Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Bhi11g00014 TCTAATTCTCTCTCCTCCATCATCATCGTCGTCTTCCCCTCTCTAAAAAGTTGAATTCCTTTCCCTCTCTCATTGCGAATTCCTCAAAGGCCAATCTTCAAATTGCCCTAATTCGCCACTTTCCCCATTTGAGGATTCCTCTGATCCTCCTCCATAGGAGCGCCTACATAATTTGTTACCGATCCTCGTTTCCAGGGGAGAATTTGATCTGTGTTTTTCTTGAATTTTGATTTGTTTTCAATCGATTTGTTCTTGTTTCTCTCTCTCTCTCTCTCTTCGGAAAAGGTTAGGATCTCGGCGACATGAGCTTTCAAGATATCGAGGCTGGTCGCCCTTTTGCTTCTTCGAGGAGAGACCTCATCAATGGCAAACAAGATCCCACGCAAGCCGTTGCTTCGGGTATATTTCAGATTAATACTGCCGTCGCTACGTTTCAGAGGCTTGTTAATACCTTAGGAACACCTAAGGATACGCCTGAGCTACGCGAGAAGCTGCACAAGACCAGGTTACATATTGGACAGTTGGTTAAAGACACCTCTGCTAAACTTAAACAAGCCAGCGACATAGATCATCATGCTGAAGTTAATGCCAGCAAGAAAATTGCAGATGCTAAACTTGCGAAAGATTTTCAAGCAGTGTTGAAAGAATTTCAGAAGGCTCAACGACTTGCAGCTGAGAGGGAAACAGCATATACACCTTTTGTTCCCCAAACTGTTCTACCTTCTAGCTACACAGCTGGCGAGGCAGATGCAAGCTCAGAGAAGAATCTTGAACAGCGTGCCCTCCTTGTGGAATCTAGGAGACAAGAGGTCTTGCTATTGGACAATGAAATAGCTTTCAATGAGGCAATAATTGAGGAAAGAGAGCAAGGCATTCATGAAATCCAGCAGCAAATTGGAGAAGTGAATGAAATTTTTAAAGATCTTGCGGTTCTAGTCCATGAACAGGGAGCCATGATTGATGATATTGGATCCAACATAGAGGGTGCCCATGCTGCAACGTCACAGGGAACAACTCAGCTTGTAAAAGCTTCAAAGACACAAAGATCAAATTCATCTCTGGCTTGCTTACTTTTGGTGATATTTGGTATTATTCTCCTCATTGTGATCATAATAGTTGTTGCTTAAAAGAAGTTTGCATTGACTTGACGCAAGAAACTTGCTGCTGGTTGTAGCAAGAAGATCAATTCTCCTGTTAGTTTGTTTTGATAAAGTTTACATTGTTCTTGGATCCTGCCTTCGGGGGGAAGGGAAGGGGTTGTGAAGAGGCTCTATGTATACAATGTCGATACGCCTTCAGAGTATACACCTCGCTTCTGTCGGGTCGACCATCCTCTTCCATTTGGAAATGTCATAACCTCTTTGTGTGAATGTGTGCAACTTGCTTGTTTCTTCTTCTTTTACTTTTTATTTTTTTTAATTATTCAATTATATTGATAAATTATTTTTTTTCCTCACTTAGCTGTTCTGTACTGTTGCACACAAAGCATTTACCTCATTTGCACCTTGGCTGGTAAAATGAGAGGAGAGAGAGAGGGGTTTCACTCTCTCTCTCTCCCCTCTGTGTCTGTCTGTAATAAATAGAAGGGTTTGGTCTGTTC 1600 42.0 MSFQDIEAGRPFASSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSAKLKQASDIDHHAEVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYTPFVPQTVLPSSYTAGEADASSEKNLEQRALLVESRRQEVLLLDNEIAFNEAIIEEREQGIHEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIEGAHAATSQGTTQLVKASKTQRSNSSLACLLLVIFGIILLIVIIIVVA 274
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
11 223022 227982 + XM_039047189.1 Bhi11g00014 48726

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Bhi11g00014 274 PANTHER SYNTAXIN 5 272 IPR045242 -
Bhi11g00014 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Bhi11g00014 274 PANTHER SYNTAXIN OF PLANTS PROTEIN 5 272 - -
Bhi11g00014 274 CDD SNARE_Qa 184 242 - -
Bhi11g00014 274 SMART tSNARE_6 176 243 IPR000727 -
Bhi11g00014 274 Pfam Syntaxin-like protein 31 130 IPR006011 GO:0016020
Bhi11g00014 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484|GO:0006886|GO:0016020
Bhi11g00014 274 Pfam SNARE domain 218 269 IPR000727 -
Bhi11g00014 274 CDD SynN 24 147 IPR006011 GO:0016020
Bhi11g00014 274 Gene3D - 21 134 - -
Bhi11g00014 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020|GO:0016192
Bhi11g00014 274 Gene3D - 174 274 - -
Bhi11g00014 274 SMART SynN_4 16 128 IPR006011 GO:0016020
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bhi11g00014 - - K08488 bhj:120089793 462.611
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Bhi09g00937 Bhi-Chr9:21127075 Bhi11g00014 Bhi-Chr11:223022 4.96E-09 dispersed
Bhi09g00938 Bhi-Chr9:21127075 Bhi11g00014 Bhi-Chr11:223022 5.87E-09 dispersed
Bhi11g00014 Bhi-Chr11:223022 Bhi03g01775 Bhi-Chr3:37339051 2.38E-14 dispersed
Bhi11g00014 Bhi-Chr11:223022 Bhi03g01774 Bhi-Chr3:37337842 2.38E-14 transposed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bhi04g01047 . 8 338 SNARE and Associated Proteins AT3G24350 63.9 7.1e-100 361.7
Bhi03g02299 CCT 1 309 SNARE and Associated Proteins AT1G08560 67.8 1.6e-100 363.6
Bhi03g01314 . 1 300 SNARE and Associated Proteins AT2G18260 56.4 5.8e-87 318.5
Bhi03g01315 . 1 300 SNARE and Associated Proteins AT2G18260 56.4 5.8e-87 318.5
Bhi11g02367 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 8.9e-115 411.0
Bhi03g01775 . 24 283 SNARE and Associated Proteins AT3G11820 72.3 3.5e-103 372.5
Bhi03g01774 . 24 283 SNARE and Associated Proteins AT3G11820 72.3 3.5e-103 372.5
Bhi08g01910 . 31 281 SNARE and Associated Proteins AT3G11820 66.5 4.8e-92 335.5
Bhi11g01551 CCT 31 285 SNARE and Associated Proteins AT3G11820 52.9 4.8e-68 255.8
Bhi11g02367 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 2.0e-91 333.6
Bhi03g01775 . 1 283 SNARE and Associated Proteins AT3G52400 60.8 5.5e-86 315.5
Bhi03g01774 . 1 283 SNARE and Associated Proteins AT3G52400 60.8 5.5e-86 315.5
Bhi08g01910 . 1 281 SNARE and Associated Proteins AT3G52400 56.7 1.8e-81 300.4
Bhi08g01910 . 1 299 SNARE and Associated Proteins AT4G03330 69.2 1.6e-108 390.2
Bhi11g02367 . 1 279 SNARE and Associated Proteins AT4G03330 58.2 1.1e-82 304.3
Bhi03g01775 . 1 290 SNARE and Associated Proteins AT4G03330 53.8 4.9e-78 288.9
Bhi03g01774 . 1 290 SNARE and Associated Proteins AT4G03330 53.8 4.9e-78 288.9
Bhi11g01551 CCT 1 285 SNARE and Associated Proteins AT4G03330 51.6 1.4e-69 260.8
Bhi08g01910 . 1 303 SNARE and Associated Proteins AT1G61290 78.9 4.0e-128 455.3
Bhi11g02367 . 1 279 SNARE and Associated Proteins AT1G61290 62.8 3.3e-90 329.3
Bhi03g01775 . 1 283 SNARE and Associated Proteins AT1G61290 56.9 9.6e-82 301.2
Bhi03g01774 . 1 283 SNARE and Associated Proteins AT1G61290 56.9 9.6e-82 301.2
Bhi08g01910 . 1 303 SNARE and Associated Proteins AT1G11250 77.2 1.2e-124 443.7
Bhi11g02367 . 1 279 SNARE and Associated Proteins AT1G11250 62.7 1.2e-92 337.4
Bhi03g01775 . 1 292 SNARE and Associated Proteins AT1G11250 56.8 8.2e-86 314.7
Bhi03g01774 . 1 292 SNARE and Associated Proteins AT1G11250 56.8 8.2e-86 314.7
Bhi11g01551 CCT 1 308 SNARE and Associated Proteins AT3G03800 73.1 1.6e-113 406.8
Bhi10g01452 . 1 305 SNARE and Associated Proteins AT3G03800 54.8 1.3e-83 307.4
Bhi10g01451 . 1 270 SNARE and Associated Proteins AT3G03800 57.8 7.4e-82 301.6
Bhi11g01551 CCT 1 203 SNARE and Associated Proteins AT5G08080 77.9 3.6e-78 288.9
Bhi10g01452 . 1 204 SNARE and Associated Proteins AT5G08080 58.8 2.1e-54 209.9
Bhi10g01451 . 2 169 SNARE and Associated Proteins AT5G08080 62.5 2.4e-50 196.4
Bhi11g00014 . 1 256 SNARE and Associated Proteins AT5G16830 59.2 4.7e-75 278.9
Bhi11g00014 . 1 256 SNARE and Associated Proteins AT5G46860 66.0 4.6e-80 295.4
Bhi11g00014 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 3.1e-73 272.7
Bhi11g00014 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 5.2e-52 202.6
Bhi07g00570 . 1 336 SNARE and Associated Proteins AT5G05760 65.3 3.2e-110 396.0
Bhi04g01047 . 8 338 SNARE and Associated Proteins AT3G24350 63.9 7.1e-100 361.7
Bhi06g01461 . 1 327 SNARE and Associated Proteins AT5G26980 75.2 5.7e-125 444.9
Bhi09g00937 . 1 318 SNARE and Associated Proteins AT5G26980 66.5 8.0e-103 371.3
Bhi09g00938 . 1 317 SNARE and Associated Proteins AT5G26980 66.5 2.0e-101 366.7
Bhi09g00937 . 1 318 SNARE and Associated Proteins AT4G02195 67.1 5.9e-106 381.7
Bhi09g00938 . 1 317 SNARE and Associated Proteins AT4G02195 66.8 3.3e-104 375.9
Bhi06g01461 . 1 329 SNARE and Associated Proteins AT4G02195 63.4 2.1e-103 373.2
Bhi06g01461 . 1 328 SNARE and Associated Proteins AT3G05710 74.8 6.2e-127 451.4
Bhi09g00937 . 1 318 SNARE and Associated Proteins AT3G05710 64.0 2.5e-99 359.8
Bhi09g00938 . 1 317 SNARE and Associated Proteins AT3G05710 64.0 6.1e-98 355.1
Bhi09g01700 . 1 233 SNARE and Associated Proteins AT1G16240 70.8 1.8e-88 323.2
Bhi11g00534 . 4 232 SNARE and Associated Proteins AT1G16240 66.8 1.8e-80 296.6
Bhi11g00535 . 4 232 SNARE and Associated Proteins AT1G16240 66.8 1.8e-80 296.6
Bhi11g00536 . 4 232 SNARE and Associated Proteins AT1G16240 66.8 1.8e-80 296.6
Bhi11g00537 . 4 232 SNARE and Associated Proteins AT1G16240 66.8 1.8e-80 296.6
Bhi09g01700 . 1 233 SNARE and Associated Proteins AT1G79590 69.5 3.3e-86 315.8
Bhi11g00534 . 4 232 SNARE and Associated Proteins AT1G79590 67.2 2.4e-81 299.7
Bhi11g00535 . 4 232 SNARE and Associated Proteins AT1G79590 67.2 2.4e-81 299.7
Bhi11g00536 . 4 232 SNARE and Associated Proteins AT1G79590 67.2 2.4e-81 299.7
Bhi11g00537 . 4 232 SNARE and Associated Proteins AT1G79590 67.2 2.4e-81 299.7
Bhi12g02591 . 56 246 SNARE and Associated Proteins AT1G28490 71.7 1.7e-66 250.0
Bhi11g02112 . 1 264 SNARE and Associated Proteins AT3G09740 79.3 1.6e-112 403.3
Bhi10g00561 . 1 265 SNARE and Associated Proteins AT3G09740 67.4 1.3e-95 347.1
Bhi10g00561 . 1 265 SNARE and Associated Proteins AT3G45280 64.4 8.4e-90 327.8
Bhi11g02112 . 1 264 SNARE and Associated Proteins AT3G45280 65.2 3.5e-88 322.4
Bhi11g02112 . 1 261 SNARE and Associated Proteins AT3G61450 68.6 1.1e-94 344.0
Bhi10g00561 . 1 262 SNARE and Associated Proteins AT3G61450 61.0 5.2e-84 308.5
Bhi04g02346 . 99 342 SNARE and Associated Proteins AT1G51740 72.4 7.0e-91 331.3
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Bhi11g00014 Bhi_Chr11 FPKM 1.382353 0.0 0.0 0.0 0.0 0.0 9.813022 0.0 5.022343 0.0