Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Bhi11g02112	AAGCGGTCGAGTCATTACACTTGCTTTTGCGAAGCAAGTTTAGTCTGATATTTGGACATCACAGACGCACGACTTCTGTAGATATTCTCGGAACCAATTTTACCGCCGTAGATCACCGGAAAACCTACCGGAGCGCGGAGGCGAAGAATCGAAGATGAGCGTGATCGACCTTTTGACCAGAGTAGATGCAATTTGCCAGAAGTACGACAAGTACGATGTTGAAAAGCAGAGAGATCTCAATGTCTCCGGTGACGATGCCTTCGCTCGACTCTATGCCTCTGTCGAAGCTGACATTGAAGCCGCTCTCCAGAAAGCGGAGGATGCTTCTAAAGAGAAGAATAGGGCATCTATAGTGGCGTTGAATGCGGAGATTCGTCGTACCAAGGCTCGATTACTGGAGGAGGTCCCCAAATTGCAGAGGTTGGCTGTAAAGAGGGTTAAAGGACTATCGACTGAAGATCTTACCACTCGAAATGATTTGGTGCTTGCATTGCCGGATAGGATTCAAGCTATACCAGATGGAACTGTGACTTCCACGAAGAATAATGGGGGTTGGACATCCTCAGCTTCACGTGCTGAAATCAAATTTGACTCAGATGGGCGATTTGATGATGAGTACTTCCAACACACTGAGGAGTCGAGTCAGTTCAGGCAAGAGTATGAAATGCGGAAAATGAAGCAGGATCAAGGACTGGACATGATATCAGAAGGGTTAGATACTCTGAAGAACATGGCACATGATATGAATGAGGAAATTGACAGGCAAGTCCCTCTGATGGACGAGATCGACACTAAGGTGGACAAGGCTGCATCTGACCTTAAAAACACCAACGTTAGATTAAAGGATACAGTTAACCAGCTAAGGTCCAGCAGAAATTTCTGTATCGATATCATTTTGTTGTGTATAATCTTGGGGATTGCTGCCTATCTATACAATGTGTTGAAGAAGTGAGCTAAGAAAGGGAATAATCTTCATGTTCTTGTGGAATATTTGTGTCAAGCTTGGTAAAGATGAGTTGATGGAATATTCGATTGAGTTGTATCTGTATGTAGTACATTATGTGTGATCGTGTGTGTTGTTTACAAATATTTGTATGTCATATTCTTTTACTCACAACTCGCCCTTTATCATCAACTTGCCCTTTTTTGTACTTGTGCAACCTCTTTTTGTTCGGCTTGAAATTTGAACACTGATCTCCATGTTTGATATATTAGCCATTTATTCATTTATAGAAATGTAGTTTGATAAGAGTCTTCTGATGAA	1264	42.33	MSVIDLLTRVDAICQKYDKYDVEKQRDLNVSGDDAFARLYASVEADIEAALQKAEDASKEKNRASIVALNAEIRRTKARLLEEVPKLQRLAVKRVKGLSTEDLTTRNDLVLALPDRIQAIPDGTVTSTKNNGGWTSSASRAEIKFDSDGRFDDEYFQHTEESSQFRQEYEMRKMKQDQGLDMISEGLDTLKNMAHDMNEEIDRQVPLMDEIDTKVDKAASDLKNTNVRLKDTVNQLRSSRNFCIDIILLCIILGIAAYLYNVLKK	265

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
11	59753419	59762471	-	XM_039048132.1	Bhi11g02112	50824

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Bhi11g02112	265	SUPERFAMILY	SNARE fusion complex	163	230	-	-
Bhi11g02112	265	Pfam	SNARE domain	207	256	IPR000727	-
Bhi11g02112	265	CDD	SNARE_Qc	175	230	-	-
Bhi11g02112	265	PANTHER	SYNTAXIN-73	1	261	-	-
Bhi11g02112	265	ProSitePatterns	Syntaxin / epimorphin family signature.	176	215	IPR006012	GO:0005484\|GO:0006886\|GO:0016020
Bhi11g02112	265	Gene3D	-	170	231	-	-
Bhi11g02112	265	Coils	Coil	40	67	-	-
Bhi11g02112	265	PANTHER	SYNTAXIN	1	261	IPR045242	-
Bhi11g02112	265	SMART	tSNARE_6	165	232	IPR000727	-
Bhi11g02112	265	ProSiteProfiles	t-SNARE coiled-coil homology domain profile.	170	232	IPR000727	-
Bhi11g02112	265	Coils	Coil	219	239	-	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Bhi11g02112	K08506	SYP7; syntaxin of plants SYP7	-	csv:101215905	497.664

Dupl-types

Select	Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
	Bhi10g00561	Bhi-Chr10:12273471	Bhi11g02112	Bhi-Chr11:59753419	9.06E-126	wgd

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi8g590	.	.	.	.	Bpe04g01584	.	.	.	.	Cmo14g00195	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Cone13ag1275	Cone19ag1262	.	.	.	Cme04g02538	.	.	.	.	.	.	.	.	Sed04g1347	.	.	.	Cma14g00203	.	Car14g00181	Cpe03g00174	.	Bhi11g02112	Tan08g1893	Cmetu04g1845	Lac10g3026	Hepe05g0250	.	.	Cla10g01938	Cam10g2004	Cec10g2046	Cco10g2031	Clacu10g2011	Cmu10g2760	Cre10g2153	Lsi03g02035	Csa03g03265	Chy04g02075	.

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Bhi04g01047	.	8	338	SNARE and Associated Proteins	AT3G24350	63.9	7.1e-100	361.7
Bhi03g02299	CCT	1	309	SNARE and Associated Proteins	AT1G08560	67.8	1.6e-100	363.6
Bhi03g01314	.	1	300	SNARE and Associated Proteins	AT2G18260	56.4	5.8e-87	318.5
Bhi03g01315	.	1	300	SNARE and Associated Proteins	AT2G18260	56.4	5.8e-87	318.5
Bhi11g02367	.	19	279	SNARE and Associated Proteins	AT3G11820	80.8	8.9e-115	411.0
Bhi03g01775	.	24	283	SNARE and Associated Proteins	AT3G11820	72.3	3.5e-103	372.5
Bhi03g01774	.	24	283	SNARE and Associated Proteins	AT3G11820	72.3	3.5e-103	372.5
Bhi08g01910	.	31	281	SNARE and Associated Proteins	AT3G11820	66.5	4.8e-92	335.5
Bhi11g01551	CCT	31	285	SNARE and Associated Proteins	AT3G11820	52.9	4.8e-68	255.8
Bhi11g02367	.	1	279	SNARE and Associated Proteins	AT3G52400	63.6	2.0e-91	333.6
Bhi03g01775	.	1	283	SNARE and Associated Proteins	AT3G52400	60.8	5.5e-86	315.5
Bhi03g01774	.	1	283	SNARE and Associated Proteins	AT3G52400	60.8	5.5e-86	315.5
Bhi08g01910	.	1	281	SNARE and Associated Proteins	AT3G52400	56.7	1.8e-81	300.4
Bhi08g01910	.	1	299	SNARE and Associated Proteins	AT4G03330	69.2	1.6e-108	390.2
Bhi11g02367	.	1	279	SNARE and Associated Proteins	AT4G03330	58.2	1.1e-82	304.3
Bhi03g01775	.	1	290	SNARE and Associated Proteins	AT4G03330	53.8	4.9e-78	288.9
Bhi03g01774	.	1	290	SNARE and Associated Proteins	AT4G03330	53.8	4.9e-78	288.9
Bhi11g01551	CCT	1	285	SNARE and Associated Proteins	AT4G03330	51.6	1.4e-69	260.8
Bhi08g01910	.	1	303	SNARE and Associated Proteins	AT1G61290	78.9	4.0e-128	455.3
Bhi11g02367	.	1	279	SNARE and Associated Proteins	AT1G61290	62.8	3.3e-90	329.3
Bhi03g01775	.	1	283	SNARE and Associated Proteins	AT1G61290	56.9	9.6e-82	301.2
Bhi03g01774	.	1	283	SNARE and Associated Proteins	AT1G61290	56.9	9.6e-82	301.2
Bhi08g01910	.	1	303	SNARE and Associated Proteins	AT1G11250	77.2	1.2e-124	443.7
Bhi11g02367	.	1	279	SNARE and Associated Proteins	AT1G11250	62.7	1.2e-92	337.4
Bhi03g01775	.	1	292	SNARE and Associated Proteins	AT1G11250	56.8	8.2e-86	314.7
Bhi03g01774	.	1	292	SNARE and Associated Proteins	AT1G11250	56.8	8.2e-86	314.7
Bhi11g01551	CCT	1	308	SNARE and Associated Proteins	AT3G03800	73.1	1.6e-113	406.8
Bhi10g01452	.	1	305	SNARE and Associated Proteins	AT3G03800	54.8	1.3e-83	307.4
Bhi10g01451	.	1	270	SNARE and Associated Proteins	AT3G03800	57.8	7.4e-82	301.6
Bhi11g01551	CCT	1	203	SNARE and Associated Proteins	AT5G08080	77.9	3.6e-78	288.9
Bhi10g01452	.	1	204	SNARE and Associated Proteins	AT5G08080	58.8	2.1e-54	209.9
Bhi10g01451	.	2	169	SNARE and Associated Proteins	AT5G08080	62.5	2.4e-50	196.4
Bhi11g00014	.	1	256	SNARE and Associated Proteins	AT5G16830	59.2	4.7e-75	278.9
Bhi11g00014	.	1	256	SNARE and Associated Proteins	AT5G46860	66.0	4.6e-80	295.4
Bhi11g00014	.	1	256	SNARE and Associated Proteins	AT4G17730	60.9	3.1e-73	272.7
Bhi11g00014	.	65	256	SNARE and Associated Proteins	AT1G32270	59.9	5.2e-52	202.6
Bhi07g00570	.	1	336	SNARE and Associated Proteins	AT5G05760	65.3	3.2e-110	396.0
Bhi04g01047	.	8	338	SNARE and Associated Proteins	AT3G24350	63.9	7.1e-100	361.7
Bhi06g01461	.	1	327	SNARE and Associated Proteins	AT5G26980	75.2	5.7e-125	444.9
Bhi09g00937	.	1	318	SNARE and Associated Proteins	AT5G26980	66.5	8.0e-103	371.3
Bhi09g00938	.	1	317	SNARE and Associated Proteins	AT5G26980	66.5	2.0e-101	366.7
Bhi09g00937	.	1	318	SNARE and Associated Proteins	AT4G02195	67.1	5.9e-106	381.7
Bhi09g00938	.	1	317	SNARE and Associated Proteins	AT4G02195	66.8	3.3e-104	375.9
Bhi06g01461	.	1	329	SNARE and Associated Proteins	AT4G02195	63.4	2.1e-103	373.2
Bhi06g01461	.	1	328	SNARE and Associated Proteins	AT3G05710	74.8	6.2e-127	451.4
Bhi09g00937	.	1	318	SNARE and Associated Proteins	AT3G05710	64.0	2.5e-99	359.8
Bhi09g00938	.	1	317	SNARE and Associated Proteins	AT3G05710	64.0	6.1e-98	355.1
Bhi09g01700	.	1	233	SNARE and Associated Proteins	AT1G16240	70.8	1.8e-88	323.2
Bhi11g00534	.	4	232	SNARE and Associated Proteins	AT1G16240	66.8	1.8e-80	296.6
Bhi11g00535	.	4	232	SNARE and Associated Proteins	AT1G16240	66.8	1.8e-80	296.6
Bhi11g00536	.	4	232	SNARE and Associated Proteins	AT1G16240	66.8	1.8e-80	296.6
Bhi11g00537	.	4	232	SNARE and Associated Proteins	AT1G16240	66.8	1.8e-80	296.6
Bhi09g01700	.	1	233	SNARE and Associated Proteins	AT1G79590	69.5	3.3e-86	315.8
Bhi11g00534	.	4	232	SNARE and Associated Proteins	AT1G79590	67.2	2.4e-81	299.7
Bhi11g00535	.	4	232	SNARE and Associated Proteins	AT1G79590	67.2	2.4e-81	299.7
Bhi11g00536	.	4	232	SNARE and Associated Proteins	AT1G79590	67.2	2.4e-81	299.7
Bhi11g00537	.	4	232	SNARE and Associated Proteins	AT1G79590	67.2	2.4e-81	299.7
Bhi12g02591	.	56	246	SNARE and Associated Proteins	AT1G28490	71.7	1.7e-66	250.0
Bhi11g02112	.	1	264	SNARE and Associated Proteins	AT3G09740	79.3	1.6e-112	403.3
Bhi10g00561	.	1	265	SNARE and Associated Proteins	AT3G09740	67.4	1.3e-95	347.1
Bhi10g00561	.	1	265	SNARE and Associated Proteins	AT3G45280	64.4	8.4e-90	327.8
Bhi11g02112	.	1	264	SNARE and Associated Proteins	AT3G45280	65.2	3.5e-88	322.4
Bhi11g02112	.	1	261	SNARE and Associated Proteins	AT3G61450	68.6	1.1e-94	344.0
Bhi10g00561	.	1	262	SNARE and Associated Proteins	AT3G61450	61.0	5.2e-84	308.5
Bhi04g02346	.	99	342	SNARE and Associated Proteins	AT1G51740	72.4	7.0e-91	331.3

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0002038	1	2	1	1	1	2	3	2	2	2	2	2	3	3	2	3	2	2	3	2	3	2	2	2	2	2	3	2	2	2	63