Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Bda11g00163	ATGGTGGAAAGAGCGTCAAATAGGGGTGGCGCTGGCCAATCGTCCGGTCAAAGTTGCGGCGCCAGAGCTCCAAGCGTTAGAGACACTATCTGCAACGCCGGTGCCGGTGCCGCATCAGGTGCTATTGCTGCTACGTTTGTATGCCCTTTGGATGTGATAAAGACGAGATTGCAGGTTTATGGTCTTCCTTCTGGACATAGAGGTAATGTCATTATTACAAGCTTAAAGGACATCATCCGTACTGAAGGCTTGAGGGGAATGTATCATGGTCTTTCTCCAACAATTATTGCTCTTCTTCCAAACTGGGCAGTTTACTTCACAGTATATGAGCATCTTAAAGGCCTACTCCATTCAAATGGTCATGGTGACCAACTCTCATTGGGTGCAAATATGTTTGCTGCCGCTAGTGCAGGGGCTGCCACTGCCCTCTCCACGAATCCATTGTGGGTTGTTAAAACTAGACTCCAAACCCAGGGAATGAGGCCCGGTGTGGTTCCTTATACAGGAATACTTTCGGCATTCAGAAGGATTGTACACGAGGAAGGAGTGAGGGGACTTTATAGTGGAATCATCCCTTCATTGGCCGGGATAAGTCACGTTGCGATACAATTTCCTGCGTACGAGAAGCTCAAATTTTACTTGGCACAAAGGGAAAACACAACCACTGATAAGCTAGGCCCTGGAAGTGTAGGCATTGCCTCTGCCATTTCCAAAATCACTGCTTCTTTATTAACCTATCCTCATGAGGTAATTCGTTCTCGTCTTCAAGAGCAAGGACAACAAGCGAGAACTGTCGGGATTCAATATACCGGGGTGATAGATTGCGTAAAAAAAGTGTTGGAAAAGGAAGGTTTTTGCGGATTTTATCGGGGTTGCGCTACCAATCTTCTGCGAACAACCCCATCGGCCGTTATAACTTTTACTAGTTACGAGATGATATGTCGATTCCTCCAGCAACTTTTTCCGCCGGAAAATGGTGAGAGTTCATACCAAAGATAA	999	46.35	MVERASNRGGAGQSSGQSCGARAPSVRDTICNAGAGAASGAIAATFVCPLDVIKTRLQVYGLPSGHRGNVIITSLKDIIRTEGLRGMYHGLSPTIIALLPNWAVYFTVYEHLKGLLHSNGHGDQLSLGANMFAAASAGAATALSTNPLWVVKTRLQTQGMRPGVVPYTGILSAFRRIVHEEGVRGLYSGIIPSLAGISHVAIQFPAYEKLKFYLAQRENTTTDKLGPGSVGIASAISKITASLLTYPHEVIRSRLQEQGQQARTVGIQYTGVIDCVKKVLEKEGFCGFYRGCATNLLRTTPSAVITFTSYEMICRFLQQLFPPENGESSYQR	332

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
11	2115551	2118719	-	Bda004877.1	Bda11g00163	15271

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Bda11g00163	332	ProSiteProfiles	Prokaryotic membrane lipoprotein lipid attachment site profile.	1	19	-	-
Bda11g00163	332	PANTHER	NICOTINAMIDE ADENINE DINUCLEOTIDE TRANSPORTER 1, CHLOROPLASTIC	23	326	-	-
Bda11g00163	332	Pfam	Mitochondrial carrier protein	32	118	IPR018108	-
Bda11g00163	332	Pfam	Mitochondrial carrier protein	124	216	IPR018108	-
Bda11g00163	332	Pfam	Mitochondrial carrier protein	229	319	IPR018108	-
Bda11g00163	332	PRINTS	Mitochondrial carrier protein signature	234	256	IPR002067	GO:0055085
Bda11g00163	332	PRINTS	Mitochondrial carrier protein signature	140	158	IPR002067	GO:0055085
Bda11g00163	332	PRINTS	Mitochondrial carrier protein signature	45	59	IPR002067	GO:0055085
Bda11g00163	332	PRINTS	Mitochondrial carrier protein signature	32	45	IPR002067	GO:0055085
Bda11g00163	332	PRINTS	Mitochondrial carrier protein signature	90	110	IPR002067	GO:0055085
Bda11g00163	332	PANTHER	MITOCHONDRIAL NICOTINAMIDE ADENINE DINUCLEOTIDE TRANSPORTER 1-RELATED-RELATED	23	326	IPR044712	GO:0006862\|GO:0055085
Bda11g00163	332	ProSiteProfiles	Solute carrier (Solcar) repeat profile.	125	213	IPR018108	-
Bda11g00163	332	MobiDBLite	consensus disorder prediction	1	22	-	-
Bda11g00163	332	ProSiteProfiles	Solute carrier (Solcar) repeat profile.	225	316	IPR018108	-
Bda11g00163	332	Gene3D	Mitochondrial carrier domain	13	120	IPR023395	-
Bda11g00163	332	Gene3D	Mitochondrial carrier domain	121	322	IPR023395	-
Bda11g00163	332	ProSiteProfiles	Solute carrier (Solcar) repeat profile.	27	115	IPR018108	-
Bda11g00163	332	MobiDBLite	consensus disorder prediction	8	22	-	-
Bda11g00163	332	SUPERFAMILY	Mitochondrial carrier	27	312	IPR023395	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Bda11g00163	K15115	SLC25A32, MFT; solute carrier family 25 (mitochondrial folate transporter), member 32	-	qsu:112039500	462.611

WGDs- Genes

Select	Gene_1	Gene_2	Event_name
	Bda01g02021	Bda11g00163	CCT
	Bda01g02021	Bda11g00163	BCT

Dupl-types

Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
Bda10g01144	Bda-Chr10:45498098	Bda11g00163	Bda-Chr11:2115551	2.02E-27	dispersed
Bda11g00163	Bda-Chr11:2115551	Bda12g00080	Bda-Chr12:591857	8.20E-134	dispersed
Bda11g00163	Bda-Chr11:2115551	Bda13g01267	Bda-Chr13:35050116	7.60E-10	transposed

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi1g346	.	.	Bda01g02021	Bda11g00163	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Cone6ag0430	Cone9ag0448	.	Csa05g02065	.	.	.	.	.	Bda11g00163	.	Bpe02g02209	.	.	.	.	Cmo15g00963	.	Cma15g00924	.	Car15g00866	Cpe13g00396	.	Bhi12g00835	.	.	.	Hepe02g2690	.	Lcy10g1474	Cla01g00571	Cam01g0597	Cec01g0586	Cco01g0612	Clacu01g0590	Cmu01g0562	Cre09g1945	Lsi09g00619	.	Chy09g00893	Cme09g01426

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Bda09g00155	.	1	345	Chloroplast and Mitochondria Gene Families	AT2G28800	65.7	6.5e-116	414.5
Bda08g00695	.	5	256	Chloroplast and Mitochondria Gene Families	AT1G15820	77.0	6.9e-113	403.7
Bda08g00696	.	5	256	Chloroplast and Mitochondria Gene Families	AT1G15820	77.0	6.9e-113	403.7
Bda08g00723	.	5	256	Chloroplast and Mitochondria Gene Families	AT1G15820	77.0	6.9e-113	403.7
Bda06g01104	.	3	254	Chloroplast and Mitochondria Gene Families	AT1G15820	74.6	5.4e-110	394.0
Bda13g00597	BCT,CCT,ECH	1	267	Chloroplast and Mitochondria Gene Families	AT3G27690	90.6	2.3e-144	508.4
Bda06g00422	BCT,CCT,ECH	1	265	Chloroplast and Mitochondria Gene Families	AT3G27690	90.6	5.1e-144	507.3
Bda15g00911	CCT,ECH	1	257	Chloroplast and Mitochondria Gene Families	AT3G27690	90.3	5.5e-138	487.3
Bda14g01617	.	2	261	Chloroplast and Mitochondria Gene Families	AT3G27690	77.2	6.1e-121	430.6
Bda01g00815	.	2	263	Chloroplast and Mitochondria Gene Families	AT3G27690	76.9	2.3e-120	428.7
Bda05g00187	.	3	262	Chloroplast and Mitochondria Gene Families	AT3G27690	76.5	5.1e-120	427.6
Bda07g00940	.	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	76.3	2.5e-119	425.2
Bda07g00941	.	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	75.6	1.3e-118	422.9
Bda07g01813	.	13	231	Chloroplast and Mitochondria Gene Families	AT3G27690	88.1	3.1e-117	418.3
Bda07g00942	.	13	231	Chloroplast and Mitochondria Gene Families	AT3G27690	86.3	1.7e-115	412.5
Bda05g00395	.	10	232	Chloroplast and Mitochondria Gene Families	AT3G27690	83.9	1.9e-114	409.1
Bda07g00273	.	7	264	Chloroplast and Mitochondria Gene Families	AT3G27690	66.0	5.0e-99	357.8
Bda09g00367	.	15	268	Chloroplast and Mitochondria Gene Families	AT3G27690	67.0	1.0e-96	350.1
Bda07g00939	.	1	160	Chloroplast and Mitochondria Gene Families	AT3G27690	85.6	3.6e-81	298.5
Bda05g00415	.	1	160	Chloroplast and Mitochondria Gene Families	AT3G27690	84.4	1.8e-80	296.2
Bda11g00909	.	69	274	Chloroplast and Mitochondria Gene Families	AT3G27690	52.1	3.9e-51	198.7
Bda03g01535	.	1	212	Chloroplast and Mitochondria Gene Families	AT3G61470	87.7	2.9e-119	424.9
Bda03g01539	.	1	212	Chloroplast and Mitochondria Gene Families	AT3G61470	87.7	2.9e-119	424.9
Bda05g01028	.	1	202	Chloroplast and Mitochondria Gene Families	AT3G61470	88.1	7.3e-115	410.2
Bda06g00542	BCT	22	244	Chloroplast and Mitochondria Gene Families	AT3G61470	53.4	1.1e-65	246.9
Bda15g00170	CCT	1	198	Chloroplast and Mitochondria Gene Families	AT3G54890	80.8	2.6e-89	325.1
Bda14g00345	CCT	1	161	Chloroplast and Mitochondria Gene Families	AT3G54890	76.4	1.1e-66	250.0
Bda05g00930	.	4	282	Chloroplast and Mitochondria Gene Families	AT3G08940	83.9	2.9e-136	481.5
Bda07g01019	.	1	281	Chloroplast and Mitochondria Gene Families	AT3G08940	84.1	2.9e-136	481.5
Bda01g00152	.	1	303	Chloroplast and Mitochondria Gene Families	AT3G08940	80.3	1.4e-135	479.2
Bda07g00716	.	1	272	Chloroplast and Mitochondria Gene Families	AT1G61520	83.9	1.4e-132	469.2
Bda09g00283	.	1	272	Chloroplast and Mitochondria Gene Families	AT1G61520	82.1	1.7e-130	462.2
Bda06g00422	BCT,CCT,ECH	1	265	Chloroplast and Mitochondria Gene Families	AT2G05070	90.6	5.9e-144	506.9
Bda13g00597	BCT,CCT,ECH	1	267	Chloroplast and Mitochondria Gene Families	AT2G05070	89.9	1.5e-142	502.3
Bda15g00911	CCT,ECH	1	257	Chloroplast and Mitochondria Gene Families	AT2G05070	89.9	1.6e-136	482.3
Bda01g00815	.	5	263	Chloroplast and Mitochondria Gene Families	AT2G05070	77.7	4.1e-121	431.0
Bda14g01617	.	5	261	Chloroplast and Mitochondria Gene Families	AT2G05070	78.4	1.6e-120	429.1
Bda07g00940	.	7	265	Chloroplast and Mitochondria Gene Families	AT2G05070	78.0	6.0e-120	427.2
Bda05g00187	.	6	262	Chloroplast and Mitochondria Gene Families	AT2G05070	77.7	1.3e-119	426.0
Bda07g00941	.	7	265	Chloroplast and Mitochondria Gene Families	AT2G05070	77.3	3.0e-119	424.9
Bda07g01813	.	13	231	Chloroplast and Mitochondria Gene Families	AT2G05070	87.7	6.8e-116	413.7
Bda07g00942	.	13	231	Chloroplast and Mitochondria Gene Families	AT2G05070	86.3	3.4e-115	411.4
Bda05g00395	.	10	232	Chloroplast and Mitochondria Gene Families	AT2G05070	83.9	3.7e-114	407.9
Bda09g00367	.	15	268	Chloroplast and Mitochondria Gene Families	AT2G05070	68.4	1.1e-97	353.2
Bda07g00273	.	11	264	Chloroplast and Mitochondria Gene Families	AT2G05070	67.7	1.9e-97	352.4
Bda07g00939	.	1	160	Chloroplast and Mitochondria Gene Families	AT2G05070	85.6	7.1e-81	297.4
Bda05g00415	.	1	160	Chloroplast and Mitochondria Gene Families	AT2G05070	84.4	3.5e-80	295.0
Bda11g00909	.	69	274	Chloroplast and Mitochondria Gene Families	AT2G05070	52.6	2.6e-51	199.1
Bda06g00422	BCT,CCT,ECH	1	237	Chloroplast and Mitochondria Gene Families	AT2G05100	91.1	7.9e-127	450.3
Bda15g00911	CCT,ECH	1	239	Chloroplast and Mitochondria Gene Families	AT2G05100	90.8	6.7e-126	447.2
Bda13g00597	BCT,CCT,ECH	1	239	Chloroplast and Mitochondria Gene Families	AT2G05100	90.8	6.7e-126	447.2
Bda01g00815	.	5	235	Chloroplast and Mitochondria Gene Families	AT2G05100	75.8	2.3e-102	369.0
Bda14g01617	.	5	233	Chloroplast and Mitochondria Gene Families	AT2G05100	76.3	8.8e-102	367.1
Bda07g00940	.	7	237	Chloroplast and Mitochondria Gene Families	AT2G05100	76.3	3.3e-101	365.2
Bda05g00187	.	6	234	Chloroplast and Mitochondria Gene Families	AT2G05100	75.4	7.4e-101	364.0
Bda07g00941	.	7	237	Chloroplast and Mitochondria Gene Families	AT2G05100	75.4	1.7e-100	362.8
Bda07g01813	.	13	203	Chloroplast and Mitochondria Gene Families	AT2G05100	86.9	1.0e-97	353.6
Bda07g00942	.	13	203	Chloroplast and Mitochondria Gene Families	AT2G05100	85.3	5.0e-97	351.3
Bda05g00395	.	10	204	Chloroplast and Mitochondria Gene Families	AT2G05100	82.6	5.5e-96	347.8
Bda07g00273	.	8	236	Chloroplast and Mitochondria Gene Families	AT2G05100	66.0	4.5e-82	301.6
Bda09g00367	.	15	240	Chloroplast and Mitochondria Gene Families	AT2G05100	67.7	5.9e-82	301.2
Bda07g00939	.	1	132	Chloroplast and Mitochondria Gene Families	AT2G05100	84.1	1.0e-62	237.3
Bda05g00415	.	1	132	Chloroplast and Mitochondria Gene Families	AT2G05100	82.6	5.2e-62	235.0
Bda11g00909	.	69	258	Chloroplast and Mitochondria Gene Families	AT2G05100	51.8	3.2e-43	172.6
Bda05g00930	.	4	165	Chloroplast and Mitochondria Gene Families	AT2G40100	69.6	3.6e-63	238.0
Bda07g01019	.	1	164	Chloroplast and Mitochondria Gene Families	AT2G40100	69.0	6.1e-63	237.3
Bda01g00152	.	3	165	Chloroplast and Mitochondria Gene Families	AT2G40100	68.8	1.0e-62	236.5
Bda07g00941	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	89.1	4.1e-137	484.2
Bda07g00940	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	88.4	4.6e-136	480.7
Bda01g00815	.	1	263	Chloroplast and Mitochondria Gene Families	AT1G29930	88.0	1.3e-135	479.2
Bda14g01617	.	1	261	Chloroplast and Mitochondria Gene Families	AT1G29930	87.6	3.3e-134	474.6
Bda05g00187	.	2	262	Chloroplast and Mitochondria Gene Families	AT1G29930	87.6	7.3e-134	473.4
Bda07g01813	.	1	231	Chloroplast and Mitochondria Gene Families	AT1G29930	91.4	5.3e-124	440.7
Bda05g00395	.	1	232	Chloroplast and Mitochondria Gene Families	AT1G29930	89.7	2.0e-123	438.7
Bda07g00942	.	1	231	Chloroplast and Mitochondria Gene Families	AT1G29930	91.0	2.0e-123	438.7
Bda13g00597	BCT,CCT,ECH	35	267	Chloroplast and Mitochondria Gene Families	AT1G29930	84.4	2.1e-117	418.7
Bda06g00422	BCT,CCT,ECH	29	265	Chloroplast and Mitochondria Gene Families	AT1G29930	83.4	3.6e-117	417.9
Bda15g00911	CCT,ECH	35	257	Chloroplast and Mitochondria Gene Families	AT1G29930	84.1	1.8e-111	399.1
Bda09g00367	.	50	268	Chloroplast and Mitochondria Gene Families	AT1G29930	75.9	6.7e-95	344.0
Bda07g00273	.	46	264	Chloroplast and Mitochondria Gene Families	AT1G29930	75.0	1.1e-94	343.2
Bda07g00939	.	1	160	Chloroplast and Mitochondria Gene Families	AT1G29930	92.5	1.8e-84	309.3
Bda05g00415	.	1	160	Chloroplast and Mitochondria Gene Families	AT1G29930	91.3	9.1e-84	307.0
Bda11g00909	.	69	274	Chloroplast and Mitochondria Gene Families	AT1G29930	52.4	9.8e-54	207.2
Bda07g00941	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	88.8	1.6e-136	482.3
Bda07g00940	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	88.0	1.7e-135	478.8
Bda01g00815	.	1	263	Chloroplast and Mitochondria Gene Families	AT1G29920	87.6	5.1e-135	477.2
Bda14g01617	.	1	261	Chloroplast and Mitochondria Gene Families	AT1G29920	87.6	4.3e-134	474.2
Bda05g00187	.	2	262	Chloroplast and Mitochondria Gene Families	AT1G29920	87.6	9.6e-134	473.0
Bda07g01813	.	1	231	Chloroplast and Mitochondria Gene Families	AT1G29920	91.4	5.3e-124	440.7
Bda05g00395	.	1	232	Chloroplast and Mitochondria Gene Families	AT1G29920	89.7	2.0e-123	438.7
Bda07g00942	.	1	231	Chloroplast and Mitochondria Gene Families	AT1G29920	91.0	2.0e-123	438.7
Bda13g00597	BCT,CCT,ECH	35	267	Chloroplast and Mitochondria Gene Families	AT1G29920	84.4	2.1e-117	418.7
Bda06g00422	BCT,CCT,ECH	29	265	Chloroplast and Mitochondria Gene Families	AT1G29920	83.4	3.6e-117	417.9
Bda15g00911	CCT,ECH	35	257	Chloroplast and Mitochondria Gene Families	AT1G29920	84.1	1.8e-111	399.1
Bda09g00367	.	50	268	Chloroplast and Mitochondria Gene Families	AT1G29920	75.9	6.7e-95	344.0
Bda07g00273	.	46	264	Chloroplast and Mitochondria Gene Families	AT1G29920	75.0	1.1e-94	343.2
Bda07g00939	.	1	160	Chloroplast and Mitochondria Gene Families	AT1G29920	92.5	1.8e-84	309.3
Bda05g00415	.	1	160	Chloroplast and Mitochondria Gene Families	AT1G29920	91.3	9.1e-84	307.0
Bda11g00909	.	69	274	Chloroplast and Mitochondria Gene Families	AT1G29920	52.4	9.8e-54	207.2
Bda07g00941	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	88.8	1.6e-136	482.3
Bda07g00940	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	88.0	1.7e-135	478.8
Bda01g00815	.	1	263	Chloroplast and Mitochondria Gene Families	AT1G29910	87.6	5.1e-135	477.2
Bda14g01617	.	1	261	Chloroplast and Mitochondria Gene Families	AT1G29910	87.6	4.3e-134	474.2
Bda05g00187	.	2	262	Chloroplast and Mitochondria Gene Families	AT1G29910	87.6	9.6e-134	473.0
Bda07g01813	.	1	231	Chloroplast and Mitochondria Gene Families	AT1G29910	91.4	5.3e-124	440.7
Bda05g00395	.	1	232	Chloroplast and Mitochondria Gene Families	AT1G29910	89.7	2.0e-123	438.7
Bda07g00942	.	1	231	Chloroplast and Mitochondria Gene Families	AT1G29910	91.0	2.0e-123	438.7
Bda13g00597	BCT,CCT,ECH	35	267	Chloroplast and Mitochondria Gene Families	AT1G29910	84.4	2.1e-117	418.7
Bda06g00422	BCT,CCT,ECH	29	265	Chloroplast and Mitochondria Gene Families	AT1G29910	83.4	3.6e-117	417.9
Bda15g00911	CCT,ECH	35	257	Chloroplast and Mitochondria Gene Families	AT1G29910	84.1	1.8e-111	399.1
Bda09g00367	.	50	268	Chloroplast and Mitochondria Gene Families	AT1G29910	75.9	6.7e-95	344.0
Bda07g00273	.	46	264	Chloroplast and Mitochondria Gene Families	AT1G29910	75.0	1.1e-94	343.2
Bda07g00939	.	1	160	Chloroplast and Mitochondria Gene Families	AT1G29910	92.5	1.8e-84	309.3
Bda05g00415	.	1	160	Chloroplast and Mitochondria Gene Families	AT1G29910	91.3	9.1e-84	307.0
Bda11g00909	.	69	274	Chloroplast and Mitochondria Gene Families	AT1G29910	52.4	9.8e-54	207.2
Bda11g00909	.	11	289	Chloroplast and Mitochondria Gene Families	AT4G10340	84.9	3.2e-140	494.6
Bda05g00187	.	35	250	Chloroplast and Mitochondria Gene Families	AT4G10340	51.4	2.6e-57	219.2
Bda14g01617	.	34	249	Chloroplast and Mitochondria Gene Families	AT4G10340	51.4	2.6e-57	219.2
Bda07g01813	.	15	219	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	5.8e-57	218.0
Bda07g00940	.	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	53.1	9.9e-57	217.2
Bda07g00941	.	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.6	1.3e-56	216.9
Bda07g00942	.	15	219	Chloroplast and Mitochondria Gene Families	AT4G10340	52.6	1.3e-56	216.9
Bda01g00815	.	47	251	Chloroplast and Mitochondria Gene Families	AT4G10340	52.2	3.8e-56	215.3
Bda05g00395	.	16	220	Chloroplast and Mitochondria Gene Families	AT4G10340	52.2	4.9e-56	214.9
Bda06g00422	BCT,CCT,ECH	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	53.6	8.4e-56	214.2
Bda15g00911	CCT,ECH	51	255	Chloroplast and Mitochondria Gene Families	AT4G10340	53.1	1.4e-55	213.4
Bda13g00597	BCT,CCT,ECH	51	255	Chloroplast and Mitochondria Gene Families	AT4G10340	53.1	1.4e-55	213.4
Bda09g00367	.	50	256	Chloroplast and Mitochondria Gene Families	AT4G10340	52.6	3.6e-51	198.7
Bda07g00273	.	46	252	Chloroplast and Mitochondria Gene Families	AT4G10340	52.1	1.1e-50	197.2
Bda05g00415	.	1	148	Chloroplast and Mitochondria Gene Families	AT4G10340	52.3	1.8e-37	153.3
Bda07g00939	.	1	148	Chloroplast and Mitochondria Gene Families	AT4G10340	51.7	3.0e-37	152.5
Bda07g00941	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	88.0	2.5e-134	474.9
Bda07g00940	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	87.3	2.8e-133	471.5
Bda01g00815	.	1	263	Chloroplast and Mitochondria Gene Families	AT2G34420	86.9	8.0e-133	469.9
Bda14g01617	.	1	261	Chloroplast and Mitochondria Gene Families	AT2G34420	86.9	8.9e-132	466.5
Bda05g00187	.	2	262	Chloroplast and Mitochondria Gene Families	AT2G34420	86.9	2.6e-131	464.9
Bda07g01813	.	1	231	Chloroplast and Mitochondria Gene Families	AT2G34420	91.8	3.1e-124	441.4
Bda05g00395	.	1	232	Chloroplast and Mitochondria Gene Families	AT2G34420	90.1	1.2e-123	439.5
Bda07g00942	.	1	231	Chloroplast and Mitochondria Gene Families	AT2G34420	91.4	1.2e-123	439.5
Bda13g00597	BCT,CCT,ECH	3	267	Chloroplast and Mitochondria Gene Families	AT2G34420	76.2	2.1e-117	418.7
Bda06g00422	BCT,CCT,ECH	29	265	Chloroplast and Mitochondria Gene Families	AT2G34420	83.0	8.1e-117	416.8
Bda15g00911	CCT,ECH	3	257	Chloroplast and Mitochondria Gene Families	AT2G34420	75.7	1.7e-111	399.1
Bda09g00367	.	50	268	Chloroplast and Mitochondria Gene Families	AT2G34420	76.4	8.7e-95	343.6
Bda07g00273	.	46	264	Chloroplast and Mitochondria Gene Families	AT2G34420	75.5	1.5e-94	342.8
Bda07g00939	.	1	160	Chloroplast and Mitochondria Gene Families	AT2G34420	93.2	1.1e-84	310.1
Bda05g00415	.	1	160	Chloroplast and Mitochondria Gene Families	AT2G34420	91.9	5.3e-84	307.8
Bda11g00909	.	69	274	Chloroplast and Mitochondria Gene Families	AT2G34420	52.4	1.7e-53	206.5
Bda07g00941	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	87.6	3.9e-135	477.6
Bda01g00815	.	1	263	Chloroplast and Mitochondria Gene Families	AT2G34430	89.1	8.6e-135	476.5
Bda07g00940	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	86.8	4.3e-134	474.2
Bda14g01617	.	1	261	Chloroplast and Mitochondria Gene Families	AT2G34430	87.6	2.8e-133	471.5
Bda05g00187	.	2	262	Chloroplast and Mitochondria Gene Families	AT2G34430	87.6	6.2e-133	470.3
Bda07g01813	.	1	231	Chloroplast and Mitochondria Gene Families	AT2G34430	90.9	3.4e-123	438.0
Bda07g00942	.	1	231	Chloroplast and Mitochondria Gene Families	AT2G34430	90.5	7.6e-123	436.8
Bda05g00395	.	1	232	Chloroplast and Mitochondria Gene Families	AT2G34430	89.7	4.9e-122	434.1
Bda13g00597	BCT,CCT,ECH	35	267	Chloroplast and Mitochondria Gene Families	AT2G34430	84.3	4.0e-116	414.5
Bda06g00422	BCT,CCT,ECH	33	265	Chloroplast and Mitochondria Gene Families	AT2G34430	84.3	8.9e-116	413.3
Bda15g00911	CCT,ECH	35	257	Chloroplast and Mitochondria Gene Families	AT2G34430	84.1	3.3e-110	394.8
Bda09g00367	.	50	268	Chloroplast and Mitochondria Gene Families	AT2G34430	76.4	1.1e-94	343.2
Bda07g00273	.	46	264	Chloroplast and Mitochondria Gene Families	AT2G34430	75.5	1.9e-94	342.4
Bda07g00939	.	1	160	Chloroplast and Mitochondria Gene Families	AT2G34430	93.2	1.1e-84	310.1
Bda05g00415	.	1	160	Chloroplast and Mitochondria Gene Families	AT2G34430	91.9	5.3e-84	307.8
Bda11g00909	.	69	274	Chloroplast and Mitochondria Gene Families	AT2G34430	52.4	2.2e-53	206.1
Bda05g00930	.	2	282	Chloroplast and Mitochondria Gene Families	AT5G01530	84.2	1.3e-139	492.7
Bda07g01019	.	4	281	Chloroplast and Mitochondria Gene Families	AT5G01530	83.7	8.5e-136	479.9
Bda01g00152	.	1	303	Chloroplast and Mitochondria Gene Families	AT5G01530	78.9	3.6e-134	474.6
Bda01g01310	BCT	263	522	Chloroplast and Mitochondria Gene Families	AT5G40810	93.1	3.8e-143	504.2
Bda13g01648	BCT	48	305	Chloroplast and Mitochondria Gene Families	AT5G40810	93.1	2.1e-141	498.4
Bda13g01648	BCT	1	305	Chloroplast and Mitochondria Gene Families	AT3G27240	85.8	1.1e-149	526.2
Bda01g01310	BCT	235	522	Chloroplast and Mitochondria Gene Families	AT3G27240	87.8	6.9e-144	506.9
Bda09g01563	.	5	323	Chloroplast and Mitochondria Gene Families	AT2G30160	73.1	1.6e-138	489.2
Bda02g00881	.	1	323	Chloroplast and Mitochondria Gene Families	AT2G30160	72.3	1.1e-134	476.5
Bda07g01026	.	4	319	Chloroplast and Mitochondria Gene Families	AT2G30160	66.5	9.1e-118	420.2
Bda09g01563	.	1	323	Chloroplast and Mitochondria Gene Families	AT1G07030	73.1	6.6e-137	483.8
Bda02g00881	.	1	323	Chloroplast and Mitochondria Gene Families	AT1G07030	73.1	1.1e-136	483.0
Bda07g01026	.	8	319	Chloroplast and Mitochondria Gene Families	AT1G07030	69.3	7.3e-120	427.2
Bda12g00080	.	1	311	Chloroplast and Mitochondria Gene Families	AT2G47490	77.4	2.8e-137	485.0
Bda11g00163	BCT,CCT	17	325	Chloroplast and Mitochondria Gene Families	AT2G47490	61.0	2.1e-108	389.0
Bda11g00163	BCT,CCT	25	320	Chloroplast and Mitochondria Gene Families	AT1G25380	70.0	5.5e-116	414.5
Bda12g00080	.	16	297	Chloroplast and Mitochondria Gene Families	AT1G25380	66.6	2.1e-107	386.0
Bda01g01793	.	1	583	Chloroplast and Mitochondria Gene Families	AT4G21490	74.0	3.1e-254	874.4
Bda13g00644	BCT	1	586	Chloroplast and Mitochondria Gene Families	AT4G21490	70.2	6.9e-238	820.1
Bda01g01745	.	331	792	Chloroplast and Mitochondria Gene Families	AT4G21490	77.5	1.1e-211	733.0
Bda10g00865	.	5	186	Chloroplast and Mitochondria Gene Families	AT1G17530	63.2	1.6e-60	229.2
Bda08g01019	.	4	178	Chloroplast and Mitochondria Gene Families	AT1G17530	52.5	1.1e-43	173.3
Bda08g01019	.	4	182	Chloroplast and Mitochondria Gene Families	AT3G04800	53.9	2.0e-45	179.1
Bda10g00865	.	22	190	Chloroplast and Mitochondria Gene Families	AT3G04800	52.6	1.9e-40	162.5
Bda10g00865	.	6	190	Chloroplast and Mitochondria Gene Families	AT1G72750	66.7	6.2e-63	237.3
Bda08g01019	.	4	182	Chloroplast and Mitochondria Gene Families	AT1G72750	53.8	1.8e-46	182.6
Bda01g02102	.	1	240	Chloroplast and Mitochondria Gene Families	AT1G26100	64.9	4.4e-82	301.2
Bda13g01762	.	1	223	Chloroplast and Mitochondria Gene Families	AT5G38630	72.3	4.7e-89	324.3
Bda07g01072	.	1	248	Chloroplast and Mitochondria Gene Families	AT5G38630	63.1	1.0e-83	306.6
Bda15g00732	.	23	234	Chloroplast and Mitochondria Gene Families	AT4G25570	61.8	7.1e-71	264.2
Bda01g01054	.	7	397	Chloroplast and Mitochondria Gene Families	AT5G14040	75.5	3.7e-168	587.8
Bda11g01581	.	10	353	Chloroplast and Mitochondria Gene Families	AT5G14040	79.4	3.3e-156	548.1
Bda01g01054	.	8	396	Chloroplast and Mitochondria Gene Families	AT3G48850	64.6	1.9e-140	495.7
Bda11g01581	.	9	353	Chloroplast and Mitochondria Gene Families	AT3G48850	69.4	1.0e-138	490.0
Bda11g01581	.	68	352	Chloroplast and Mitochondria Gene Families	AT2G17270	50.9	7.0e-80	294.3
Bda12g00204	.	16	315	Chloroplast and Mitochondria Gene Families	AT5G15640	74.5	2.5e-125	445.3
Bda07g01034	.	16	315	Chloroplast and Mitochondria Gene Families	AT5G15640	73.8	6.9e-123	437.2
Bda03g00133	BCT	12	339	Chloroplast and Mitochondria Gene Families	AT5G26200	66.8	1.2e-120	429.9
Bda01g00634	BCT	12	343	Chloroplast and Mitochondria Gene Families	AT5G26200	64.5	2.7e-117	418.7
Bda10g00867	.	1	346	Chloroplast and Mitochondria Gene Families	AT5G26200	61.2	2.4e-113	405.6
Bda10g00867	.	1	349	Chloroplast and Mitochondria Gene Families	AT1G72820	76.4	2.5e-150	528.5
Bda03g00133	BCT	1	339	Chloroplast and Mitochondria Gene Families	AT1G72820	67.6	8.1e-125	443.7
Bda01g00634	BCT	1	344	Chloroplast and Mitochondria Gene Families	AT1G72820	66.6	9.9e-123	436.8
Bda07g00490	.	99	303	Chloroplast and Mitochondria Gene Families	AT5G52570	52.7	5.2e-51	198.0
Bda07g01901	.	599	772	Chloroplast and Mitochondria Gene Families	AT5G52570	51.1	1.6e-39	159.8
Bda07g00490	.	49	221	Chloroplast and Mitochondria Gene Families	AT4G25700	61.5	2.2e-59	225.7
Bda07g01901	.	599	688	Chloroplast and Mitochondria Gene Families	AT4G25700	88.9	1.3e-43	173.3
Bda01g01934	.	29	459	Chloroplast and Mitochondria Gene Families	AT2G18710	88.2	1.1e-216	749.6

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0002161	2	2	0	1	2	2	3	2	2	2	2	2	2	2	2	3	2	4	2	2	2	2	2	2	2	2	2	4	2	2	63

Transcriptome

Select	Gene	Chr	Type	da1	da2	da3	da4	da5	da6	da7	da8	da9	da10
	Bda11g00163	Bda_Chr11	FPKM	79.607208	80.480461	13.295816	12.482021	6.041076	5.630198	6.878078	10.523599	11.343162