Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Blo01g00722 ATGACCAAATCATTTCTGAGCTATGTAGAACTAAAGAAACAAGCAATGAAGGATTTGGAAGCTGGGCCAGACATCGAGATGGGGAAACTTGACCCTGCAGATGAACAAAATCTCTCGCACTTTTTTGAAGAAGTTGGTGCGATCAAAGCAAGCATGGAAGAGATCACTAATCTTCTCTTCGACCTTCAAAACCTGAACGAAGAGGCGAAATCCATTTATAATGCCAATGCTCTTAGTGGAGTCAGAGAAAAAATCAACTTAGACATGGTCGAGGTTCTTCGAAAGGCAAAAAATATCAAAACGAAGCTTGGATTTCTTGATCAATCCAATATCGCCAATCGAAAAGTATCAAAATCTTACAAAGAAGGAAGCCCAGTTGACAGGACGAGAATTTCTGTTACGAACGGGCTGAGAATTAAACTGAGAGATATGATGAATGATTTTCAAGCATTGAGAGAGCAGATTCTGAAGGATCACAAAGAGGGTCTGAAGAGAAGGTATTTTGCTGCAACTGGAGAAGAAGCTAGCGAGGAAGCCATTGAAAGGATGATTTCAGAAGGTGGGAAAGAGAAGATCTTTGAAGGGAAAAAAGACTTGTTAATGGAGAATGAGGAGAGAGAAGAGGGTTTGAAGGAGATACAGAGGAGCCTGAAGGAGCTTCATCAGGTTTTTCTTGATATGGCTGTTCTGGTGGAAACTCAAGGAGAGCACATGAATAATATTGAGCAGAATATGAGTTGGGCTGGAGCTCATATCCAGGATGGAACAAAGGAGCTGTTGGATGCCAAGAAATTGAAGAGCAGAGCTCAATGGACTTACTGGATTGTAGCTCTGGTTTTAATTCTGCTGTTCATTTGCCTTATTTCTACATTGGTTTACTAA 882 40.82 MTKSFLSYVELKKQAMKDLEAGPDIEMGKLDPADEQNLSHFFEEVGAIKASMEEITNLLFDLQNLNEEAKSIYNANALSGVREKINLDMVEVLRKAKNIKTKLGFLDQSNIANRKVSKSYKEGSPVDRTRISVTNGLRIKLRDMMNDFQALREQILKDHKEGLKRRYFAATGEEASEEAIERMISEGGKEKIFEGKKDLLMENEEREEGLKEIQRSLKELHQVFLDMAVLVETQGEHMNNIEQNMSWAGAHIQDGTKELLDAKKLKSRAQWTYWIVALVLILLFICLISTLVY 293
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
1 9192879 9193760 + BLOR00722 Blo01g00722 55162

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Blo01g00722 293 Pfam SNARE domain 238 285 IPR000727 -
Blo01g00722 293 SUPERFAMILY t-snare proteins 37 255 IPR010989 GO:0016020|GO:0016192
Blo01g00722 293 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 200 262 IPR000727 -
Blo01g00722 293 Gene3D - 194 292 - -
Blo01g00722 293 CDD SynN 38 188 IPR006011 GO:0016020
Blo01g00722 293 CDD SNARE_syntaxin1-like 204 259 - -
Blo01g00722 293 Coils Coil 48 68 - -
Blo01g00722 293 Pfam Syntaxin 41 235 IPR006011 GO:0016020
Blo01g00722 293 ProSitePatterns Syntaxin / epimorphin family signature. 206 245 IPR006012 GO:0005484|GO:0006886|GO:0016020
Blo01g00722 293 SMART tSNARE_6 195 262 IPR000727 -
Blo01g00722 293 Gene3D - 33 163 - -
Blo01g00722 293 SMART SynN_4 33 160 IPR006011 GO:0016020
Blo01g00722 293 PANTHER SYNTAXIN-112 8 289 - -
Blo01g00722 293 PANTHER SYNTAXIN 8 289 IPR045242 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Blo01g00722 K08486 STX1B_2_3; syntaxin 1B/2/3 - csin:114258522 413.305
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Blo01g00722 Blo-Chr1:9192879 Blo15g00703 Blo-Chr15:22339372 0 dispersed
Blo17g00576 Blo-Chr17:10693580 Blo01g00722 Blo-Chr1:9192879 1.73E-10 dispersed
Blo01g00722 Blo-Chr1:9192879 Blo04g00912 Blo-Chr4:10701857 1.12E-116 transposed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Blo18g00047 . 82 420 SNARE and Associated Proteins AT3G24350 60.1 5.5e-93 338.2
Blo17g00037 BCT 445 752 SNARE and Associated Proteins AT3G24350 62.3 1.9e-90 329.7
Blo04g00912 BCT 1 286 SNARE and Associated Proteins AT2G18260 53.8 5.1e-76 281.6
Blo15g00703 . 102 394 SNARE and Associated Proteins AT2G18260 50.2 4.3e-75 278.5
Blo01g00722 . 1 289 SNARE and Associated Proteins AT2G18260 50.2 1.5e-72 270.0
Blo16g00051 BCT 1 271 SNARE and Associated Proteins AT2G18260 51.6 6.1e-69 258.1
Blo09g00464 . 22 278 SNARE and Associated Proteins AT3G11820 81.3 3.2e-113 405.2
Blo12g00540 . 1 261 SNARE and Associated Proteins AT3G11820 73.6 7.1e-105 377.5
Blo08g00183 . 954 1204 SNARE and Associated Proteins AT3G11820 66.1 3.3e-94 342.0
Blo14g00365 . 31 281 SNARE and Associated Proteins AT3G11820 65.7 1.3e-93 340.1
Blo09g00464 . 29 278 SNARE and Associated Proteins AT3G52400 70.0 2.4e-90 329.3
Blo12g00540 . 13 261 SNARE and Associated Proteins AT3G52400 65.5 7.5e-84 307.8
Blo14g00365 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 9.1e-82 300.8
Blo08g00183 . 924 1204 SNARE and Associated Proteins AT3G52400 56.4 1.2e-81 300.4
Blo14g00365 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 7.8e-109 390.6
Blo08g00183 . 924 1218 SNARE and Associated Proteins AT4G03330 67.1 2.8e-106 382.1
Blo09g00464 . 1 278 SNARE and Associated Proteins AT4G03330 58.0 5.1e-84 308.1
Blo12g00540 . 10 261 SNARE and Associated Proteins AT4G03330 56.7 1.7e-74 276.6
Blo15g00503 . 136 373 SNARE and Associated Proteins AT4G03330 50.8 1.0e-55 214.2
Blo14g00365 . 1 299 SNARE and Associated Proteins AT1G61290 78.3 1.2e-125 446.4
Blo08g00183 . 924 1226 SNARE and Associated Proteins AT1G61290 77.6 5.0e-124 441.0
Blo09g00464 . 1 272 SNARE and Associated Proteins AT1G61290 63.5 3.1e-89 325.5
Blo12g00540 . 13 261 SNARE and Associated Proteins AT1G61290 61.8 6.9e-81 297.7
Blo14g00365 . 1 299 SNARE and Associated Proteins AT1G11250 76.6 1.8e-121 432.6
Blo08g00183 . 924 1226 SNARE and Associated Proteins AT1G11250 75.9 8.7e-121 430.3
Blo09g00464 . 1 272 SNARE and Associated Proteins AT1G11250 64.3 1.2e-93 340.1
Blo12g00540 . 3 261 SNARE and Associated Proteins AT1G11250 61.0 2.2e-84 309.3
Blo15g00503 . 96 396 SNARE and Associated Proteins AT3G03800 59.8 7.7e-88 320.9
Blo12g00540 . 13 277 SNARE and Associated Proteins AT3G03800 51.5 4.0e-60 228.8
Blo15g00503 . 97 293 SNARE and Associated Proteins AT5G08080 60.4 8.4e-52 200.7
Blo02g00982 . 1 263 SNARE and Associated Proteins AT5G16830 61.3 1.4e-75 280.0
Blo03g00106 . 225 443 SNARE and Associated Proteins AT5G16830 57.3 4.7e-60 228.4
Blo02g00982 . 1 274 SNARE and Associated Proteins AT5G46860 69.7 5.9e-84 307.8
Blo03g00106 . 225 414 SNARE and Associated Proteins AT5G46860 76.3 7.5e-71 264.2
Blo02g00982 . 1 257 SNARE and Associated Proteins AT4G17730 65.8 8.9e-77 283.9
Blo03g00106 . 225 414 SNARE and Associated Proteins AT4G17730 76.2 3.5e-73 271.9
Blo18g00562 BCT 1 182 SNARE and Associated Proteins AT4G17730 51.5 1.1e-42 170.6
Blo02g00982 . 65 256 SNARE and Associated Proteins AT1G32270 59.4 9.2e-50 194.5
Blo03g00106 . 289 440 SNARE and Associated Proteins AT1G32270 64.5 1.2e-44 177.6
Blo04g00243 . 1 337 SNARE and Associated Proteins AT5G05760 65.8 2.4e-111 399.1
Blo18g00047 . 82 420 SNARE and Associated Proteins AT3G24350 60.1 5.5e-93 338.2
Blo17g00037 BCT 445 752 SNARE and Associated Proteins AT3G24350 62.3 1.9e-90 329.7
Blo18g00633 . 1 341 SNARE and Associated Proteins AT5G26980 74.8 9.1e-124 440.3
Blo17g00673 . 115 418 SNARE and Associated Proteins AT5G26980 71.4 1.6e-112 402.9
Blo18g00633 . 1 339 SNARE and Associated Proteins AT4G02195 62.8 2.1e-99 359.4
Blo17g00673 . 115 416 SNARE and Associated Proteins AT4G02195 60.9 7.1e-92 334.3
Blo18g00633 . 1 339 SNARE and Associated Proteins AT3G05710 74.9 4.5e-126 448.0
Blo17g00673 . 115 416 SNARE and Associated Proteins AT3G05710 71.7 2.6e-113 405.6
Blo03g00538 . 1 220 SNARE and Associated Proteins AT1G16240 72.7 2.3e-84 308.9
Blo07g00879 . 34 267 SNARE and Associated Proteins AT1G16240 58.5 7.1e-70 260.8
Blo03g00538 . 1 220 SNARE and Associated Proteins AT1G79590 71.8 2.0e-84 309.3
Blo07g00879 . 34 267 SNARE and Associated Proteins AT1G79590 59.8 1.6e-70 263.1
Blo03g00554 . 55 234 SNARE and Associated Proteins AT1G28490 66.1 5.8e-60 227.6
Blo03g01454 . 55 215 SNARE and Associated Proteins AT1G28490 60.9 1.6e-49 193.0
Blo07g01404 . 1 248 SNARE and Associated Proteins AT3G09740 72.4 4.0e-93 338.2
Blo14g00167 . 1 233 SNARE and Associated Proteins AT3G09740 61.0 4.8e-70 261.5
Blo07g01404 . 1 248 SNARE and Associated Proteins AT3G45280 60.4 5.5e-74 274.6
Blo14g00167 . 1 236 SNARE and Associated Proteins AT3G45280 57.7 1.4e-66 250.0
Blo07g01404 . 1 248 SNARE and Associated Proteins AT3G61450 60.6 5.2e-77 284.6
Blo14g00167 . 1 235 SNARE and Associated Proteins AT3G61450 53.8 3.6e-62 235.3
Blo04g00134 . 624 868 SNARE and Associated Proteins AT1G51740 72.4 2.7e-91 332.0
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002433 5 3 5 4 2 1 2 1 2 2 1 1 2 1 2 1 1 3 2 1 2 3 2 2 1 1 1 2 1 4 61