Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Bda14g00262	ATGGCAACTACTTATCGAGATCGGACGACGGAGTTTCTATCTTTATCTGAGACGCTGAAGAAGATCGGACCAATCAAAACAGTTAGTCAAGCTGAAAACGAGACCTCTCTTTCTAAACCTTCCCGACCTGTCTCTTCCAAGTCAGAATTCAATAGGAAGGCTGCGCAAATTTCTTTCGGAATGCATGAGACCTCTCATAAGATTGCTCGACTTGCGCAATTGGCAAAAAGATCATCAATGTTTGATGACCCAATTGTGGAAATACAGGAATTGACCGTTTTCATAAAGAACGATATAACAGCTTTGAATGTAGCTCTCTCTGATCTACAAACTATTCAAAACATGGAAATGGCCGATGGGAGCTATTCTGAGGATAAAGTTGTTCACTCAACAGCTGTTTGTGATGACTTGAAAAACAGACTCATGGGGGTCACTAAACATCTTAAAAATGTGTTAACCACAAGAACAGAGAACATAAAAGCAAATGAGAGTAGGAAGCAGATATTCTCCGCAACTGTAACTAAAGAAAATGCTTCTCAAAATCATGCAAAGACAGTGTCTCAGCCACCACCGTGGTTAATTTCATCAAATACATCTGAGAGTTCTCAACCACCAACATTGCCAGTAAATGGAGGCCAAGTTGGTAGTCAACTGAGGAGAAGGTTAGCTGTCGAAAACACTCCATCCCAGCATATGGAAATGTCAATGTTACAGCAGGTGGTTCCAAGACAGGAAAATTATTCTGAAAGTCGTGGGGTTGCTCTTCATAATGTTGAATCTACGATTTCAGAACTCAGTGGAATCTTTACGCATTTGGCGACGATGGTTGCTCATCAAGGGGAACTGGCTATCAGGATTGACGATAACATGGATGAATCGTTGACTAATGTCGAAGGGGCTCGCAGCTCTCTATTAAGGCATCTCAACCGAATATGGTCAAATAGGTGGCTTATGATCAAAATATTTGGGATAATTATATTTTTTCTAATGGTCTTTATTTTTTTCATGGCTTGA	1014	40.43	MATTYRDRTTEFLSLSETLKKIGPIKTVSQAENETSLSKPSRPVSSKSEFNRKAAQISFGMHETSHKIARLAQLAKRSSMFDDPIVEIQELTVFIKNDITALNVALSDLQTIQNMEMADGSYSEDKVVHSTAVCDDLKNRLMGVTKHLKNVLTTRTENIKANESRKQIFSATVTKENASQNHAKTVSQPPPWLISSNTSESSQPPTLPVNGGQVGSQLRRRLAVENTPSQHMEMSMLQQVVPRQENYSESRGVALHNVESTISELSGIFTHLATMVAHQGELAIRIDDNMDESLTNVEGARSSLLRHLNRIWSNRWLMIKIFGIIIFFLMVFIFFMA	337

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
14	1802621	1805093	-	Bda026998.1	Bda14g00262	20313

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Bda14g00262	337	ProSiteProfiles	t-SNARE coiled-coil homology domain profile.	245	307	IPR000727	-
Bda14g00262	337	PANTHER	SYNTAXIN	4	336	IPR045242	-
Bda14g00262	337	ProSitePatterns	Syntaxin / epimorphin family signature.	251	290	IPR006012	GO:0005484\|GO:0006886\|GO:0016020
Bda14g00262	337	MobiDBLite	consensus disorder prediction	175	215	-	-
Bda14g00262	337	SMART	tSNARE_6	240	307	IPR000727	-
Bda14g00262	337	Pfam	SNARE domain	282	333	IPR000727	-
Bda14g00262	337	Pfam	Syntaxin-5 N-terminal, Sly1p-binding domain	3	21	IPR021538	-
Bda14g00262	337	CDD	SNARE_syntaxin5	248	336	-	-
Bda14g00262	337	MobiDBLite	consensus disorder prediction	175	213	-	-
Bda14g00262	337	Gene3D	-	45	300	-	-
Bda14g00262	337	SUPERFAMILY	t-snare proteins	48	300	IPR010989	GO:0016020\|GO:0016192
Bda14g00262	337	PANTHER	SYNTAXIN-31	4	336	-	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Bda14g00262	K08490	STX5; syntaxin 5	-	jre:108991917	473.396

Dupl-types

Select	Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
	Bda01g00978	Bda-Chr1:43390432	Bda14g00262	Bda-Chr14:1802621	6.65E-101	dispersed
	Bda14g00262	Bda-Chr14:1802621	Bda13g01286	Bda-Chr13:35174025	1.53E-49	transposed

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi13g19	.	.	.	.	.	Bpe15g01148	.	.	Cmo04g00161	Cmo04g01191	Cma04g01124	Cma04g00161	Car04g00154	.	.	.	Cpe01g00138	.	.	.	.	.	.	.	Cla07g00385	Cam07g0410	Cec07g0462	Cco07g0418	Clacu07g0410	Cmu07g0454	Cre07g0761	.	Cone5ag0210	.	.	.	.	Chy10g00436	Cme10g01057	.	Blo04g00243	Bda14g00262	.	.	.	.	.	.	.	.	.	.	.	.	Cpe01g01046	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Csa05g00800	.	.

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Bda13g01286	.	440	803	SNARE and Associated Proteins	AT3G24350	59.5	1.5e-97	353.2
Bda01g00978	.	1	341	SNARE and Associated Proteins	AT3G24350	61.5	9.0e-95	344.0
Bda11g01860	.	1	294	SNARE and Associated Proteins	AT2G18260	55.0	5.7e-82	301.2
Bda14g01003	.	1	290	SNARE and Associated Proteins	AT2G18260	55.0	1.4e-80	296.6
Bda06g00929	.	1	293	SNARE and Associated Proteins	AT2G18260	51.8	1.6e-76	283.1
Bda05g01127	.	22	278	SNARE and Associated Proteins	AT3G11820	78.6	1.9e-109	392.5
Bda03g00658	.	19	279	SNARE and Associated Proteins	AT3G11820	74.3	2.6e-106	382.1
Bda01g00422	.	19	279	SNARE and Associated Proteins	AT3G11820	71.6	1.9e-101	365.9
Bda01g00430	.	19	279	SNARE and Associated Proteins	AT3G11820	71.6	1.9e-101	365.9
Bda09g01276	.	31	281	SNARE and Associated Proteins	AT3G11820	66.1	5.7e-93	337.8
Bda03g00659	.	19	238	SNARE and Associated Proteins	AT3G11820	57.1	5.3e-67	251.5
Bda02g00552	.	31	159	SNARE and Associated Proteins	AT3G11820	56.6	6.8e-38	154.8
Bda03g00658	.	1	279	SNARE and Associated Proteins	AT3G52400	62.5	5.4e-89	324.7
Bda01g00422	.	1	279	SNARE and Associated Proteins	AT3G52400	61.2	8.6e-87	317.4
Bda01g00430	.	1	279	SNARE and Associated Proteins	AT3G52400	61.2	8.6e-87	317.4
Bda05g01127	.	29	278	SNARE and Associated Proteins	AT3G52400	66.4	2.1e-85	312.8
Bda09g01276	.	1	281	SNARE and Associated Proteins	AT3G52400	56.0	2.0e-80	296.2
Bda09g01276	.	1	299	SNARE and Associated Proteins	AT4G03330	67.9	3.0e-107	385.2
Bda03g00658	.	1	279	SNARE and Associated Proteins	AT4G03330	56.1	1.3e-78	290.0
Bda05g01127	.	1	282	SNARE and Associated Proteins	AT4G03330	53.4	2.9e-78	288.9
Bda01g00422	.	1	284	SNARE and Associated Proteins	AT4G03330	52.4	3.6e-76	282.0
Bda01g00430	.	1	284	SNARE and Associated Proteins	AT4G03330	52.4	3.6e-76	282.0
Bda02g00552	.	1	159	SNARE and Associated Proteins	AT4G03330	63.6	3.7e-49	192.2
Bda03g00659	.	1	201	SNARE and Associated Proteins	AT4G03330	52.6	1.4e-48	190.3
Bda09g01276	.	1	303	SNARE and Associated Proteins	AT1G61290	77.2	1.5e-122	436.0
Bda03g00658	.	1	279	SNARE and Associated Proteins	AT1G61290	59.1	3.5e-84	308.5
Bda05g01127	.	1	277	SNARE and Associated Proteins	AT1G61290	58.6	2.3e-83	305.8
Bda01g00422	.	1	294	SNARE and Associated Proteins	AT1G61290	54.7	4.8e-81	298.1
Bda01g00430	.	1	294	SNARE and Associated Proteins	AT1G61290	54.7	4.8e-81	298.1
Bda02g00552	.	1	159	SNARE and Associated Proteins	AT1G61290	74.2	2.7e-60	229.2
Bda09g01276	.	1	303	SNARE and Associated Proteins	AT1G11250	75.6	4.3e-119	424.5
Bda03g00658	.	1	279	SNARE and Associated Proteins	AT1G11250	60.9	3.0e-88	322.0
Bda05g01127	.	1	278	SNARE and Associated Proteins	AT1G11250	59.4	1.2e-87	320.1
Bda01g00422	.	1	284	SNARE and Associated Proteins	AT1G11250	57.7	3.5e-84	308.5
Bda01g00430	.	1	284	SNARE and Associated Proteins	AT1G11250	57.7	3.5e-84	308.5
Bda02g00552	.	1	159	SNARE and Associated Proteins	AT1G11250	70.4	1.2e-55	213.8
Bda06g00358	.	1	307	SNARE and Associated Proteins	AT3G03800	63.2	3.4e-95	345.1
Bda06g00358	.	1	204	SNARE and Associated Proteins	AT5G08080	62.3	7.1e-58	220.7
Bda06g01261	BCT	1	263	SNARE and Associated Proteins	AT5G16830	63.2	5.9e-78	287.7
Bda06g01264	.	1	263	SNARE and Associated Proteins	AT5G16830	63.2	2.3e-77	285.8
Bda08g00639	BCT	1	263	SNARE and Associated Proteins	AT5G16830	62.5	9.5e-76	280.4
Bda08g00639	BCT	1	274	SNARE and Associated Proteins	AT5G46860	70.4	5.3e-84	307.8
Bda06g01264	.	1	263	SNARE and Associated Proteins	AT5G46860	70.0	5.9e-83	304.3
Bda06g01261	BCT	1	263	SNARE and Associated Proteins	AT5G46860	69.6	6.5e-82	300.8
Bda08g00639	BCT	1	257	SNARE and Associated Proteins	AT4G17730	66.5	1.1e-76	283.5
Bda06g01264	.	1	257	SNARE and Associated Proteins	AT4G17730	64.2	5.8e-75	277.7
Bda06g01261	BCT	1	257	SNARE and Associated Proteins	AT4G17730	64.2	2.2e-74	275.8
Bda01g01045	.	1	184	SNARE and Associated Proteins	AT4G17730	54.0	1.2e-43	173.7
Bda13g01915	.	1	176	SNARE and Associated Proteins	AT4G17730	53.1	4.2e-41	165.2
Bda08g00639	BCT	65	256	SNARE and Associated Proteins	AT1G32270	58.3	3.2e-49	192.6
Bda06g01261	BCT	65	256	SNARE and Associated Proteins	AT1G32270	58.3	4.2e-49	192.2
Bda06g01264	.	65	256	SNARE and Associated Proteins	AT1G32270	58.3	4.2e-49	192.2
Bda14g00262	.	1	337	SNARE and Associated Proteins	AT5G05760	65.5	2.0e-112	402.5
Bda13g01286	.	440	803	SNARE and Associated Proteins	AT3G24350	59.5	1.5e-97	353.2
Bda01g00978	.	1	341	SNARE and Associated Proteins	AT3G24350	61.5	9.0e-95	344.0
Bda01g01644	.	1	341	SNARE and Associated Proteins	AT5G26980	75.4	2.6e-125	445.3
Bda01g01638	.	1	341	SNARE and Associated Proteins	AT5G26980	75.4	2.6e-125	445.3
Bda08g01094	.	16	263	SNARE and Associated Proteins	AT5G26980	78.6	7.3e-96	347.4
Bda01g01644	.	1	339	SNARE and Associated Proteins	AT4G02195	63.9	2.6e-101	365.5
Bda01g01638	.	1	339	SNARE and Associated Proteins	AT4G02195	63.9	2.6e-101	365.5
Bda08g01094	.	16	261	SNARE and Associated Proteins	AT4G02195	67.6	6.4e-84	307.8
Bda01g01644	.	1	339	SNARE and Associated Proteins	AT3G05710	75.2	4.8e-127	451.1
Bda01g01638	.	1	339	SNARE and Associated Proteins	AT3G05710	75.2	4.8e-127	451.1
Bda08g01094	.	17	261	SNARE and Associated Proteins	AT3G05710	82.0	4.5e-101	364.8
Bda09g00411	BCT,CCT	1	232	SNARE and Associated Proteins	AT1G16240	72.4	6.2e-89	323.9
Bda05g00693	CCT	1	234	SNARE and Associated Proteins	AT1G16240	60.3	9.7e-74	273.5
Bda07g00381	BCT,CCT	1	195	SNARE and Associated Proteins	AT1G16240	70.8	5.9e-71	264.2
Bda09g00411	BCT,CCT	1	232	SNARE and Associated Proteins	AT1G79590	70.4	2.8e-85	312.0
Bda05g00693	CCT	1	233	SNARE and Associated Proteins	AT1G79590	61.4	1.9e-73	272.7
Bda07g00381	BCT,CCT	1	195	SNARE and Associated Proteins	AT1G79590	69.7	1.3e-71	266.5
Bda09g00403	.	63	264	SNARE and Associated Proteins	AT1G28490	67.3	7.6e-67	250.4
Bda07g00367	.	55	226	SNARE and Associated Proteins	AT1G28490	60.6	2.8e-53	205.3
Bda02g00767	.	1	286	SNARE and Associated Proteins	AT3G09740	56.4	1.6e-80	296.2
Bda02g00767	.	1	286	SNARE and Associated Proteins	AT3G45280	56.4	1.1e-78	290.0
Bda02g00767	.	1	286	SNARE and Associated Proteins	AT3G61450	52.3	9.8e-75	276.9
Bda14g00163	.	65	263	SNARE and Associated Proteins	AT1G51740	65.5	1.3e-65	246.5

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0006940	1	1	1	1	1	1	2	1	1	1	1	1	2	1	1	2	1	1	2	1	1	1	1	1	1	1	1	3	1	1	36

Transcriptome

Select	Gene	Chr	Type	da1	da2	da3	da4	da5	da6	da7	da8	da9	da10
	Bda14g00262	Bda_Chr14	FPKM	17.833334	19.902271	13.443923	15.074477	12.654894	14.043196	12.914077	25.5919	26.598036