Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Bda09g00411 ATGGCATCCACTTCGGATTCATGGGTGAAGGAATATAATGAAGCAGTGAAACTTGCTGATGATATCAATGGAATGATCTCTGAGCGTAGTTCGGTTTCTGTATCTGGACCAGAAGCTCAGCGTTATGCCTCTGCTATTCGCAGAAAGATCACAATATTGGGAACGAGGCTTGATAGCCTACTGGCCCTCTTGTCTAGAATTCCTGGAAAACCCATCTCTGATAAAGAGATGAATCGCCGGAGGGACATGGTTACAAATTTAAGATCAAAAGTTAACCAAATGGCCTCACAATTGAACATGTCAAACTTTGCTAATCGGGACAGCTTGCTTGGTCCAGAAATAAAAGCAGCTGATCCCATGAACAGAACAGTAGGCCTGGACAACCAAGGACTAGTTGGTTTACAACGACAAATTATAAAAGAACAAGACGAGGACCTTCAAAAGCTGGAGGAGACTGTAATAAGTACAAAACATATTGCTTTGGCAGTCAATGAAGAACTTGACCTTCACACCAGACTAATTGATGACTTGGATCAACACGTAGATGTCACTGACTCTCGATTACGGCGAGTGCAGAAGAACCTAGCAATTTTAAACAAGCGTACCAAAGGAGGTTGCTCGTGCTTGTGCATGCTTTTATCGGTTGTCGGAATCGTGATTCTGGTTGTTGTCATATATCTTCTCGTCAGGTATTTGTAA 699 42.49 MASTSDSWVKEYNEAVKLADDINGMISERSSVSVSGPEAQRYASAIRRKITILGTRLDSLLALLSRIPGKPISDKEMNRRRDMVTNLRSKVNQMASQLNMSNFANRDSLLGPEIKAADPMNRTVGLDNQGLVGLQRQIIKEQDEDLQKLEETVISTKHIALAVNEELDLHTRLIDDLDQHVDVTDSRLRRVQKNLAILNKRTKGGCSCLCMLLSVVGIVILVVVIYLLVRYL 232
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
9 5111043 5112781 + Bda030989.1 Bda09g00411 12661

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Bda09g00411 232 PANTHER TARGET SNARE COILED-COIL DOMAIN-CONTAINING PROTEIN-RELATED 1 226 - -
Bda09g00411 232 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 136 198 IPR000727 -
Bda09g00411 232 SUPERFAMILY t-snare proteins 19 99 IPR010989 GO:0016020|GO:0016192
Bda09g00411 232 Pfam SNARE domain 173 224 IPR000727 -
Bda09g00411 232 PANTHER SYNTAXIN 1 226 IPR045242 -
Bda09g00411 232 SMART tSNARE_6 131 198 IPR000727 -
Bda09g00411 232 CDD SNARE_Qc 139 196 - -
Bda09g00411 232 Gene3D - 138 200 - -
Bda09g00411 232 SUPERFAMILY SNARE fusion complex 127 197 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bda09g00411 K08503 SYP5; syntaxin of plants SYP5 - cit:102608030 363.229
       

WGDs- Genes

Select Gene_1 Gene_2 Event_name
Bda05g00693 Bda09g00411 CCT
Bda07g00381 Bda09g00411 BCT
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Bda09g00411 Bda-Chr9:5111043 Bda07g00367 Bda-Chr7:4669492 6.63E-08 dispersed
Bda09g00403 Bda-Chr9:5049766 Bda09g00411 Bda-Chr9:5111043 2.37E-06 proximal
Bda05g00693 Bda-Chr5:55214811 Bda09g00411 Bda-Chr9:5111043 6.44E-107 wgd
Bda07g00381 Bda-Chr7:4808229 Bda09g00411 Bda-Chr9:5111043 1.24E-128 wgd
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi19g583 Blo03g00538 . Bda07g00381 Bda09g00411 . Bpe08g01109 . . Cmo16g00959 . Cma01g01111 Cma09g00975 Car01g00980 Car09g00889 Sed07g2705 Cpe06g00787 Cpe02g00792 Bhi09g01700 Tan01g3132 Cmetu01g0482 . Hepe01g1245 Mch11g1220 . . . . . . . . Cone6ag0041 Cone9ag0047 Cone14ag1185 Cone15ag1202 Lsi02g01877 . . . . . Bda05g00693 . . Bpe03g00767 Bma07g01281 Bma14g00320 . Cmo01g01156 Cmo09g00974 . Cma16g00924 . Car16g00895 Cpe14g00748 . . . . . . . . Cla09g01036 Cam09g1092 Cec09g1092 Cco09g1113 . . Cre09g1057 . . Chy01g01059 Cme01g00994
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bda13g01286 . 440 803 SNARE and Associated Proteins AT3G24350 59.5 1.5e-97 353.2
Bda01g00978 . 1 341 SNARE and Associated Proteins AT3G24350 61.5 9.0e-95 344.0
Bda11g01860 . 1 294 SNARE and Associated Proteins AT2G18260 55.0 5.7e-82 301.2
Bda14g01003 . 1 290 SNARE and Associated Proteins AT2G18260 55.0 1.4e-80 296.6
Bda06g00929 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 1.6e-76 283.1
Bda05g01127 . 22 278 SNARE and Associated Proteins AT3G11820 78.6 1.9e-109 392.5
Bda03g00658 . 19 279 SNARE and Associated Proteins AT3G11820 74.3 2.6e-106 382.1
Bda01g00422 . 19 279 SNARE and Associated Proteins AT3G11820 71.6 1.9e-101 365.9
Bda01g00430 . 19 279 SNARE and Associated Proteins AT3G11820 71.6 1.9e-101 365.9
Bda09g01276 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 5.7e-93 337.8
Bda03g00659 . 19 238 SNARE and Associated Proteins AT3G11820 57.1 5.3e-67 251.5
Bda02g00552 . 31 159 SNARE and Associated Proteins AT3G11820 56.6 6.8e-38 154.8
Bda03g00658 . 1 279 SNARE and Associated Proteins AT3G52400 62.5 5.4e-89 324.7
Bda01g00422 . 1 279 SNARE and Associated Proteins AT3G52400 61.2 8.6e-87 317.4
Bda01g00430 . 1 279 SNARE and Associated Proteins AT3G52400 61.2 8.6e-87 317.4
Bda05g01127 . 29 278 SNARE and Associated Proteins AT3G52400 66.4 2.1e-85 312.8
Bda09g01276 . 1 281 SNARE and Associated Proteins AT3G52400 56.0 2.0e-80 296.2
Bda09g01276 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 3.0e-107 385.2
Bda03g00658 . 1 279 SNARE and Associated Proteins AT4G03330 56.1 1.3e-78 290.0
Bda05g01127 . 1 282 SNARE and Associated Proteins AT4G03330 53.4 2.9e-78 288.9
Bda01g00422 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 3.6e-76 282.0
Bda01g00430 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 3.6e-76 282.0
Bda02g00552 . 1 159 SNARE and Associated Proteins AT4G03330 63.6 3.7e-49 192.2
Bda03g00659 . 1 201 SNARE and Associated Proteins AT4G03330 52.6 1.4e-48 190.3
Bda09g01276 . 1 303 SNARE and Associated Proteins AT1G61290 77.2 1.5e-122 436.0
Bda03g00658 . 1 279 SNARE and Associated Proteins AT1G61290 59.1 3.5e-84 308.5
Bda05g01127 . 1 277 SNARE and Associated Proteins AT1G61290 58.6 2.3e-83 305.8
Bda01g00422 . 1 294 SNARE and Associated Proteins AT1G61290 54.7 4.8e-81 298.1
Bda01g00430 . 1 294 SNARE and Associated Proteins AT1G61290 54.7 4.8e-81 298.1
Bda02g00552 . 1 159 SNARE and Associated Proteins AT1G61290 74.2 2.7e-60 229.2
Bda09g01276 . 1 303 SNARE and Associated Proteins AT1G11250 75.6 4.3e-119 424.5
Bda03g00658 . 1 279 SNARE and Associated Proteins AT1G11250 60.9 3.0e-88 322.0
Bda05g01127 . 1 278 SNARE and Associated Proteins AT1G11250 59.4 1.2e-87 320.1
Bda01g00422 . 1 284 SNARE and Associated Proteins AT1G11250 57.7 3.5e-84 308.5
Bda01g00430 . 1 284 SNARE and Associated Proteins AT1G11250 57.7 3.5e-84 308.5
Bda02g00552 . 1 159 SNARE and Associated Proteins AT1G11250 70.4 1.2e-55 213.8
Bda06g00358 . 1 307 SNARE and Associated Proteins AT3G03800 63.2 3.4e-95 345.1
Bda06g00358 . 1 204 SNARE and Associated Proteins AT5G08080 62.3 7.1e-58 220.7
Bda06g01261 BCT 1 263 SNARE and Associated Proteins AT5G16830 63.2 5.9e-78 287.7
Bda06g01264 . 1 263 SNARE and Associated Proteins AT5G16830 63.2 2.3e-77 285.8
Bda08g00639 BCT 1 263 SNARE and Associated Proteins AT5G16830 62.5 9.5e-76 280.4
Bda08g00639 BCT 1 274 SNARE and Associated Proteins AT5G46860 70.4 5.3e-84 307.8
Bda06g01264 . 1 263 SNARE and Associated Proteins AT5G46860 70.0 5.9e-83 304.3
Bda06g01261 BCT 1 263 SNARE and Associated Proteins AT5G46860 69.6 6.5e-82 300.8
Bda08g00639 BCT 1 257 SNARE and Associated Proteins AT4G17730 66.5 1.1e-76 283.5
Bda06g01264 . 1 257 SNARE and Associated Proteins AT4G17730 64.2 5.8e-75 277.7
Bda06g01261 BCT 1 257 SNARE and Associated Proteins AT4G17730 64.2 2.2e-74 275.8
Bda01g01045 . 1 184 SNARE and Associated Proteins AT4G17730 54.0 1.2e-43 173.7
Bda13g01915 . 1 176 SNARE and Associated Proteins AT4G17730 53.1 4.2e-41 165.2
Bda08g00639 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 3.2e-49 192.6
Bda06g01261 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 4.2e-49 192.2
Bda06g01264 . 65 256 SNARE and Associated Proteins AT1G32270 58.3 4.2e-49 192.2
Bda14g00262 . 1 337 SNARE and Associated Proteins AT5G05760 65.5 2.0e-112 402.5
Bda13g01286 . 440 803 SNARE and Associated Proteins AT3G24350 59.5 1.5e-97 353.2
Bda01g00978 . 1 341 SNARE and Associated Proteins AT3G24350 61.5 9.0e-95 344.0
Bda01g01644 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.6e-125 445.3
Bda01g01638 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.6e-125 445.3
Bda08g01094 . 16 263 SNARE and Associated Proteins AT5G26980 78.6 7.3e-96 347.4
Bda01g01644 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bda01g01638 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bda08g01094 . 16 261 SNARE and Associated Proteins AT4G02195 67.6 6.4e-84 307.8
Bda01g01644 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.8e-127 451.1
Bda01g01638 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.8e-127 451.1
Bda08g01094 . 17 261 SNARE and Associated Proteins AT3G05710 82.0 4.5e-101 364.8
Bda09g00411 BCT,CCT 1 232 SNARE and Associated Proteins AT1G16240 72.4 6.2e-89 323.9
Bda05g00693 CCT 1 234 SNARE and Associated Proteins AT1G16240 60.3 9.7e-74 273.5
Bda07g00381 BCT,CCT 1 195 SNARE and Associated Proteins AT1G16240 70.8 5.9e-71 264.2
Bda09g00411 BCT,CCT 1 232 SNARE and Associated Proteins AT1G79590 70.4 2.8e-85 312.0
Bda05g00693 CCT 1 233 SNARE and Associated Proteins AT1G79590 61.4 1.9e-73 272.7
Bda07g00381 BCT,CCT 1 195 SNARE and Associated Proteins AT1G79590 69.7 1.3e-71 266.5
Bda09g00403 . 63 264 SNARE and Associated Proteins AT1G28490 67.3 7.6e-67 250.4
Bda07g00367 . 55 226 SNARE and Associated Proteins AT1G28490 60.6 2.8e-53 205.3
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G09740 56.4 1.6e-80 296.2
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G45280 56.4 1.1e-78 290.0
Bda02g00767 . 1 286 SNARE and Associated Proteins AT3G61450 52.3 9.8e-75 276.9
Bda14g00163 . 65 263 SNARE and Associated Proteins AT1G51740 65.5 1.3e-65 246.5
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002063 3 5 2 3 2 1 3 1 2 1 1 1 3 2 2 3 1 4 3 1 2 2 1 2 2 2 1 5 3 1 65
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Bda09g00411 Bda_Chr09 FPKM 333.230164 364.762177 418.185974 400.275879 182.69371 218.81778 166.643997 377.662506 398.235382