-84 308.5
Bda02g00552 . 1 159 SNARE and Associated Proteins AT1G11250 70.4 1.2e-55 213.8
Bda06g00358 . 1 307 SNARE and Associated Proteins AT3G03800 63.2 3.4e-95 345.1
Bda06g00358 . 1 204 SNARE and Associated Proteins AT5G08080 62.3 7.1e-58 220.7
Bda06g01261 BCT 1 263 SNARE and Associated Proteins AT5G16830 63.2 5.9e-78 287.7
Bda06g01264 . 1 263 SNARE and Associated Proteins AT5G16830 63.2 2.3e-77 285.8
Bda08g00639 BCT 1 263 SNARE and Associated Proteins AT5G16830 62.5 9.5e-76 280.4
Bda08g00639 BCT 1 274 SNARE and Associated Proteins AT5G46860 70.4 5.3e-84 307.8
Bda06g01264 . 1 263 SNARE and Associated Proteins AT5G46860 70.0 5.9e-83 304.3
Bda06g01261 BCT 1 263 SNARE and Associated Proteins AT5G46860 69.6 6.5e-82 300.8
Bda08g00639 BCT 1 257 SNARE and Associated Proteins AT4G17730 66.5 1.1e-76 283.5
Bda06g01264 . 1 257 SNARE and Associated Proteins AT4G17730 64.2 5.8e-75 277.7
Bda06g01261 BCT 1 257 SNARE and Associated Proteins AT4G17730 64.2 2.2e-74 275.8
Bda01g01045 . 1 184 SNARE and Associated Proteins AT4G17730 54.0 1.2e-43 173.7
Bda13g01915 . 1 176 SNARE and Associated Proteins AT4G17730 53.1 4.2e-41 165.2
Bda08g00639 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 3.2e-49 192.6
Bda06g01261 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 4.2e-49 192.2
Bda06g01264 . 65 256 SNARE and Associated Proteins AT1G32270 58.3 4.2e-49 192.2
Bda14g00262 . 1 337 SNARE and Associated Proteins AT5G05760 65.5 2.0e-112 402.5
Bda13g01286 . 440 803 SNARE and Associated Proteins AT3G24350 59.5 1.5e-97 353.2
Bda01g00978 . 1 341 SNARE and Associated Proteins AT3G24350 61.5 9.0e-95 344.0
Bda01g01644 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.6e-125 445.3
Bda01g01638 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.6e-125 445.3
Bda08g01094 . 16 263 SNARE and Associated Proteins AT5G26980 78.6 7.3e-96 347.4
Bda01g01644 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bda01g01638 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bda08g01094 . 16 261 SNARE and Associated Proteins AT4G02195 67.6 6.4e-84 307.8
Bda01g01644 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.8e-127 451.1
Bda01g01638 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.8e-127 451.1
Bda08g01094 . 17 261 SNARE and Associated Proteins AT3G05710 82.0 4.5e-101 364.8
Bda09g00411 BCT,CCT 1 232 SNARE and Associated Proteins AT1G16240 72.4 6.2e-89 323.9
Bda05g00693 CCT 1 234 SNARE and Associated Proteins AT1G16240 60.3 9.7e-74 273.5
Bda07g00381 BCT,CCT 1 195 SNARE and Associated Proteins AT1G16240 70.8 5.9e-71 264.2
Bda09g00411 BCT,CCT 1 232 SNARE and Associated Proteins AT1G79590 70.4 2.8e-85 312.0
Bda05g00693 CCT 1 233 SNARE and Associated Proteins AT1G79590 61.4 1.9e-73 272.7
Bda07g00381 BCT,CCT 1 195 SNARE and Associated Proteins AT1G79590 69.7 1.3e-71 266.5
Bda09g00403 . 63 264 SNARE and Associated Proteins AT1G28490 67.3 7.6e-67 250.4
Bda07g00367 . 55 226 SNARE and Associated Proteins AT1G28490 60.6 2.8e-53 205.3
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G09740 56.4 1.6e-80 296.2
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G45280 56.4 1.1e-78 290.0
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G61450 52.3 9.8e-75 276.9
Bda14g00163 . 65 263 SNARE and Associated Proteins AT1G51740 65.5 1.3e-65 246.5
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003549 2 1 2 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 5 4 0 44
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Bda09g00403 Bda_Chr09 FPKM 7.316934 7.569067 15.328386 16.440823 10.203396 6.610255 7.768736 35.184441 35.611515