Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Blo02g00982 ATGAGTTTTCAAGATATCGAGGCGGGCCGGCCCTATGCTTATTCGAAGCGGGAAGCCATCAATGGCAAGCAGGACCCGACACAAGCCGTCGCCTCTGGTGTATTTCAGATCAACACAGCCGTTGCTACCTTTCAGAGGCTCGTCAATACCTTAGGAACTCCGAAGGACACCCCCGAGCTCCGAGAGAAGCTGCATAAGACAAGGCTTCATATTGGACAGTTGGTGAAAGATACTTCTGCCAGACTTAAACAAGCGAGTGAAATAGATCATCAGACTGAAGTTAAAGCCAGCAAGAAAATTGCAGATGCAAAACTTGCCAAAGACTTTCAAGCGGTGTTGAAAGAATTTCAAAAGGCTCAACGACTTGCGGCTGAGAGAGAAACTGCATATACTCCTTTTGTTCCCCAAGCAGTTCTCCCTTCCAGCTACACAGCCAGCGAGATTGATGTACGACCAGATAAGACTCCTGAGCAGCGTGCACTCCTTGTGGAGTCTAGGAGACAAGAAGTATTGCTTTTGGACAATGAAATTGTCTTCAACGAGGCGATAATTGAGGAAAGAGAGCAGGGGATTGAAGAAATACAACAACAAATTGGTGAAGTAAATGAGATTTTCAAAGATTTGGCTGTTCTGGTCCACGAGCAGGGAGCCATGATTGATGACATTGGATCTAACATCGAAAGTTCCCATGCGGCTACTGCACAAGGAACGTCCCAACTTGTCAAAGCCTCAAAGGCACAAAGATCAAATTCATCTCTGTCCTGCTTACTCTTGGTGATATTTGGGATTTTGCTTCTCATTGTGATCATACTTGTGGCTGCTTAA 825 45.7 MSFQDIEAGRPYAYSKREAINGKQDPTQAVASGVFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSARLKQASEIDHQTEVKASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYTPFVPQAVLPSSYTASEIDVRPDKTPEQRALLVESRRQEVLLLDNEIVFNEAIIEEREQGIEEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIESSHAATAQGTSQLVKASKAQRSNSSLSCLLLVIFGILLLIVIILVAA 274
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
2 37993441 37997352 + BLOR10712 Blo02g00982 57212

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Blo02g00982 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Blo02g00982 274 Pfam SNARE domain 218 269 IPR000727 -
Blo02g00982 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020|GO:0016192
Blo02g00982 274 SMART tSNARE_6 176 243 IPR000727 -
Blo02g00982 274 SMART SynN_4 15 128 IPR006011 GO:0016020
Blo02g00982 274 Gene3D - 174 274 - -
Blo02g00982 274 CDD SNARE_Qa 184 242 - -
Blo02g00982 274 Gene3D - 18 134 - -
Blo02g00982 274 CDD SynN 24 149 IPR006011 GO:0016020
Blo02g00982 274 PANTHER SYNTAXIN OF PLANTS PROTEIN 7 273 - -
Blo02g00982 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484|GO:0006886|GO:0016020
Blo02g00982 274 PANTHER SYNTAXIN 7 273 IPR045242 -
Blo02g00982 274 Pfam Syntaxin-like protein 31 130 IPR006011 GO:0016020
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Blo02g00982 - - K08488 bhj:120089793 414.075
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Blo02g00982 Blo-Chr2:37993441 Blo18g00562 Blo-Chr18:7935770 5.22E-87 dispersed
Blo02g00982 Blo-Chr2:37993441 Blo03g00106 Blo-Chr3:3337321 7.11E-147 wgd
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Blo18g00047 . 82 420 SNARE and Associated Proteins AT3G24350 60.1 5.5e-93 338.2
Blo17g00037 BCT 445 752 SNARE and Associated Proteins AT3G24350 62.3 1.9e-90 329.7
Blo04g00912 BCT 1 286 SNARE and Associated Proteins AT2G18260 53.8 5.1e-76 281.6
Blo15g00703 . 102 394 SNARE and Associated Proteins AT2G18260 50.2 4.3e-75 278.5
Blo01g00722 . 1 289 SNARE and Associated Proteins AT2G18260 50.2 1.5e-72 270.0
Blo16g00051 BCT 1 271 SNARE and Associated Proteins AT2G18260 51.6 6.1e-69 258.1
Blo09g00464 . 22 278 SNARE and Associated Proteins AT3G11820 81.3 3.2e-113 405.2
Blo12g00540 . 1 261 SNARE and Associated Proteins AT3G11820 73.6 7.1e-105 377.5
Blo08g00183 . 954 1204 SNARE and Associated Proteins AT3G11820 66.1 3.3e-94 342.0
Blo14g00365 . 31 281 SNARE and Associated Proteins AT3G11820 65.7 1.3e-93 340.1
Blo09g00464 . 29 278 SNARE and Associated Proteins AT3G52400 70.0 2.4e-90 329.3
Blo12g00540 . 13 261 SNARE and Associated Proteins AT3G52400 65.5 7.5e-84 307.8
Blo14g00365 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 9.1e-82 300.8
Blo08g00183 . 924 1204 SNARE and Associated Proteins AT3G52400 56.4 1.2e-81 300.4
Blo14g00365 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 7.8e-109 390.6
Blo08g00183 . 924 1218 SNARE and Associated Proteins AT4G03330 67.1 2.8e-106 382.1
Blo09g00464 . 1 278 SNARE and Associated Proteins AT4G03330 58.0 5.1e-84 308.1
Blo12g00540 . 10 261 SNARE and Associated Proteins AT4G03330 56.7 1.7e-74 276.6
Blo15g00503 . 136 373 SNARE and Associated Proteins AT4G03330 50.8 1.0e-55 214.2
Blo14g00365 . 1 299 SNARE and Associated Proteins AT1G61290 78.3 1.2e-125 446.4
Blo08g00183 . 924 1226 SNARE and Associated Proteins AT1G61290 77.6 5.0e-124 441.0
Blo09g00464 . 1 272 SNARE and Associated Proteins AT1G61290 63.5 3.1e-89 325.5
Blo12g00540 . 13 261 SNARE and Associated Proteins AT1G61290 61.8 6.9e-81 297.7
Blo14g00365 . 1 299 SNARE and Associated Proteins AT1G11250 76.6 1.8e-121 432.6
Blo08g00183 . 924 1226 SNARE and Associated Proteins AT1G11250 75.9 8.7e-121 430.3
Blo09g00464 . 1 272 SNARE and Associated Proteins AT1G11250 64.3 1.2e-93 340.1
Blo12g00540 . 3 261 SNARE and Associated Proteins AT1G11250 61.0 2.2e-84 309.3
Blo15g00503 . 96 396 SNARE and Associated Proteins AT3G03800 59.8 7.7e-88 320.9
Blo12g00540 . 13 277 SNARE and Associated Proteins AT3G03800 51.5 4.0e-60 228.8
Blo15g00503 . 97 293 SNARE and Associated Proteins AT5G08080 60.4 8.4e-52 200.7
Blo02g00982 . 1 263 SNARE and Associated Proteins AT5G16830 61.3 1.4e-75 280.0
Blo03g00106 . 225 443 SNARE and Associated Proteins AT5G16830 57.3 4.7e-60 228.4
Blo02g00982 . 1 274 SNARE and Associated Proteins AT5G46860 69.7 5.9e-84 307.8
Blo03g00106 . 225 414 SNARE and Associated Proteins AT5G46860 76.3 7.5e-71 264.2
Blo02g00982 . 1 257 SNARE and Associated Proteins AT4G17730 65.8 8.9e-77 283.9
Blo03g00106 . 225 414 SNARE and Associated Proteins AT4G17730 76.2 3.5e-73 271.9
Blo18g00562 BCT 1 182 SNARE and Associated Proteins AT4G17730 51.5 1.1e-42 170.6
Blo02g00982 . 65 256 SNARE and Associated Proteins AT1G32270 59.4 9.2e-50 194.5
Blo03g00106 . 289 440 SNARE and Associated Proteins AT1G32270 64.5 1.2e-44 177.6
Blo04g00243 . 1 337 SNARE and Associated Proteins AT5G05760 65.8 2.4e-111 399.1
Blo18g00047 . 82 420 SNARE and Associated Proteins AT3G24350 60.1 5.5e-93 338.2
Blo17g00037 BCT 445 752 SNARE and Associated Proteins AT3G24350 62.3 1.9e-90 329.7
Blo18g00633 . 1 341 SNARE and Associated Proteins AT5G26980 74.8 9.1e-124 440.3
Blo17g00673 . 115 418 SNARE and Associated Proteins AT5G26980 71.4 1.6e-112 402.9
Blo18g00633 . 1 339 SNARE and Associated Proteins AT4G02195 62.8 2.1e-99 359.4
Blo17g00673 . 115 416 SNARE and Associated Proteins AT4G02195 60.9 7.1e-92 334.3
Blo18g00633 . 1 339 SNARE and Associated Proteins AT3G05710 74.9 4.5e-126 448.0
Blo17g00673 . 115 416 SNARE and Associated Proteins AT3G05710 71.7 2.6e-113 405.6
Blo03g00538 . 1 220 SNARE and Associated Proteins AT1G16240 72.7 2.3e-84 308.9
Blo07g00879 . 34 267 SNARE and Associated Proteins AT1G16240 58.5 7.1e-70 260.8
Blo03g00538 . 1 220 SNARE and Associated Proteins AT1G79590 71.8 2.0e-84 309.3
Blo07g00879 . 34 267 SNARE and Associated Proteins AT1G79590 59.8 1.6e-70 263.1
Blo03g00554 . 55 234 SNARE and Associated Proteins AT1G28490 66.1 5.8e-60 227.6
Blo03g01454 . 55 215 SNARE and Associated Proteins AT1G28490 60.9 1.6e-49 193.0
Blo07g01404 . 1 248 SNARE and Associated Proteins AT3G09740 72.4 4.0e-93 338.2
Blo14g00167 . 1 233 SNARE and Associated Proteins AT3G09740 61.0 4.8e-70 261.5
Blo07g01404 . 1 248 SNARE and Associated Proteins AT3G45280 60.4 5.5e-74 274.6
Blo14g00167 . 1 236 SNARE and Associated Proteins AT3G45280 57.7 1.4e-66 250.0
Blo07g01404 . 1 248 SNARE and Associated Proteins AT3G61450 60.6 5.2e-77 284.6
Blo14g00167 . 1 235 SNARE and Associated Proteins AT3G61450 53.8 3.6e-62 235.3
Blo04g00134 . 624 868 SNARE and Associated Proteins AT1G51740 72.4 2.7e-91 332.0
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Blo02g00982 Blo_Chr02 FPKM 16.578651 17.920748 26.283564 25.480211 5.058192 2.751561 4.193406 50.544281 48.963734 44.83147