Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Bhi10g01451	TTTAGTGACTAGACTGTGCTTAAAACGTCCCCTTTATCTATTGTTAAACGGCAGCTCGAAGCCTTCAAATGCATCGCGAGAAGCCAAGAGGAGAATTTAAAATTGCAGAAGAATAGCGAAGAGAGTTCATAAAATAATCCAAAAGGACTCATTCGTTAGTGATGCCAAAGGTGAGGCTTCTAGAGAAATTGATCTCGAGAAGGGAACTCGAGTTCTGCGAATCAATTCTGACATGGGAATGGAGGTTTTCAATAAGCAGATACAAGAGGTTGAGGTTCAAGTAGATAAGCTCTCTGGGCTTCTTATTAAACTGAAGGATGCTAATGAGGAATCGAAGGCTGCTACCAAAGCATCAGAGATGAAAGCTATCAAGAAGCGTATGGAAAAGGATATCGATGAAGTGGGGAAAATAGCACGCAATGTCAAGGGGAAGTTGGAGGCTGTAAATAAAGATAACTTGACCAATAGGAAGAAGCCTGGGTGTGAGAAGGGAACGGCCATTGACAGAGCAAGAATGAACGTGACAAATGCGTTGACAAAAAAGTTCAAGGATCTAATGATAGAATTTCAGACCCTTCGTCAAAAAATTCAAGATGAGTACCGTGAAGTCGTGGAAAGACGAGTGATTACAGTTACGGGTACCAGACCAGATGAGTCGACGATTGATCACCTTATAGAAACTGGAAATAGTGAGCAAATATTCCAGAATGCATTTGAACAGATGGGACGAGGACAGGTTATCAGTACCGTGGAAGAAATTCAAGAGCGACATGATGCAGTTAAAGAAATTGAAAAAAGGCTCTTCGAATTGCATCAGATTTACCTTGACATGGCAGTTTTAGTGGAAGCCCAGAGTGAAATTTTGGATAACATAGAAAATCAGGTAACGAATGCAGTCGACCACGTTCGAACGGGAACCGATGCCCTCCAAACTGCGAAGAGCTTACAGAGGAGATCAAGAAAATGCATGATGATTGGCATCATATTGCTTCTGGTTATAGCAATCATAATCATCCTCTCAGTGCTGAAGCCATGGAAGAAGTAAACTGATGGAAATGATACCAAAATGTGGACTCAGTTTTCACAGTTTCCATTGCTCACAATGTCCTTTCGTTGTAGAATCGTCGCTCCTTCAAATTACAAATTTTATTTTGTTT	1157	40.97	MGMEVFNKQIQEVEVQVDKLSGLLIKLKDANEESKAATKASEMKAIKKRMEKDIDEVGKIARNVKGKLEAVNKDNLTNRKKPGCEKGTAIDRARMNVTNALTKKFKDLMIEFQTLRQKIQDEYREVVERRVITVTGTRPDESTIDHLIETGNSEQIFQNAFEQMGRGQVISTVEEIQERHDAVKEIEKRLFELHQIYLDMAVLVEAQSEILDNIENQVTNAVDHVRTGTDALQTAKSLQRRSRKCMMIGIILLLVIAIIIILSVLKPWKK	270

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
10	34753397	34757126	+	XM_039046080.1	Bhi10g01451	47792

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Bhi10g01451	270	SMART	SynN_4	1	124	IPR006011	GO:0016020
Bhi10g01451	270	SUPERFAMILY	t-snare proteins	2	228	IPR010989	GO:0016020\|GO:0016192
Bhi10g01451	270	PANTHER	SYNTAXIN OF PLANTS 122 PROTEIN	1	264	-	-
Bhi10g01451	270	ProSiteProfiles	t-SNARE coiled-coil homology domain profile.	173	235	IPR000727	-
Bhi10g01451	270	Gene3D	-	164	266	-	-
Bhi10g01451	270	PANTHER	SYNTAXIN	1	264	IPR045242	-
Bhi10g01451	270	CDD	SNARE_syntaxin1-like	172	234	-	-
Bhi10g01451	270	Pfam	SNARE domain	209	261	IPR000727	-
Bhi10g01451	270	CDD	SynN	3	160	IPR006011	GO:0016020
Bhi10g01451	270	SMART	tSNARE_6	168	235	IPR000727	-
Bhi10g01451	270	Coils	Coil	10	30	-	-
Bhi10g01451	270	Pfam	Syntaxin	6	207	IPR006011	GO:0016020
Bhi10g01451	270	Gene3D	-	2	127	-	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Bhi10g01451	K08486	STX1B_2_3; syntaxin 1B/2/3	-	csv:101214355	469.159

Dupl-types

Select	Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
	Bhi10g01451	Bhi-Chr10:34753397	Bhi10g01454	Bhi-Chr10:34761476	9.11E-105	dispersed
	Bhi10g01451	Bhi-Chr10:34753397	Bhi10g01452	Bhi-Chr10:34753599	0	tandem

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi12g523	.	Blo15g00503	Bda06g00358	.	.	.	.	.	.	.	.	Cma20g00629	Car02g00135	Car20g00525	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Cone3ag1346	.	.	.	.	.	.	.	.	.	.	.	.	Bpe07g00604	.	.	.	Cmo02g00163	Cmo20g00615	.	.	.	.	Cpe16g00449	Cpe05g01447	Bhi10g01451	.	.	.	.	.	.	Cla02g00831	Cam02g0975	Cec02g0887	Cco02g0923	Clacu02g0875	Cmu02g0866	Cre02g1184	.	.	.	Cme11g00777

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Bhi04g01047	.	8	338	SNARE and Associated Proteins	AT3G24350	63.9	7.1e-100	361.7
Bhi03g02299	CCT	1	309	SNARE and Associated Proteins	AT1G08560	67.8	1.6e-100	363.6
Bhi03g01314	.	1	300	SNARE and Associated Proteins	AT2G18260	56.4	5.8e-87	318.5
Bhi03g01315	.	1	300	SNARE and Associated Proteins	AT2G18260	56.4	5.8e-87	318.5
Bhi11g02367	.	19	279	SNARE and Associated Proteins	AT3G11820	80.8	8.9e-115	411.0
Bhi03g01775	.	24	283	SNARE and Associated Proteins	AT3G11820	72.3	3.5e-103	372.5
Bhi03g01774	.	24	283	SNARE and Associated Proteins	AT3G11820	72.3	3.5e-103	372.5
Bhi08g01910	.	31	281	SNARE and Associated Proteins	AT3G11820	66.5	4.8e-92	335.5
Bhi11g01551	CCT	31	285	SNARE and Associated Proteins	AT3G11820	52.9	4.8e-68	255.8
Bhi11g02367	.	1	279	SNARE and Associated Proteins	AT3G52400	63.6	2.0e-91	333.6
Bhi03g01775	.	1	283	SNARE and Associated Proteins	AT3G52400	60.8	5.5e-86	315.5
Bhi03g01774	.	1	283	SNARE and Associated Proteins	AT3G52400	60.8	5.5e-86	315.5
Bhi08g01910	.	1	281	SNARE and Associated Proteins	AT3G52400	56.7	1.8e-81	300.4
Bhi08g01910	.	1	299	SNARE and Associated Proteins	AT4G03330	69.2	1.6e-108	390.2
Bhi11g02367	.	1	279	SNARE and Associated Proteins	AT4G03330	58.2	1.1e-82	304.3
Bhi03g01775	.	1	290	SNARE and Associated Proteins	AT4G03330	53.8	4.9e-78	288.9
Bhi03g01774	.	1	290	SNARE and Associated Proteins	AT4G03330	53.8	4.9e-78	288.9
Bhi11g01551	CCT	1	285	SNARE and Associated Proteins	AT4G03330	51.6	1.4e-69	260.8
Bhi08g01910	.	1	303	SNARE and Associated Proteins	AT1G61290	78.9	4.0e-128	455.3
Bhi11g02367	.	1	279	SNARE and Associated Proteins	AT1G61290	62.8	3.3e-90	329.3
Bhi03g01775	.	1	283	SNARE and Associated Proteins	AT1G61290	56.9	9.6e-82	301.2
Bhi03g01774	.	1	283	SNARE and Associated Proteins	AT1G61290	56.9	9.6e-82	301.2
Bhi08g01910	.	1	303	SNARE and Associated Proteins	AT1G11250	77.2	1.2e-124	443.7
Bhi11g02367	.	1	279	SNARE and Associated Proteins	AT1G11250	62.7	1.2e-92	337.4
Bhi03g01775	.	1	292	SNARE and Associated Proteins	AT1G11250	56.8	8.2e-86	314.7
Bhi03g01774	.	1	292	SNARE and Associated Proteins	AT1G11250	56.8	8.2e-86	314.7
Bhi11g01551	CCT	1	308	SNARE and Associated Proteins	AT3G03800	73.1	1.6e-113	406.8
Bhi10g01452	.	1	305	SNARE and Associated Proteins	AT3G03800	54.8	1.3e-83	307.4
Bhi10g01451	.	1	270	SNARE and Associated Proteins	AT3G03800	57.8	7.4e-82	301.6
Bhi11g01551	CCT	1	203	SNARE and Associated Proteins	AT5G08080	77.9	3.6e-78	288.9
Bhi10g01452	.	1	204	SNARE and Associated Proteins	AT5G08080	58.8	2.1e-54	209.9
Bhi10g01451	.	2	169	SNARE and Associated Proteins	AT5G08080	62.5	2.4e-50	196.4
Bhi11g00014	.	1	256	SNARE and Associated Proteins	AT5G16830	59.2	4.7e-75	278.9
Bhi11g00014	.	1	256	SNARE and Associated Proteins	AT5G46860	66.0	4.6e-80	295.4
Bhi11g00014	.	1	256	SNARE and Associated Proteins	AT4G17730	60.9	3.1e-73	272.7
Bhi11g00014	.	65	256	SNARE and Associated Proteins	AT1G32270	59.9	5.2e-52	202.6
Bhi07g00570	.	1	336	SNARE and Associated Proteins	AT5G05760	65.3	3.2e-110	396.0
Bhi04g01047	.	8	338	SNARE and Associated Proteins	AT3G24350	63.9	7.1e-100	361.7
Bhi06g01461	.	1	327	SNARE and Associated Proteins	AT5G26980	75.2	5.7e-125	444.9
Bhi09g00937	.	1	318	SNARE and Associated Proteins	AT5G26980	66.5	8.0e-103	371.3
Bhi09g00938	.	1	317	SNARE and Associated Proteins	AT5G26980	66.5	2.0e-101	366.7
Bhi09g00937	.	1	318	SNARE and Associated Proteins	AT4G02195	67.1	5.9e-106	381.7
Bhi09g00938	.	1	317	SNARE and Associated Proteins	AT4G02195	66.8	3.3e-104	375.9
Bhi06g01461	.	1	329	SNARE and Associated Proteins	AT4G02195	63.4	2.1e-103	373.2
Bhi06g01461	.	1	328	SNARE and Associated Proteins	AT3G05710	74.8	6.2e-127	451.4
Bhi09g00937	.	1	318	SNARE and Associated Proteins	AT3G05710	64.0	2.5e-99	359.8
Bhi09g00938	.	1	317	SNARE and Associated Proteins	AT3G05710	64.0	6.1e-98	355.1
Bhi09g01700	.	1	233	SNARE and Associated Proteins	AT1G16240	70.8	1.8e-88	323.2
Bhi11g00534	.	4	232	SNARE and Associated Proteins	AT1G16240	66.8	1.8e-80	296.6
Bhi11g00535	.	4	232	SNARE and Associated Proteins	AT1G16240	66.8	1.8e-80	296.6
Bhi11g00536	.	4	232	SNARE and Associated Proteins	AT1G16240	66.8	1.8e-80	296.6
Bhi11g00537	.	4	232	SNARE and Associated Proteins	AT1G16240	66.8	1.8e-80	296.6
Bhi09g01700	.	1	233	SNARE and Associated Proteins	AT1G79590	69.5	3.3e-86	315.8
Bhi11g00534	.	4	232	SNARE and Associated Proteins	AT1G79590	67.2	2.4e-81	299.7
Bhi11g00535	.	4	232	SNARE and Associated Proteins	AT1G79590	67.2	2.4e-81	299.7
Bhi11g00536	.	4	232	SNARE and Associated Proteins	AT1G79590	67.2	2.4e-81	299.7
Bhi11g00537	.	4	232	SNARE and Associated Proteins	AT1G79590	67.2	2.4e-81	299.7
Bhi12g02591	.	56	246	SNARE and Associated Proteins	AT1G28490	71.7	1.7e-66	250.0
Bhi11g02112	.	1	264	SNARE and Associated Proteins	AT3G09740	79.3	1.6e-112	403.3
Bhi10g00561	.	1	265	SNARE and Associated Proteins	AT3G09740	67.4	1.3e-95	347.1
Bhi10g00561	.	1	265	SNARE and Associated Proteins	AT3G45280	64.4	8.4e-90	327.8
Bhi11g02112	.	1	264	SNARE and Associated Proteins	AT3G45280	65.2	3.5e-88	322.4
Bhi11g02112	.	1	261	SNARE and Associated Proteins	AT3G61450	68.6	1.1e-94	344.0
Bhi10g00561	.	1	262	SNARE and Associated Proteins	AT3G61450	61.0	5.2e-84	308.5
Bhi04g02346	.	99	342	SNARE and Associated Proteins	AT1G51740	72.4	7.0e-91	331.3

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0001189	1	6	1	1	1	2	3	2	2	2	2	2	3	2	3	3	2	4	3	2	3	1	2	3	3	2	3	8	3	2	77