Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Blo08g00141 ATGCAACTGCACCCACGGCACTTCGGCCGCAACCTCCGGGATAATCTTGTGTCCAAGCTCATGAAAGATGTTGAGGGCACTTGCAGTGGCCGACATGGTTTTGTGGTGGCAATAACGGGTATTGAGAACATTGGGAAAGGGCTGATTCGTGATGGCACAGGATTTGTTACATTTCCAGTTAAGTATCAGTGTGTAGTATTCAGGCCCTTCAAAGGAGAAATCTTAGAGGCTGTTGTCACCATGGTAAACAAGATGGGGTTTTTCGCTGAGGCTGGACCTGTTCAGATTTTTGTTTCAAACCATTTGATACCAGACGATATGGAGTTTCAGTCAGGAGACATGCCAAACTACACTACCTCAGATGGATCAGTGAAGATTCAGAAAGATAGCGAGGTGCGATTAAAGATAATTGGCACTCGAGTGGATGCAACTGAAATTATCCGAGCAAATCCTGGACAAAGAATCGACAACATACGAAGAACCGAATCAACGTACCCTAATCGAGCTGCAAGGGGCTCTAAAACGAGACTCTTCGATCTTCGTAGCGCCGGGGTTGCCTTCGCAGAGAAGGGGATTGTCTTCGCAACGCAGGGGTTCACAGAGCAGGGTTCGTCTTCGCCCAGCCAGAGGTCGCTTCGCAGAGTCGGGCTTTGCTTCTGGGTGTCGTCGTCTTCATCTTCGTCGTCGCCTTCGTGCTTCGGAGAGGAGATTTTGAGCTGCTGCAGAGGAAGCTTTAGTCTTCTGGAGATTAGATATAAACGGCCAGTAAACGGAAGGTGTCAGATGAAAACACAGCATAGTACAAGATCTTCTCCGCTATGTTTTTGTGCTCTAGATGCGGATATGGAAGACTATGGATTCGAATACTCCGATGAGGAGCCTGAGGAGCAGGACGTTGATATTGAGAACCAATATTACAACTCTAAAGGGTTGGTCGAAACAGATCCTGAAGAAGCACTTGCAGGATTTTCTGAAGTGGTTCACATGGAACCTGAAAAGGCTGAGTGGGGTTTTAAAGCTTTGAAACAAACGGTGAAGCTTTATTATCGTCTAGGGAGGTACAAAGAGATGATGGAAGCTTATAGAGTGATGCTTACTTACATCAAATCAGCAGTGACACGTAATTATAGCGAAAAATGCATTAACAATATAATGGATTTTGTTTCTGGGTCAGCTAGTCAGAACTTTGGTCTCTTGCAAGAATTTTATCAAACTACTCTAAAAGCTCTTGAAGAGGCAAAAAATGAGCGACTTTGGTTCAAGACTAATCTAAAGCTCTGTAAGATCTGGTTTGATATAGGGGAATATGGACGGATGAATAAGATTTTGAAGGAACTTCATAAATCTTGTCAAAGAGAAGACGGTGCAGATGATCAAAAGAAAGGAAGTCAACTTCTAGAAGTATATGCAATCGAAATTCAAATGTATACAGAAACTAAAAATAACAAAAAGCTCAAGCAATTATACCAAAAGGCTCTTGCAATCAAGTCGGCCATTCCCCATCCACGGATCATGGGAATAATTCGTGAATGTGGGGGTAAGATGCACATGGCAGAGCGTCAGTGGGCAGAAGCAGCCACAGATTTCTTTGAAGCTTTTAAGAACTATGATGAAGCTGGCAATCAAAGACGTATTCAGTGCTTGAAATATTTAGTTTTGGCTAATATGCTTATGGAATCAGAAGTTAATCCTTTTGATGGTCAAGAGGCGAAGCCGTATAAAAACGACCCGGAAATTTTGGCTATGACAAATCTTATAGCAGCATATCAGAGGAATGAAATACTTGAATTTGAGAAAATTCTTAAGAGTAACAGAAGGACAATTATGGACGATCCATTCATCCGAAACTACATCGAAGACTTGTTGAAAAATGTTAGAACCCAAGTTCTGCTTAAGCTCATCAAGCCTTACACCAGAATCCGAATACCATTTATATCCCAGGAGCTTAATGTGCCAGAAAAAGACGTAGAACAGTTGTTGGTTTCTCTTATATTGGATAACCGCATTGACGGCCACATCGATCAAGTGAACCGGCTTCTAGAGCGCGGTGACAGGAAGCTTTATCATATCCACGTCCTTATGTTTACTTTCATTTCTTTCATAGGCTGTATCACCACCAAGGAGCTTGGAACTGTAATGCGATCTTTGGGTCAGAACCCAACTGAAGCAGAGTTGCAAGACATGATAAATGAAGTGGATGCTGATGGTAATGGAACTATTGATTTCCCAGAGTTCCTTAATCTGATGGCCAGGAAAATGAAGGACACAGACTCAGAGGAGGAACTGAAGGAAGCTTTTCGAGTTTTTGACAAGGACCAGAATGGCTTTATTTCTGCAGCTGAGCTTCGCCATGTGATGACGAATTTAGGTGAGAAGCTAACAGATGAAGAAGTTGATGAGATGATTCGTGAAGCTGATGTCGATGGTGACGGACAGATCAACTATGATGAATTTGTCAGAGTCATGATGGCCAAGAGCATCAGCAATGCCTCCATTGGCAGAAGAAATCTAGCTTCCTGTAGTACAGCCAACCCCATTGATGACTGCTGGAGGTGCGACTCTAATTGGGCGACTAACCGGAAGCGTCTCGCTGATTGTGCCATTGGCTTCGGCAAGCAGGCGATCGGCGGGAGAGACGGACAGATTTATGTCGTCACCGACCCAACTGACACAGACCTCATAAACCCTAAACCAGGCACCCTCCGTTACGCGGTCATACAAGACGAGCCCCTCTGGATCATCTTCAGCCGAGATATGGTCATCAAGCTAAAAGCAGAGCTCATCATGAACTCCTTCAAGACCATCGACGGCCGCGGAGTCAACGTCCACATAGCCGGCGGACCCTGCATTACGATTCAGTACGTGACGAACATCATAATTCACGGAATCAGCATTCACGATTGCAAGGTCGGAGGGAACACCTACGTGAGAGACTCGCCGGATCATTACGGCTGGCGGACGTTGTCAGACGGAGATGGTATTTCGATCTTCGGAGGAAGCCATGTTTGGGTGGACCATTGCTCTCTGTCTAACTGCAATGACGGTCTGATAGACGCTATTCGTGGGTCGACCGCCATAACCATATCTAACAATTACATGACCCATCACGGCAAAGTCATGCTCTTAGGCCACAGCGATTCCTACATACAAGACAAGAACATGCAAGTCACCATAGCTTTCAACCATTTCGGAGAAGGACTAATCCAGAGAATGCCAAGATGTAGACATGGGTATTTCCACGTCGTGAATAATGACTACACTCATTGGGTAATGTACGCCATCGGCGGTAGCGCAGCTCCGACGATCAACAGCCAAGGCAACAGATTTCTAGCCCCAAACGACGCTGACCACAAAGAGGTAACGAAGCACGAGAACACAGCAGAGAGAGAATGGAGCAAGTGGAATTGGAGATCTCAGGGAGATTTGATGTTAAACGGTGCATTTTTCACGGGATCTGGATCGGCCGGGTCCTCCAGCTACGCCAAGGCGTCGAGCGTGAGCGCAAGACCATCGTCGCTAAGCTTTGATTGTATGCAAGCTTTTTCATCACAACTGAAATGTGTTCTGGGTGGACCACAACTTGACCGATTGACAACCAAGGAGAAGGAATACAGCTTCTGGAGAAGTGATATTCCATTTTTATTGAAGGCCGAGGCCGAGGCCGAGATTGTAACAATGGCGGCAACGAAAGAGGAGAGTCTTTTGATTGATTCAGCTGGTTTGACATGA 3729 45.32 MQLHPRHFGRNLRDNLVSKLMKDVEGTCSGRHGFVVAITGIENIGKGLIRDGTGFVTFPVKYQCVVFRPFKGEILEAVVTMVNKMGFFAEAGPVQIFVSNHLIPDDMEFQSGDMPNYTTSDGSVKIQKDSEVRLKIIGTRVDATEIIRANPGQRIDNIRRTESTYPNRAARGSKTRLFDLRSAGVAFAEKGIVFATQGFTEQGSSSPSQRSLRRVGLCFWVSSSSSSSSPSCFGEEILSCCRGSFSLLEIRYKRPVNGRCQMKTQHSTRSSPLCFCALDADMEDYGFEYSDEEPEEQDVDIENQYYNSKGLVETDPEEALAGFSEVVHMEPEKAEWGFKALKQTVKLYYRLGRYKEMMEAYRVMLTYIKSAVTRNYSEKCINNIMDFVSGSASQNFGLLQEFYQTTLKALEEAKNERLWFKTNLKLCKIWFDIGEYGRMNKILKELHKSCQREDGADDQKKGSQLLEVYAIEIQMYTETKNNKKLKQLYQKALAIKSAIPHPRIMGIIRECGGKMHMAERQWAEAATDFFEAFKNYDEAGNQRRIQCLKYLVLANMLMESEVNPFDGQEAKPYKNDPEILAMTNLIAAYQRNEILEFEKILKSNRRTIMDDPFIRNYIEDLLKNVRTQVLLKLIKPYTRIRIPFISQELNVPEKDVEQLLVSLILDNRIDGHIDQVNRLLERGDRKLYHIHVLMFTFISFIGCITTKELGTVMRSLGQNPTEAELQDMINEVDADGNGTIDFPEFLNLMARKMKDTDSEEELKEAFRVFDKDQNGFISAAELRHVMTNLGEKLTDEEVDEMIREADVDGDGQINYDEFVRVMMAKSISNASIGRRNLASCSTANPIDDCWRCDSNWATNRKRLADCAIGFGKQAIGGRDGQIYVVTDPTDTDLINPKPGTLRYAVIQDEPLWIIFSRDMVIKLKAELIMNSFKTIDGRGVNVHIAGGPCITIQYVTNIIIHGISIHDCKVGGNTYVRDSPDHYGWRTLSDGDGISIFGGSHVWVDHCSLSNCNDGLIDAIRGSTAITISNNYMTHHGKVMLLGHSDSYIQDKNMQVTIAFNHFGEGLIQRMPRCRHGYFHVVNNDYTHWVMYAIGGSAAPTINSQGNRFLAPNDADHKEVTKHENTAEREWSKWNWRSQGDLMLNGAFFTGSGSAGSSSYAKASSVSARPSSLSFDCMQAFSSQLKCVLGGPQLDRLTTKEKEYSFWRSDIPFLLKAEAEAEIVTMAATKEESLLIDSAGLT 1242
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
8 1477647 1502004 - BLOR20311 Blo08g00141 64093

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Blo08g00141 1242 Gene3D - 71 159 IPR012340 -
Blo08g00141 1242 CDD S1_RNAPII_Rpb7 71 146 - -
Blo08g00141 1242 SMART motif in proteasome subunits, Int-6, Nip-1 and TRIP-15 616 697 - -
Blo08g00141 1242 Gene3D - 843 1183 IPR012334 -
Blo08g00141 1242 SUPERFAMILY N-terminal, heterodimerisation domain of RBP7 (RpoE) 2 68 IPR036898 -
Blo08g00141 1242 SUPERFAMILY Winged helix DNA-binding domain 610 685 IPR036390 -
Blo08g00141 1242 SUPERFAMILY Nucleic acid-binding proteins 68 146 IPR012340 -
Blo08g00141 1242 Gene3D - 699 746 - -
Blo08g00141 1242 Pfam PCI domain 581 681 IPR000717 -
Blo08g00141 1242 Pfam EF-hand domain pair 702 751 IPR002048 GO:0005509
Blo08g00141 1242 ProSitePatterns EF-hand calcium-binding domain. 733 745 IPR018247 -
Blo08g00141 1242 PRINTS Pollen allergen Amb family signature 926 942 IPR018082 -
Blo08g00141 1242 PRINTS Pollen allergen Amb family signature 1134 1158 IPR018082 -
Blo08g00141 1242 PRINTS Pollen allergen Amb family signature 1092 1111 IPR018082 -
Blo08g00141 1242 PRINTS Pollen allergen Amb family signature 990 1011 IPR018082 -
Blo08g00141 1242 PRINTS Pollen allergen Amb family signature 866 883 IPR018082 -
Blo08g00141 1242 PRINTS Pollen allergen Amb family signature 890 915 IPR018082 -
Blo08g00141 1242 PRINTS Pollen allergen Amb family signature 1070 1089 IPR018082 -
Blo08g00141 1242 SMART efh_1 761 789 IPR002048 GO:0005509
Blo08g00141 1242 SMART efh_1 797 825 IPR002048 GO:0005509
Blo08g00141 1242 SMART efh_1 724 752 IPR002048 GO:0005509
Blo08g00141 1242 Pfam S1 RNA binding domain 68 147 IPR003029 GO:0003676
Blo08g00141 1242 ProSitePatterns EF-hand calcium-binding domain. 770 782 IPR018247 -
Blo08g00141 1242 Pfam SHS2 domain found in N terminus of Rpb7p/Rpc25p/MJ0397 2 54 IPR005576 GO:0006351
Blo08g00141 1242 Pfam EF-hand domain pair 759 822 IPR002048 GO:0005509
Blo08g00141 1242 SMART amb_all 918 1115 IPR002022 -
Blo08g00141 1242 Gene3D - 747 838 - -
Blo08g00141 1242 CDD RNAP_II_Rpb7_N 1 71 - -
Blo08g00141 1242 Gene3D - 1 70 IPR036898 -
Blo08g00141 1242 Pfam Pectate lyase 928 1109 IPR002022 -
Blo08g00141 1242 ProSitePatterns EF-hand calcium-binding domain. 806 818 IPR018247 -
Blo08g00141 1242 ProSiteProfiles EF-hand calcium-binding domain profile. 793 828 IPR002048 GO:0005509
Blo08g00141 1242 PANTHER 26S PROTEASOME NON-ATPASE REGULATORY SUBUNIT 11/COP9 SIGNALOSOME COMPLEX SUBUNIT 2 279 686 - -
Blo08g00141 1242 Gene3D - 329 684 - -
Blo08g00141 1242 ProSiteProfiles EF-hand calcium-binding domain profile. 720 755 IPR002048 GO:0005509
Blo08g00141 1242 SUPERFAMILY EF-hand 702 824 IPR011992 -
Blo08g00141 1242 CDD EFh 702 750 IPR002048 GO:0005509
Blo08g00141 1242 ProSiteProfiles EF-hand calcium-binding domain profile. 757 792 IPR002048 GO:0005509
Blo08g00141 1242 SMART PINT_4 616 697 IPR000717 -
Blo08g00141 1242 CDD EFh 761 823 IPR002048 GO:0005509
Blo08g00141 1242 PANTHER - 279 686 - -
Blo08g00141 1242 ProSiteProfiles PCI domain profile. 518 687 IPR000717 -
Blo08g00141 1242 SUPERFAMILY Pectin lyase-like 828 1162 IPR011050 -
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Blo08g00141 K12176 COPS2, CSN2, TRIP15; COP9 signalosome complex subunit 2 - tcc:18590052 790.415
       

WGDs- Genes


Select Gene_1 Gene_2 Event_name
Blo08g00141 Blo14g00306 BCT
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Blo07g01194 Blo-Chr7:31807133 Blo08g00141 Blo-Chr8:1477647 3.25E-65 dispersed
Blo08g00141 Blo-Chr8:1477647 Blo14g00307 Blo-Chr14:3143618 0 dispersed
Blo16g01102 Blo-Chr16:39522729 Blo08g00141 Blo-Chr8:1477647 9.22E-18 dispersed
Blo01g00098 Blo-Chr1:1400427 Blo08g00141 Blo-Chr8:1477647 3.02E-16 transposed
Blo05g00389 Blo-Chr5:4777464 Blo08g00141 Blo-Chr8:1477647 7.63E-08 transposed
Blo06g00583 Blo-Chr6:28510491 Blo08g00141 Blo-Chr8:1477647 2.60E-97 transposed
Blo12g00644 Blo-Chr12:24791886 Blo08g00141 Blo-Chr8:1477647 3.29E-75 transposed
Blo14g00308 Blo-Chr14:3165288 Blo08g00141 Blo-Chr8:1477647 4.21E-69 transposed
Blo14g00306 Blo-Chr14:3136127 Blo08g00141 Blo-Chr8:1477647 6.94E-11 wgd
       

Deco-Alignment


Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi6g915 . . Bda02g00602 Bda09g01315 Bpe01g00341 . . . . . . . . . . . . . . . . . . . Cla02g02337 Cam02g2479 Cec02g2534 Cco02g2564 Clacu02g2458 Cmu02g2392 Cre02g2713 Cone3ag0514 Cone10ag0490 Cone13ag0435 . . . . . Blo08g00141 Blo14g00306 . . Bpe08g00307 . Bma07g00296 . Sed01g3386 . . . . . . Cpe16g00932 . Bhi10g00439 Tan07g0624 Cmetu05g1554 . . . . . . . . . . . . . . .
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Blo04g01306 . 107 690 EF-hand Containing Proteins AT4G25970 74.3 1.0e-256 882.9
Blo13g00242 . 1 181 EF-hand Containing Proteins AT4G25970 71.3 9.7e-69 258.5
Blo04g01306 . 98 646 EF-hand Containing Proteins AT5G57190 73.0 6.3e-240 827.0
Blo13g00242 . 1 123 EF-hand Containing Proteins AT5G57190 72.4 1.1e-47 188.3
Blo07g00806 BCT 2 1834 EF-hand Containing Proteins AT3G14270 60.3 0.0e+00 2013.8
Blo10g00959 BCT 2 1893 EF-hand Containing Proteins AT3G14270 57.7 0.0e+00 1995.3
Blo03g01173 . 5 577 EF-hand Containing Proteins AT5G58670 54.6 1.0e-178 623.6
Blo13g00796 . 3 580 EF-hand Containing Proteins AT5G58670 52.3 7.8e-171 597.4
Blo04g00235 BCT,CCT 3 569 EF-hand Containing Proteins AT5G58670 53.2 1.2e-166 583.6
Blo02g00324 BCT 25 491 EF-hand Containing Proteins AT1G01280 78.0 7.7e-218 753.4
Blo04g00371 . 1 580 EF-hand Containing Proteins AT5G04870 74.4 5.6e-223 770.8
Blo07g01294 . 1 595 EF-hand Containing Proteins AT5G04870 62.8 3.2e-210 728.4
Blo09g00457 . 1 626 EF-hand Containing Proteins AT5G04870 60.1 2.5e-199 692.2
Blo09g00453 . 1 631 EF-hand Containing Proteins AT5G04870 59.4 5.6e-191 664.5
Blo01g01253 . 1 581 EF-hand Containing Proteins AT5G04870 55.1 2.1e-177 619.4
Blo15g00417 . 94 563 EF-hand Containing Proteins AT5G04870 68.4 9.6e-175 610.5
Blo02g00160 . 95 567 EF-hand Containing Proteins AT5G04870 73.2 6.9e-173 604.4
Blo12g00800 . 18 470 EF-hand Containing Proteins AT5G04870 73.5 1.1e-170 597.0
Blo16g00559 . 15 517 EF-hand Containing Proteins AT5G04870 61.0 6.7e-168 587.8
Blo13g00467 . 396 914 EF-hand Containing Proteins AT5G04870 59.9 1.9e-162 569.7
Blo08g00131 BCT 33 522 EF-hand Containing Proteins AT5G04870 57.6 1.8e-157 553.1
Blo14g00295 BCT 62 522 EF-hand Containing Proteins AT5G04870 59.2 1.5e-156 550.1
Blo07g00904 BCT 48 517 EF-hand Containing Proteins AT5G04870 55.5 2.8e-150 529.3
Blo13g00983 . 83 563 EF-hand Containing Proteins AT5G04870 53.1 5.7e-143 505.0
Blo02g01128 . 49 501 EF-hand Containing Proteins AT5G04870 64.9 4.8e-142 501.9
Blo03g00231 . 63 499 EF-hand Containing Proteins AT5G04870 66.1 1.6e-140 496.9
Blo12g00874 . 32 513 EF-hand Containing Proteins AT5G04870 52.4 2.5e-138 489.6
Blo07g01139 CCT 25 495 EF-hand Containing Proteins AT5G04870 52.7 2.2e-134 476.5
Blo08g00105 . 57 520 EF-hand Containing Proteins AT5G04870 52.3 4.8e-134 475.3
Blo10g00833 BCT 64 521 EF-hand Containing Proteins AT5G04870 51.7 1.1e-133 474.2
Blo12g00582 . 55 498 EF-hand Containing Proteins AT5G04870 52.9 4.5e-132 468.8
Blo04g00755 BCT 63 504 EF-hand Containing Proteins AT5G04870 54.2 4.5e-132 468.8
Blo01g01057 CCT 47 495 EF-hand Containing Proteins AT5G04870 51.7 5.7e-127 451.8
Blo11g00138 . 52 495 EF-hand Containing Proteins AT5G04870 51.7 1.7e-126 450.3
Blo12g00256 . 53 495 EF-hand Containing Proteins AT5G04870 50.3 4.8e-126 448.7
Blo12g00391 . 47 508 EF-hand Containing Proteins AT5G04870 50.8 3.1e-125 446.0
Blo06g00303 . 116 467 EF-hand Containing Proteins AT5G04870 50.3 2.3e-99 360.1
Blo09g00114 . 26 303 EF-hand Containing Proteins AT5G04870 51.1 1.9e-77 287.3
Blo04g00322 . 90 287 EF-hand Containing Proteins AT5G04870 54.6 3.2e-53 206.8
Blo04g00371 . 1 575 EF-hand Containing Proteins AT3G10660 68.4 2.0e-215 745.7
Blo07g01294 . 1 596 EF-hand Containing Proteins AT3G10660 59.4 2.3e-206 715.7
Blo09g00457 . 1 616 EF-hand Containing Proteins AT3G10660 57.2 7.8e-199 690.6
Blo09g00453 . 1 630 EF-hand Containing Proteins AT3G10660 55.7 1.5e-186 649.8
Blo15g00417 . 94 563 EF-hand Containing Proteins AT3G10660 68.0 6.6e-174 607.8
Blo01g01253 . 94 581 EF-hand Containing Proteins AT3G10660 62.1 4.3e-173 605.1
Blo02g00160 . 95 567 EF-hand Containing Proteins AT3G10660 72.7 6.2e-172 601.3
Blo12g00800 . 18 470 EF-hand Containing Proteins AT3G10660 73.3 3.4e-170 595.5
Blo16g00559 . 15 517 EF-hand Containing Proteins AT3G10660 61.8 1.7e-169 593.2
Blo13g00467 . 396 914 EF-hand Containing Proteins AT3G10660 60.1 1.4e-163 573.5
Blo08g00131 BCT 35 522 EF-hand Containing Proteins AT3G10660 56.8 4.0e-155 545.4
Blo14g00295 BCT 62 522 EF-hand Containing Proteins AT3G10660 58.8 5.3e-155 545.0
Blo07g00904 BCT 60 517 EF-hand Containing Proteins AT3G10660 55.2 2.6e-146 516.2
Blo02g01128 . 49 501 EF-hand Containing Proteins AT3G10660 64.5 3.3e-141 499.2
Blo12g00874 . 59 513 EF-hand Containing Proteins AT3G10660 55.0 2.8e-140 496.1
Blo13g00983 . 83 563 EF-hand Containing Proteins AT3G10660 51.9 1.1e-139 494.2
Blo03g00231 . 63 422 EF-hand Containing Proteins AT3G10660 65.3 1.5e-138 490.3
Blo07g01139 CCT 25 516 EF-hand Containing Proteins AT3G10660 52.0 1.2e-135 480.7
Blo04g00755 BCT 63 504 EF-hand Containing Proteins AT3G10660 54.6 4.8e-132 468.8
Blo08g00105 . 57 499 EF-hand Containing Proteins AT3G10660 52.8 6.3e-132 468.4
Blo12g00582 . 55 498 EF-hand Containing Proteins AT3G10660 52.9 1.4e-131 467.2
Blo10g00833 BCT 64 521 EF-hand Containing Proteins AT3G10660 50.9 1.4e-131 467.2
Blo11g00138 . 52 495 EF-hand Containing Proteins AT3G10660 51.8 6.1e-127 451.8
Blo01g01057 CCT 47 516 EF-hand Containing Proteins AT3G10660 50.4 6.1e-127 451.8
Blo12g00391 . 27 508 EF-hand Containing Proteins AT3G10660 50.1 2.5e-125 446.4
Blo06g00303 . 116 467 EF-hand Containing Proteins AT3G10660 50.6 4.1e-99 359.4
Blo04g00322 . 90 287 EF-hand Containing Proteins AT3G10660 56.0 3.1e-54 210.3
Blo14g00295 BCT 60 524 EF-hand Containing Proteins AT4G23650 72.3 5.6e-203 704.1
Blo08g00131 BCT 60 524 EF-hand Containing Proteins AT4G23650 72.3 1.8e-201 699.1
Blo07g00904 BCT 53 519 EF-hand Containing Proteins AT4G23650 68.7 1.6e-189 659.4
Blo02g01128 . 40 511 EF-hand Containing Proteins AT4G23650 69.3 7.8e-189 657.1
Blo03g00231 . 61 498 EF-hand Containing Proteins AT4G23650 73.7 1.1e-187 653.3
Blo13g00983 . 75 563 EF-hand Containing Proteins AT4G23650 63.2 7.1e-182 634.0
Blo12g00874 . 61 515 EF-hand Containing Proteins AT4G23650 62.4 4.4e-176 614.8
Blo10g00833 BCT 68 520 EF-hand Containing Proteins AT4G23650 64.0 8.6e-172 600.5
Blo09g00457 . 156 615 EF-hand Containing Proteins AT4G23650 62.3 8.6e-172 600.5
Blo07g01294 . 128 576 EF-hand Containing Proteins AT4G23650 61.6 6.2e-170 594.3
Blo15g00417 . 94 546 EF-hand Containing Proteins AT4G23650 59.5 1.4e-158 556.6
Blo01g01253 . 120 584 EF-hand Containing Proteins AT4G23650 57.9 5.4e-158 554.7
Blo16g00559 . 14 503 EF-hand Containing Proteins AT4G23650 55.0 1.1e-153 540.4
Blo09g00453 . 138 638 EF-hand Containing Proteins AT4G23650 52.4 1.5e-152 536.6
Blo04g00755 BCT 63 503 EF-hand Containing Proteins AT4G23650 57.9 2.9e-151 532.3
Blo08g00105 . 52 498 EF-hand Containing Proteins AT4G23650 56.4 2.9e-151 532.3
Blo13g00467 . 399 905 EF-hand Containing Proteins AT4G23650 53.7 9.3e-150 527.3
Blo04g00371 . 96 552 EF-hand Containing Proteins AT4G23650 56.8 3.5e-149 525.4
Blo12g00582 . 42 497 EF-hand Containing Proteins AT4G23650 57.0 1.0e-148 523.9
Blo07g01139 CCT 41 494 EF-hand Containing Proteins AT4G23650 55.7 8.7e-148 520.8
Blo02g00160 . 95 556 EF-hand Containing Proteins AT4G23650 56.6 3.7e-146 515.4
Blo01g01057 CCT 41 494 EF-hand Containing Proteins AT4G23650 56.0 5.3e-145 511.5
Blo11g00138 . 39 494 EF-hand Containing Proteins AT4G23650 54.8 6.9e-145 511.1
Blo16g00202 BCT 63 560 EF-hand Containing Proteins AT4G23650 51.2 1.7e-143 506.5
Blo12g00391 . 41 507 EF-hand Containing Proteins AT4G23650 54.6 6.5e-143 504.6
Blo12g00800 . 6 478 EF-hand Containing Proteins AT4G23650 53.6 2.7e-141 499.2
Blo12g00256 . 48 495 EF-hand Containing Proteins AT4G23650 51.6 1.9e-134 476.5
Blo06g00303 . 122 495 EF-hand Containing Proteins AT4G23650 50.3 7.7e-104 374.8
Blo09g00114 . 42 303 EF-hand Containing Proteins AT4G23650 50.4 5.8e-75 278.9
Blo04g00322 . 115 287 EF-hand Containing Proteins AT4G23650 52.8 9.3e-49 191.8
Blo12g00800 . 18 494 EF-hand Containing Proteins AT4G09570 82.2 1.3e-201 699.5
Blo16g00559 . 24 528 EF-hand Containing Proteins AT4G09570 69.4 1.3e-190 662.9
Blo15g00417 . 94 564 EF-hand Containing Proteins AT4G09570 65.7 2.6e-162 568.9
Blo02g00160 . 95 573 EF-hand Containing Proteins AT4G09570 69.5 1.7e-161 566.2
Blo07g01294 . 105 598 EF-hand Containing Proteins AT4G09570 57.5 3.2e-160 562.0
Blo09g00457 . 155 631 EF-hand Containing Proteins AT4G09570 60.2 3.2e-160 562.0
Blo04g00371 . 97 578 EF-hand Containing Proteins AT4G09570 66.6 3.0e-158 555.4
Blo13g00467 . 398 915 EF-hand Containing Proteins AT4G09570 58.6 1.8e-155 546.2
Blo09g00453 . 113 631 EF-hand Containing Proteins AT4G09570 52.4 4.5e-146 515.0
Blo01g01253 . 108 601 EF-hand Containing Proteins AT4G09570 53.4 3.2e-144 508.8
Blo14g00295 BCT 52 515 EF-hand Containing Proteins AT4G09570 53.9 7.5e-141 497.7
Blo08g00131 BCT 52 515 EF-hand Containing Proteins AT4G09570 54.7 1.7e-140 496.5
Blo07g00904 BCT 50 516 EF-hand Containing Proteins AT4G09570 52.5 1.2e-135 480.3
Blo02g01128 . 43 501 EF-hand Containing Proteins AT4G09570 63.0 5.2e-134 474.9
Blo12g00874 . 75 513 EF-hand Containing Proteins AT4G09570 52.0 2.5e-128 456.1
Blo03g00231 . 59 418 EF-hand Containing Proteins AT4G09570 62.5 3.3e-128 455.7
Blo04g00755 BCT 58 503 EF-hand Containing Proteins AT4G09570 51.0 6.8e-126 448.0
Blo12g00582 . 55 497 EF-hand Containing Proteins AT4G09570 50.1 2.2e-124 443.0
Blo10g00833 BCT 65 423 EF-hand Containing Proteins AT4G09570 58.2 1.1e-120 430.6
Blo15g00417 . 1 564 EF-hand Containing Proteins AT4G35310 80.4 7.0e-249 856.7
Blo02g00160 . 1 569 EF-hand Containing Proteins AT4G35310 77.3 1.3e-231 799.3
Blo13g00467 . 336 915 EF-hand Containing Proteins AT4G35310 71.0 1.7e-226 782.3
Blo07g01294 . 124 597 EF-hand Containing Proteins AT4G35310 67.0 1.0e-186 650.2
Blo09g00457 . 152 628 EF-hand Containing Proteins AT4G35310 65.4 1.5e-182 636.3
Blo16g00559 . 11 517 EF-hand Containing Proteins AT4G35310 63.5 4.3e-182 634.8
Blo04g00371 . 100 577 EF-hand Containing Proteins AT4G35310 68.4 2.0e-174 609.4
Blo01g01253 . 95 592 EF-hand Containing Proteins AT4G35310 61.0 1.8e-172 602.8
Blo12g00800 . 19 491 EF-hand Containing Proteins AT4G35310 66.4 2.9e-170 595.5
Blo09g00453 . 134 631 EF-hand Containing Proteins AT4G35310 60.8 1.2e-168 590.1
Blo14g00295 BCT 33 515 EF-hand Containing Proteins AT4G35310 59.4 4.8e-165 578.2
Blo08g00131 BCT 62 515 EF-hand Containing Proteins AT4G35310 61.0 5.0e-162 568.2
Blo07g00904 BCT 27 516 EF-hand Containing Proteins AT4G35310 56.9 3.4e-158 555.4
Blo13g00983 . 63 563 EF-hand Containing Proteins AT4G35310 54.0 7.5e-150 527.7
Blo12g00874 . 63 513 EF-hand Containing Proteins AT4G35310 56.4 7.7e-147 517.7
Blo10g00833 BCT 53 520 EF-hand Containing Proteins AT4G35310 53.8 1.8e-143 506.5
Blo02g01128 . 49 511 EF-hand Containing Proteins AT4G35310 59.6 1.1e-140 497.3
Blo03g00231 . 63 499 EF-hand Containing Proteins AT4G35310 62.5 2.4e-140 496.1
Blo12g00582 . 55 497 EF-hand Containing Proteins AT4G35310 54.0 2.8e-136 482.6
Blo04g00755 BCT 59 503 EF-hand Containing Proteins AT4G35310 54.9 1.0e-135 480.7
Blo08g00105 . 46 498 EF-hand Containing Proteins AT4G35310 51.9 4.4e-134 475.3
Blo07g01139 CCT 48 494 EF-hand Containing Proteins AT4G35310 53.0 2.9e-133 472.6
Blo11g00138 . 6 494 EF-hand Containing Proteins AT4G35310 50.2 3.2e-132 469.2
Blo01g01057 CCT 49 494 EF-hand Containing Proteins AT4G35310 52.5 4.3e-129 458.8
Blo12g00391 . 48 507 EF-hand Containing Proteins AT4G35310 51.6 1.4e-127 453.8
Blo15g00417 . 1 565 EF-hand Containing Proteins AT2G17290 78.4 3.0e-236 814.7
Blo02g00160 . 1 569 EF-hand Containing Proteins AT2G17290 80.7 6.7e-228 786.9
Blo13g00467 . 336 916 EF-hand Containing Proteins AT2G17290 68.4 7.9e-213 736.9
Blo07g01294 . 128 597 EF-hand Containing Proteins AT2G17290 62.9 9.8e-171 597.0
Blo12g00800 . 19 491 EF-hand Containing Proteins AT2G17290 70.8 1.1e-169 593.6
Blo04g00371 . 100 577 EF-hand Containing Proteins AT2G17290 70.9 1.9e-169 592.8
Blo09g00457 . 156 617 EF-hand Containing Proteins AT2G17290 63.2 3.5e-168 588.6
Blo16g00559 . 23 517 EF-hand Containing Proteins AT2G17290 61.6 2.3e-167 585.9
Blo01g01253 . 95 592 EF-hand Containing Proteins AT2G17290 56.8 1.2e-155 547.0
Blo09g00453 . 138 631 EF-hand Containing Proteins AT2G17290 56.7 6.0e-152 534.6
Blo14g00295 BCT 62 515 EF-hand Containing Proteins AT2G17290 57.3 3.6e-149 525.4
Blo08g00131 BCT 62 515 EF-hand Containing Proteins AT2G17290 57.5 4.7e-149 525.0
Blo07g00904 BCT 49 516 EF-hand Containing Proteins AT2G17290 55.1 4.2e-145 511.9
Blo02g01128 . 49 501 EF-hand Containing Proteins AT2G17290 65.8 2.1e-141 499.6
Blo13g00983 . 63 563 EF-hand Containing Proteins AT2G17290 51.6 9.9e-139 490.7
Blo03g00231 . 63 418 EF-hand Containing Proteins AT2G17290 65.7 3.8e-138 488.8
Blo12g00874 . 63 513 EF-hand Containing Proteins AT2G17290 54.2 1.6e-136 483.4
Blo10g00833 BCT 53 423 EF-hand Containing Proteins AT2G17290 59.5 5.8e-131 464.9
Blo08g00105 . 57 498 EF-hand Containing Proteins AT2G17290 51.8 2.1e-128 456.4
Blo12g00582 . 36 497 EF-hand Containing Proteins AT2G17290 50.9 6.0e-128 454.9
Blo04g00755 BCT 59 503 EF-hand Containing Proteins AT2G17290 52.9 9.6e-126 447.6
Blo11g00138 . 52 494 EF-hand Containing Proteins AT2G17290 51.1 3.4e-123 439.1
Blo07g01139 CCT 48 494 EF-hand Containing Proteins AT2G17290 50.1 1.9e-121 433.3
Blo04g00322 . 109 287 EF-hand Containing Proteins AT2G17290 52.2 1.5e-46 184.5
Blo08g00105 . 1 531 EF-hand Containing Proteins AT5G12480 66.9 1.4e-191 666.0
Blo12g00582 . 145 527 EF-hand Containing Proteins AT5G12480 78.9 2.8e-176 615.1
Blo11g00138 . 142 514 EF-hand Containing Proteins AT5G12480 77.5 9.7e-169 590.1
Blo04g00755 BCT 153 533 EF-hand Containing Proteins AT5G12480 70.8 2.0e-158 555.8
Blo07g01139 CCT 110 527 EF-hand Containing Proteins AT5G12480 65.4 3.3e-156 548.5
Blo16g00202 BCT 153 590 EF-hand Containing Proteins AT5G12480 62.2 1.3e-152 536.6
Blo01g01057 CCT 143 522 EF-hand Containing Proteins AT5G12480 68.1 8.0e-147 517.3
Blo12g00391 . 143 530 EF-hand Containing Proteins AT5G12480 65.4 1.7e-141 499.6
Blo12g00256 . 146 526 EF-hand Containing Proteins AT5G12480 60.6 2.3e-138 489.2
Blo09g00457 . 261 605 EF-hand Containing Proteins AT5G12480 57.9 5.8e-113 404.8
Blo07g01294 . 233 576 EF-hand Containing Proteins AT5G12480 57.1 6.4e-112 401.4
Blo14g00295 BCT 164 514 EF-hand Containing Proteins AT5G12480 55.8 1.1e-111 400.6
Blo08g00131 BCT 164 514 EF-hand Containing Proteins AT5G12480 55.5 1.2e-110 397.1
Blo07g00904 BCT 166 522 EF-hand Containing Proteins AT5G12480 54.3 1.7e-109 393.3
Blo13g00983 . 187 563 EF-hand Containing Proteins AT5G12480 51.6 1.2e-105 380.6
Blo10g00833 BCT 170 521 EF-hand Containing Proteins AT5G12480 52.3 1.2e-102 370.5
Blo01g01253 . 213 580 EF-hand Containing Proteins AT5G12480 50.3 2.1e-102 369.8
Blo12g00874 . 165 512 EF-hand Containing Proteins AT5G12480 51.3 1.8e-101 366.7
Blo15g00417 . 199 545 EF-hand Containing Proteins AT5G12480 52.6 5.1e-101 365.2
Blo09g00453 . 243 609 EF-hand Containing Proteins AT5G12480 50.1 4.0e-98 355.5
Blo02g00160 . 200 546 EF-hand Containing Proteins AT5G12480 50.9 3.3e-92 335.9
Blo04g00371 . 205 551 EF-hand Containing Proteins AT5G12480 50.1 2.8e-91 332.8
Blo08g00105 . 1 531 EF-hand Containing Proteins AT5G19450 82.5 1.5e-256 882.1
Blo12g00582 . 1 527 EF-hand Containing Proteins AT5G19450 75.9 9.5e-235 809.7
Blo11g00138 . 1 514 EF-hand Containing Proteins AT5G19450 74.8 2.3e-225 778.5
Blo04g00755 BCT 1 533 EF-hand Containing Proteins AT5G19450 65.6 2.2e-199 692.2
Blo07g01139 CCT 1 527 EF-hand Containing Proteins AT5G19450 64.9 6.4e-199 690.6
Blo16g00202 BCT 1 590 EF-hand Containing Proteins AT5G19450 60.4 9.6e-195 676.8
Blo01g01057 CCT 1 522 EF-hand Containing Proteins AT5G19450 64.3 4.6e-189 657.9
Blo12g00391 . 1 530 EF-hand Containing Proteins AT5G19450 63.0 6.2e-186 647.5
Blo12g00256 . 1 526 EF-hand Containing Proteins AT5G19450 59.0 1.7e-183 639.4
Blo09g00457 . 155 605 EF-hand Containing Proteins AT5G19450 57.6 1.4e-150 530.0
Blo14g00295 BCT 1 514 EF-hand Containing Proteins AT5G19450 53.2 1.0e-148 523.9
Blo07g01294 . 119 576 EF-hand Containing Proteins AT5G19450 54.9 1.3e-146 516.9
Blo08g00131 BCT 69 514 EF-hand Containing Proteins AT5G19450 56.5 1.1e-145 513.8
Blo07g00904 BCT 71 522 EF-hand Containing Proteins AT5G19450 54.8 3.4e-144 508.8
Blo13g00983 . 92 563 EF-hand Containing Proteins AT5G19450 52.4 2.8e-138 489.2
Blo01g01253 . 106 580 EF-hand Containing Proteins AT5G19450 51.4 4.8e-138 488.4
Blo12g00874 . 70 512 EF-hand Containing Proteins AT5G19450 52.9 1.4e-137 486.9
Blo10g00833 BCT 75 521 EF-hand Containing Proteins AT5G19450 53.2 3.5e-136 482.3
Blo15g00417 . 105 545 EF-hand Containing Proteins AT5G19450 53.4 1.2e-133 473.8
Blo09g00453 . 129 609 EF-hand Containing Proteins AT5G19450 50.7 6.1e-133 471.5
Blo02g00160 . 106 546 EF-hand Containing Proteins AT5G19450 51.8 4.0e-124 442.2
Blo12g00800 . 31 470 EF-hand Containing Proteins AT5G19450 50.3 5.7e-123 438.3
Blo07g00904 BCT 51 524 EF-hand Containing Proteins AT3G20410 81.5 1.6e-229 792.3
Blo13g00983 . 1 563 EF-hand Containing Proteins AT3G20410 66.4 1.1e-211 733.0
Blo10g00833 BCT 55 527 EF-hand Containing Proteins AT3G20410 75.1 1.8e-209 725.7
Blo12g00874 . 10 518 EF-hand Containing Proteins AT3G20410 65.1 3.3e-195 678.3
Blo08g00131 BCT 24 517 EF-hand Containing Proteins AT3G20410 65.8 5.3e-193 671.0
Blo14g00295 BCT 1 517 EF-hand Containing Proteins AT3G20410 62.2 2.6e-192 668.7
Blo09g00457 . 155 616 EF-hand Containing Proteins AT3G20410 60.5 8.6e-167 583.9
Blo07g01294 . 127 576 EF-hand Containing Proteins AT3G20410 59.9 4.4e-163 571.6
Blo03g00231 . 63 499 EF-hand Containing Proteins AT3G20410 61.6 1.2e-155 547.0
Blo02g01128 . 38 504 EF-hand Containing Proteins AT3G20410 58.5 7.5e-155 544.3
Blo15g00417 . 94 546 EF-hand Containing Proteins AT3G20410 57.5 3.2e-153 538.9
Blo16g00559 . 8 503 EF-hand Containing Proteins AT3G20410 54.1 5.4e-153 538.1
Blo01g01253 . 108 589 EF-hand Containing Proteins AT3G20410 54.5 6.0e-152 534.6
Blo08g00105 . 52 508 EF-hand Containing Proteins AT3G20410 55.4 3.9e-151 531.9
Blo04g00755 BCT 63 513 EF-hand Containing Proteins AT3G20410 56.0 7.3e-150 527.7
Blo04g00371 . 46 552 EF-hand Containing Proteins AT3G20410 52.5 8.1e-149 524.2
Blo16g00202 BCT 63 570 EF-hand Containing Proteins AT3G20410 50.8 2.9e-146 515.8
Blo12g00582 . 50 507 EF-hand Containing Proteins AT3G20410 54.1 1.1e-145 513.8
Blo12g00800 . 30 471 EF-hand Containing Proteins AT3G20410 56.2 3.9e-143 505.4
Blo07g01139 CCT 47 504 EF-hand Containing Proteins AT3G20410 53.5 1.9e-142 503.1
Blo12g00256 . 48 505 EF-hand Containing Proteins AT3G20410 53.1 2.5e-142 502.7
Blo11g00138 . 47 504 EF-hand Containing Proteins AT3G20410 52.8 2.1e-141 499.6
Blo02g00160 . 95 547 EF-hand Containing Proteins AT3G20410 54.6 8.1e-141 497.7
Blo01g01057 CCT 53 504 EF-hand Containing Proteins AT3G20410 53.5 2.9e-138 489.2
Blo12g00391 . 47 517 EF-hand Containing Proteins AT3G20410 51.5 1.9e-137 486.5
Blo04g00755 BCT 1 544 EF-hand Containing Proteins AT1G18890 80.9 2.5e-259 891.3
Blo16g00202 BCT 1 601 EF-hand Containing Proteins AT1G18890 73.5 8.4e-255 876.3
Blo08g00105 . 1 530 EF-hand Containing Proteins AT1G18890 66.5 1.5e-206 716.1
Blo07g01139 CCT 36 524 EF-hand Containing Proteins AT1G18890 71.0 4.0e-204 708.0
Blo12g00582 . 1 528 EF-hand Containing Proteins AT1G18890 65.5 2.8e-202 701.8
Blo01g01057 CCT 37 526 EF-hand Containing Proteins AT1G18890 69.2 5.0e-199 691.0
Blo12g00391 . 36 530 EF-hand Containing Proteins AT1G18890 68.2 2.4e-193 672.2
Blo11g00138 . 1 514 EF-hand Containing Proteins AT1G18890 64.1 2.7e-192 668.7
Blo12g00256 . 34 527 EF-hand Containing Proteins AT1G18890 59.6 2.3e-175 612.5
Blo14g00295 BCT 35 514 EF-hand Containing Proteins AT1G18890 57.1 2.2e-154 542.7
Blo09g00457 . 168 631 EF-hand Containing Proteins AT1G18890 58.8 1.1e-153 540.4
Blo08g00131 BCT 31 514 EF-hand Containing Proteins AT1G18890 55.6 1.0e-151 533.9
Blo07g01294 . 136 576 EF-hand Containing Proteins AT1G18890 58.9 7.3e-150 527.7
Blo07g00904 BCT 76 522 EF-hand Containing Proteins AT1G18890 57.1 2.4e-148 522.7
Blo13g00983 . 93 563 EF-hand Containing Proteins AT1G18890 54.1 5.6e-142 501.5
Blo01g01253 . 103 580 EF-hand Containing Proteins AT1G18890 52.4 8.1e-141 497.7
Blo16g00559 . 24 502 EF-hand Containing Proteins AT1G18890 52.5 1.7e-138 490.0
Blo09g00453 . 146 637 EF-hand Containing Proteins AT1G18890 51.6 2.4e-137 486.1
Blo12g00874 . 71 512 EF-hand Containing Proteins AT1G18890 51.8 3.2e-137 485.7
Blo15g00417 . 102 545 EF-hand Containing Proteins AT1G18890 55.2 5.1e-135 478.4
Blo10g00833 BCT 79 521 EF-hand Containing Proteins AT1G18890 52.7 1.9e-134 476.5
Blo04g00371 . 112 551 EF-hand Containing Proteins AT1G18890 53.8 1.9e-129 459.9
Blo02g00160 . 103 546 EF-hand Containing Proteins AT1G18890 53.8 3.0e-127 452.6
Blo12g00800 . 26 470 EF-hand Containing Proteins AT1G18890 50.8 7.4e-126 448.0
Blo02g01128 . 55 501 EF-hand Containing Proteins AT1G18890 50.2 3.7e-125 445.7
Blo12g00800 . 8 494 EF-hand Containing Proteins AT1G35670 81.1 2.6e-202 701.8
Blo16g00559 . 24 530 EF-hand Containing Proteins AT1G35670 68.8 5.0e-190 661.0
Blo15g00417 . 94 564 EF-hand Containing Proteins AT1G35670 65.0 9.9e-162 567.0
Blo09g00457 . 155 623 EF-hand Containing Proteins AT1G35670 61.1 2.9e-161 565.5
Blo02g00160 . 95 569 EF-hand Containing Proteins AT1G35670 69.5 1.1e-160 563.5
Blo07g01294 . 107 598 EF-hand Containing Proteins AT1G35670 57.1 9.3e-160 560.5
Blo04g00371 . 97 577 EF-hand Containing Proteins AT1G35670 66.9 1.2e-159 560.1
Blo13g00467 . 398 915 EF-hand Containing Proteins AT1G35670 58.2 5.3e-155 544.7
Blo09g00453 . 137 631 EF-hand Containing Proteins AT1G35670 53.9 2.0e-146 516.2
Blo01g01253 . 108 595 EF-hand Containing Proteins AT1G35670 53.8 1.3e-145 513.5
Blo08g00131 BCT 51 515 EF-hand Containing Proteins AT1G35670 54.8 8.7e-142 500.7
Blo14g00295 BCT 51 515 EF-hand Containing Proteins AT1G35670 53.5 5.7e-141 498.0
Blo07g00904 BCT 50 516 EF-hand Containing Proteins AT1G35670 52.7 5.0e-137 485.0
Blo02g01128 . 43 501 EF-hand Containing Proteins AT1G35670 63.6 1.9e-136 483.0
Blo03g00231 . 59 418 EF-hand Containing Proteins AT1G35670 62.5 7.7e-130 461.1
Blo04g00755 BCT 58 525 EF-hand Containing Proteins AT1G35670 50.3 2.2e-129 459.5
Blo12g00874 . 75 513 EF-hand Containing Proteins AT1G35670 52.0 2.5e-128 456.1
Blo10g00833 BCT 65 423 EF-hand Containing Proteins AT1G35670 57.9 4.5e-122 435.3
Blo16g00559 . 16 521 EF-hand Containing Proteins AT5G23580 71.5 1.4e-205 712.6
Blo12g00800 . 19 486 EF-hand Containing Proteins AT5G23580 69.6 1.8e-179 625.9
Blo09g00457 . 156 630 EF-hand Containing Proteins AT5G23580 64.0 3.3e-173 605.1
Blo07g01294 . 128 593 EF-hand Containing Proteins AT5G23580 62.8 2.1e-172 602.4
Blo15g00417 . 93 560 EF-hand Containing Proteins AT5G23580 66.9 4.7e-172 601.3
Blo13g00467 . 395 911 EF-hand Containing Proteins AT5G23580 61.9 7.8e-167 583.9
Blo01g01253 . 108 596 EF-hand Containing Proteins AT5G23580 58.8 8.0e-164 573.9
Blo08g00131 BCT 62 515 EF-hand Containing Proteins AT5G23580 60.4 7.0e-160 560.8
Blo14g00295 BCT 62 515 EF-hand Containing Proteins AT5G23580 59.5 3.0e-158 555.4
Blo04g00371 . 96 572 EF-hand Containing Proteins AT5G23580 61.8 1.5e-157 553.1
Blo02g00160 . 94 564 EF-hand Containing Proteins AT5G23580 62.8 2.1e-156 549.3
Blo09g00453 . 138 637 EF-hand Containing Proteins AT5G23580 56.4 2.1e-156 549.3
Blo07g00904 BCT 60 516 EF-hand Containing Proteins AT5G23580 56.7 2.1e-148 522.7
Blo13g00983 . 92 563 EF-hand Containing Proteins AT5G23580 54.7 1.1e-144 510.4
Blo04g00755 BCT 59 503 EF-hand Containing Proteins AT5G23580 56.1 3.5e-143 505.4
Blo12g00874 . 75 513 EF-hand Containing Proteins AT5G23580 56.3 6.6e-142 501.1
Blo07g01139 CCT 47 494 EF-hand Containing Proteins AT5G23580 55.1 6.2e-140 494.6
Blo08g00105 . 57 498 EF-hand Containing Proteins AT5G23580 52.7 9.2e-136 480.7
Blo12g00582 . 49 497 EF-hand Containing Proteins AT5G23580 52.3 2.7e-135 479.2
Blo01g01057 CCT 47 494 EF-hand Containing Proteins AT5G23580 53.8 2.3e-134 476.1
Blo10g00833 BCT 64 520 EF-hand Containing Proteins AT5G23580 52.1 2.5e-133 472.6
Blo02g01128 . 49 501 EF-hand Containing Proteins AT5G23580 56.1 5.6e-133 471.5
Blo12g00391 . 47 507 EF-hand Containing Proteins AT5G23580 52.4 1.3e-132 470.3
Blo03g00231 . 63 512 EF-hand Containing Proteins AT5G23580 55.8 5.3e-131 464.9
Blo11g00138 . 46 494 EF-hand Containing Proteins AT5G23580 50.8 3.2e-128 455.7
Blo09g00114 . 37 306 EF-hand Containing Proteins AT5G23580 50.4 4.5e-74 275.8
Blo04g00322 . 109 287 EF-hand Containing Proteins AT5G23580 53.3 8.0e-47 185.3
Blo07g01139 CCT 1 412 EF-hand Containing Proteins AT3G51850 85.0 1.1e-206 716.1
Blo01g01057 CCT 1 409 EF-hand Containing Proteins AT3G51850 82.2 8.0e-197 683.3
Blo12g00391 . 1 422 EF-hand Containing Proteins AT3G51850 80.9 1.4e-196 682.6
Blo04g00755 BCT 1 411 EF-hand Containing Proteins AT3G51850 70.0 3.4e-163 571.6
Blo12g00582 . 1 403 EF-hand Containing Proteins AT3G51850 67.9 6.4e-162 567.4
Blo11g00138 . 1 400 EF-hand Containing Proteins AT3G51850 68.2 1.1e-158 556.6
Blo08g00105 . 1 416 EF-hand Containing Proteins AT3G51850 65.8 1.1e-158 556.6
Blo16g00202 BCT 1 470 EF-hand Containing Proteins AT3G51850 60.7 4.9e-154 541.2
Blo12g00256 . 1 404 EF-hand Containing Proteins AT3G51850 57.1 1.9e-137 486.1
Blo14g00295 BCT 1 422 EF-hand Containing Proteins AT3G51850 56.9 5.8e-131 464.5
Blo08g00131 BCT 55 433 EF-hand Containing Proteins AT3G51850 59.6 1.3e-127 453.4
Blo09g00457 . 148 527 EF-hand Containing Proteins AT3G51850 58.7 1.1e-126 450.3
Blo04g00371 . 67 460 EF-hand Containing Proteins AT3G51850 54.2 9.0e-124 440.7
Blo01g01253 . 93 469 EF-hand Containing Proteins AT3G51850 56.0 6.5e-122 434.5
Blo07g01294 . 84 499 EF-hand Containing Proteins AT3G51850 51.9 1.1e-121 433.7
Blo07g00904 BCT 68 436 EF-hand Containing Proteins AT3G51850 56.9 1.2e-120 430.3
Blo02g00160 . 102 453 EF-hand Containing Proteins AT3G51850 59.7 3.3e-118 422.2
Blo16g00559 . 30 382 EF-hand Containing Proteins AT3G51850 57.5 9.6e-118 420.6
Blo03g00231 . 57 422 EF-hand Containing Proteins AT3G51850 56.3 3.7e-117 418.7
Blo15g00417 . 101 451 EF-hand Containing Proteins AT3G51850 59.0 8.2e-117 417.5
Blo12g00800 . 27 379 EF-hand Containing Proteins AT3G51850 56.1 8.2e-117 417.5
Blo02g01128 . 45 406 EF-hand Containing Proteins AT3G51850 55.2 4.5e-115 411.8
Blo13g00983 . 78 474 EF-hand Containing Proteins AT3G51850 51.6 1.1e-113 407.1
Blo12g00874 . 67 426 EF-hand Containing Proteins AT3G51850 52.2 1.3e-111 400.2
Blo13g00467 . 406 799 EF-hand Containing Proteins AT3G51850 51.5 3.7e-109 392.1
Blo12g00582 . 1 528 EF-hand Containing Proteins AT2G41860 75.8 4.2e-235 810.8
Blo11g00138 . 1 509 EF-hand Containing Proteins AT2G41860 74.7 3.0e-225 778.1
Blo08g00105 . 1 526 EF-hand Containing Proteins AT2G41860 72.1 4.0e-225 777.7
Blo04g00755 BCT 1 531 EF-hand Containing Proteins AT2G41860 64.3 2.9e-199 691.8
Blo16g00202 BCT 1 588 EF-hand Containing Proteins AT2G41860 58.5 1.8e-193 672.5
Blo07g01139 CCT 1 522 EF-hand Containing Proteins AT2G41860 61.9 3.5e-189 658.3
Blo01g01057 CCT 1 522 EF-hand Containing Proteins AT2G41860 60.8 2.6e-184 642.1
Blo12g00256 . 1 522 EF-hand Containing Proteins AT2G41860 58.2 6.4e-183 637.5
Blo12g00391 . 1 530 EF-hand Containing Proteins AT2G41860 59.7 2.1e-178 622.5
Blo14g00295 BCT 1 527 EF-hand Containing Proteins AT2G41860 50.8 5.3e-145 511.5
Blo09g00457 . 156 605 EF-hand Containing Proteins AT2G41860 55.2 1.3e-143 506.9
Blo08g00131 BCT 62 527 EF-hand Containing Proteins AT2G41860 54.9 8.4e-143 504.2
Blo07g00904 BCT 49 522 EF-hand Containing Proteins AT2G41860 52.9 1.1e-142 503.8
Blo07g01294 . 122 576 EF-hand Containing Proteins AT2G41860 53.4 6.1e-141 498.0
Blo01g01253 . 106 580 EF-hand Containing Proteins AT2G41860 51.0 3.4e-136 482.3
Blo13g00983 . 85 563 EF-hand Containing Proteins AT2G41860 51.9 5.9e-136 481.5
Blo10g00833 BCT 40 521 EF-hand Containing Proteins AT2G41860 50.1 3.2e-134 475.7
Blo12g00874 . 70 512 EF-hand Containing Proteins AT2G41860 51.7 7.9e-133 471.1
Blo16g00559 . 31 502 EF-hand Containing Proteins AT2G41860 51.3 1.4e-132 470.3
Blo15g00417 . 88 545 EF-hand Containing Proteins AT2G41860 52.1 1.5e-131 466.8
Blo02g00160 . 89 546 EF-hand Containing Proteins AT2G41860 50.1 6.3e-122 434.9
Blo03g00231 . 63 498 EF-hand Containing Proteins AT2G41860 51.1 4.7e-117 418.7
Blo07g00904 BCT 52 467 EF-hand Containing Proteins AT4G21940 76.4 8.6e-190 660.2
Blo13g00983 . 3 514 EF-hand Containing Proteins AT4G21940 65.5 2.8e-188 655.2
Blo10g00833 BCT 55 471 EF-hand Containing Proteins AT4G21940 72.4 8.9e-179 623.6
Blo12g00874 . 62 463 EF-hand Containing Proteins AT4G21940 70.4 4.4e-170 594.7
Blo08g00131 BCT 43 465 EF-hand Containing Proteins AT4G21940 66.7 1.7e-169 592.8
Blo14g00295 BCT 51 465 EF-hand Containing Proteins AT4G21940 66.5 1.6e-167 586.3
Blo07g01294 . 124 531 EF-hand Containing Proteins AT4G21940 59.6 5.6e-149 524.6
Blo09g00457 . 152 559 EF-hand Containing Proteins AT4G21940 60.3 7.3e-149 524.2
Blo03g00231 . 63 422 EF-hand Containing Proteins AT4G21940 66.4 1.3e-140 496.9
Blo16g00559 . 24 427 EF-hand Containing Proteins AT4G21940 59.2 1.5e-138 490.0
Blo01g01253 . 94 532 EF-hand Containing Proteins AT4G21940 54.4 2.0e-138 489.6
Blo09g00453 . 134 599 EF-hand Containing Proteins AT4G21940 51.3 2.6e-138 489.2
Blo15g00417 . 94 497 EF-hand Containing Proteins AT4G21940 57.7 1.1e-136 483.8
Blo04g00755 BCT 50 453 EF-hand Containing Proteins AT4G21940 57.0 1.9e-136 483.0
Blo02g01128 . 49 406 EF-hand Containing Proteins AT4G21940 64.2 2.4e-136 482.6
Blo08g00105 . 52 448 EF-hand Containing Proteins AT4G21940 56.2 4.3e-133 471.9
Blo12g00800 . 18 379 EF-hand Containing Proteins AT4G21940 62.4 6.2e-132 468.0
Blo16g00202 BCT 63 510 EF-hand Containing Proteins AT4G21940 51.3 3.1e-131 465.7
Blo04g00371 . 97 461 EF-hand Containing Proteins AT4G21940 59.2 9.0e-131 464.2
Blo07g01139 CCT 41 444 EF-hand Containing Proteins AT4G21940 54.0 2.0e-130 463.0
Blo13g00467 . 395 848 EF-hand Containing Proteins AT4G21940 51.3 6.4e-129 458.0
Blo02g00160 . 95 453 EF-hand Containing Proteins AT4G21940 61.3 1.4e-128 456.8
Blo12g00256 . 48 444 EF-hand Containing Proteins AT4G21940 53.4 2.3e-126 449.5
Blo12g00582 . 42 447 EF-hand Containing Proteins AT4G21940 52.7 3.9e-126 448.7
Blo12g00391 . 39 457 EF-hand Containing Proteins AT4G21940 52.4 3.3e-125 445.7
Blo01g01057 CCT 39 444 EF-hand Containing Proteins AT4G21940 53.4 3.3e-125 445.7
Blo11g00138 . 39 444 EF-hand Containing Proteins AT4G21940 53.0 5.6e-125 444.9
Blo16g00080 . 62 539 EF-hand Containing Proteins AT2G17890 86.2 4.4e-238 820.8
Blo06g00303 . 90 514 EF-hand Containing Proteins AT2G17890 69.5 9.6e-185 643.7
Blo09g00365 BCT 87 539 EF-hand Containing Proteins AT2G17890 51.2 2.0e-121 433.3
Blo03g00231 . 70 422 EF-hand Containing Proteins AT2G17890 50.3 4.0e-98 355.9
Blo14g00295 BCT 1 526 EF-hand Containing Proteins AT5G12180 82.4 8.4e-252 866.3
Blo08g00131 BCT 1 526 EF-hand Containing Proteins AT5G12180 82.1 9.3e-251 862.8
Blo07g00904 BCT 64 516 EF-hand Containing Proteins AT5G12180 72.0 1.2e-197 686.4
Blo13g00983 . 85 563 EF-hand Containing Proteins AT5G12180 65.1 2.3e-185 645.6
Blo07g01294 . 128 576 EF-hand Containing Proteins AT5G12180 64.9 1.9e-179 625.9
Blo10g00833 BCT 68 520 EF-hand Containing Proteins AT5G12180 65.8 1.9e-179 625.9
Blo12g00874 . 60 516 EF-hand Containing Proteins AT5G12180 63.5 7.3e-179 624.0
Blo09g00457 . 156 621 EF-hand Containing Proteins AT5G12180 63.2 2.1e-178 622.5
Blo01g01253 . 108 581 EF-hand Containing Proteins AT5G12180 61.5 1.5e-171 599.7
Blo03g00231 . 42 512 EF-hand Containing Proteins AT5G12180 63.5 1.4e-169 593.2
Blo02g01128 . 37 512 EF-hand Containing Proteins AT5G12180 60.7 4.0e-169 591.7
Blo15g00417 . 94 546 EF-hand Containing Proteins AT5G12180 60.8 1.3e-164 576.6
Blo07g01139 CCT 32 494 EF-hand Containing Proteins AT5G12180 60.3 1.9e-163 572.8
Blo09g00453 . 138 637 EF-hand Containing Proteins AT5G12180 55.5 1.9e-163 572.8
Blo16g00559 . 24 503 EF-hand Containing Proteins AT5G12180 58.6 1.2e-162 570.1
Blo08g00105 . 52 498 EF-hand Containing Proteins AT5G12180 59.5 1.1e-158 557.0
Blo04g00755 BCT 50 503 EF-hand Containing Proteins AT5G12180 59.6 9.3e-158 553.9
Blo01g01057 CCT 41 494 EF-hand Containing Proteins AT5G12180 59.5 4.3e-155 545.0
Blo13g00467 . 399 897 EF-hand Containing Proteins AT5G12180 54.8 1.6e-154 543.1
Blo12g00582 . 42 497 EF-hand Containing Proteins AT5G12180 58.2 2.1e-154 542.7
Blo12g00391 . 32 507 EF-hand Containing Proteins AT5G12180 57.2 1.4e-153 540.0
Blo04g00371 . 98 552 EF-hand Containing Proteins AT5G12180 58.1 5.3e-153 538.1
Blo11g00138 . 39 494 EF-hand Containing Proteins AT5G12180 56.8 1.9e-150 529.6
Blo02g00160 . 95 547 EF-hand Containing Proteins AT5G12180 57.5 7.1e-150 527.7
Blo16g00202 BCT 63 560 EF-hand Containing Proteins AT5G12180 53.6 7.1e-150 527.7
Blo12g00800 . 31 471 EF-hand Containing Proteins AT5G12180 57.0 7.4e-147 517.7
Blo12g00256 . 48 495 EF-hand Containing Proteins AT5G12180 55.1 8.1e-146 514.2
Blo09g00114 . 37 303 EF-hand Containing Proteins AT5G12180 50.9 3.8e-79 292.7
Blo07g00432 . 35 309 EF-hand Containing Proteins AT5G12180 50.9 5.0e-79 292.4
Blo04g00322 . 125 287 EF-hand Containing Proteins AT5G12180 56.5 4.2e-49 193.0
Blo16g00080 . 36 539 EF-hand Containing Proteins AT4G36070 76.5 7.1e-225 776.9
Blo06g00303 . 78 518 EF-hand Containing Proteins AT4G36070 64.8 8.3e-181 630.6
Blo07g00904 BCT 62 522 EF-hand Containing Proteins AT1G61950 74.2 4.7e-205 711.1
Blo13g00983 . 65 562 EF-hand Containing Proteins AT1G61950 68.3 8.1e-197 683.7
Blo10g00833 BCT 66 522 EF-hand Containing Proteins AT1G61950 68.8 9.9e-187 650.2
Blo12g00874 . 63 511 EF-hand Containing Proteins AT1G61950 66.4 2.1e-181 632.5
Blo14g00295 BCT 61 512 EF-hand Containing Proteins AT1G61950 66.2 4.5e-179 624.8
Blo08g00131 BCT 61 512 EF-hand Containing Proteins AT1G61950 65.6 2.9e-178 622.1
Blo07g01294 . 124 576 EF-hand Containing Proteins AT1G61950 58.9 6.7e-159 557.8
Blo09g00457 . 152 605 EF-hand Containing Proteins AT1G61950 59.4 5.7e-158 554.7
Blo03g00231 . 63 498 EF-hand Containing Proteins AT1G61950 59.0 2.6e-147 519.2
Blo04g00755 BCT 41 502 EF-hand Containing Proteins AT1G61950 55.8 7.7e-147 517.7
Blo01g01253 . 82 578 EF-hand Containing Proteins AT1G61950 51.9 1.7e-146 516.5
Blo09g00453 . 134 638 EF-hand Containing Proteins AT1G61950 51.7 3.8e-146 515.4
Blo15g00417 . 94 543 EF-hand Containing Proteins AT1G61950 56.9 5.0e-146 515.0
Blo16g00559 . 16 500 EF-hand Containing Proteins AT1G61950 53.0 1.9e-145 513.1
Blo02g01128 . 49 499 EF-hand Containing Proteins AT1G61950 55.3 3.9e-143 505.4
Blo13g00467 . 395 894 EF-hand Containing Proteins AT1G61950 52.0 9.7e-142 500.7
Blo16g00202 BCT 59 559 EF-hand Containing Proteins AT1G61950 50.4 2.4e-140 496.1
Blo08g00105 . 52 497 EF-hand Containing Proteins AT1G61950 52.8 4.1e-140 495.4
Blo07g01139 CCT 41 493 EF-hand Containing Proteins AT1G61950 52.6 4.7e-136 481.9
Blo04g00371 . 107 549 EF-hand Containing Proteins AT1G61950 53.0 2.3e-135 479.6
Blo12g00582 . 42 496 EF-hand Containing Proteins AT1G61950 51.3 6.7e-135 478.0
Blo11g00138 . 39 493 EF-hand Containing Proteins AT1G61950 51.5 2.0e-134 476.5
Blo02g00160 . 95 544 EF-hand Containing Proteins AT1G61950 53.8 2.0e-134 476.5
Blo12g00256 . 48 492 EF-hand Containing Proteins AT1G61950 51.8 3.3e-134 475.7
Blo12g00800 . 27 468 EF-hand Containing Proteins AT1G61950 51.8 7.0e-132 468.0
Blo01g01057 CCT 37 493 EF-hand Containing Proteins AT1G61950 51.0 7.2e-129 458.0
Blo12g00391 . 37 506 EF-hand Containing Proteins AT1G61950 50.1 1.6e-128 456.8
Blo07g01294 . 1 587 EF-hand Containing Proteins AT2G38910 74.8 9.9e-254 872.8
Blo09g00453 . 1 631 EF-hand Containing Proteins AT2G38910 67.5 2.8e-232 801.6
Blo09g00457 . 138 605 EF-hand Containing Proteins AT2G38910 74.4 3.0e-210 728.4
Blo04g00371 . 1 569 EF-hand Containing Proteins AT2G38910 63.2 6.1e-203 704.1
Blo01g01253 . 104 583 EF-hand Containing Proteins AT2G38910 65.8 1.8e-186 649.4
Blo15g00417 . 78 557 EF-hand Containing Proteins AT2G38910 65.4 2.7e-182 635.6
Blo16g00559 . 24 507 EF-hand Containing Proteins AT2G38910 64.1 1.0e-181 633.6
Blo13g00467 . 395 908 EF-hand Containing Proteins AT2G38910 59.7 5.1e-173 604.7
Blo08g00131 BCT 54 512 EF-hand Containing Proteins AT2G38910 62.1 6.2e-171 597.8
Blo14g00295 BCT 59 512 EF-hand Containing Proteins AT2G38910 61.5 1.4e-170 596.7
Blo02g00160 . 79 554 EF-hand Containing Proteins AT2G38910 62.3 4.1e-167 585.1
Blo12g00800 . 18 475 EF-hand Containing Proteins AT2G38910 62.7 2.7e-166 582.4
Blo07g00904 BCT 62 514 EF-hand Containing Proteins AT2G38910 61.1 2.3e-165 579.3
Blo13g00983 . 81 561 EF-hand Containing Proteins AT2G38910 57.0 1.7e-160 563.1
Blo12g00874 . 59 510 EF-hand Containing Proteins AT2G38910 57.4 6.6e-157 551.2
Blo10g00833 BCT 66 500 EF-hand Containing Proteins AT2G38910 57.7 1.0e-149 527.3
Blo07g01139 CCT 25 492 EF-hand Containing Proteins AT2G38910 53.8 2.4e-143 506.1
Blo08g00105 . 57 496 EF-hand Containing Proteins AT2G38910 54.3 4.6e-142 501.9
Blo04g00755 BCT 61 501 EF-hand Containing Proteins AT2G38910 55.0 7.9e-142 501.1
Blo03g00231 . 60 499 EF-hand Containing Proteins AT2G38910 56.1 1.5e-140 496.9
Blo12g00582 . 55 495 EF-hand Containing Proteins AT2G38910 54.0 2.5e-140 496.1
Blo11g00138 . 52 492 EF-hand Containing Proteins AT2G38910 53.2 5.3e-138 488.4
Blo02g01128 . 46 502 EF-hand Containing Proteins AT2G38910 52.5 2.6e-137 486.1
Blo01g01057 CCT 43 492 EF-hand Containing Proteins AT2G38910 52.2 6.4e-136 481.5
Blo12g00391 . 43 505 EF-hand Containing Proteins AT2G38910 51.1 4.6e-134 475.3
Blo12g00256 . 53 492 EF-hand Containing Proteins AT2G38910 50.9 3.9e-133 472.2
Blo04g00322 . 90 287 EF-hand Containing Proteins AT2G38910 50.2 1.1e-47 188.3
Blo07g00904 BCT 51 519 EF-hand Containing Proteins AT4G04720 79.5 3.5e-221 764.6
Blo13g00983 . 80 570 EF-hand Containing Proteins AT4G04720 77.8 1.2e-218 756.1
Blo10g00833 BCT 8 526 EF-hand Containing Proteins AT4G04720 67.9 1.5e-203 706.1
Blo08g00131 BCT 38 521 EF-hand Containing Proteins AT4G04720 67.8 1.6e-194 676.0
Blo12g00874 . 25 524 EF-hand Containing Proteins AT4G04720 67.5 5.8e-192 667.5
Blo14g00295 BCT 42 521 EF-hand Containing Proteins AT4G04720 67.1 2.2e-191 665.6
Blo07g01294 . 44 576 EF-hand Containing Proteins AT4G04720 55.2 2.6e-168 589.0
Blo09g00457 . 154 610 EF-hand Containing Proteins AT4G04720 61.6 4.9e-167 584.7
Blo16g00559 . 7 503 EF-hand Containing Proteins AT4G04720 56.8 7.4e-155 544.3
Blo03g00231 . 40 499 EF-hand Containing Proteins AT4G04720 60.4 8.2e-154 540.8
Blo15g00417 . 94 546 EF-hand Containing Proteins AT4G04720 59.7 4.0e-153 538.5
Blo01g01253 . 90 581 EF-hand Containing Proteins AT4G04720 54.6 7.6e-152 534.3
Blo09g00453 . 136 631 EF-hand Containing Proteins AT4G04720 54.3 1.0e-151 533.9
Blo04g00755 BCT 34 504 EF-hand Containing Proteins AT4G04720 55.1 1.0e-148 523.9
Blo02g01128 . 49 504 EF-hand Containing Proteins AT4G04720 57.5 2.3e-148 522.7
Blo13g00467 . 367 897 EF-hand Containing Proteins AT4G04720 52.0 6.3e-146 514.6
Blo08g00105 . 52 499 EF-hand Containing Proteins AT4G04720 55.4 8.2e-146 514.2
Blo04g00371 . 99 552 EF-hand Containing Proteins AT4G04720 56.9 2.4e-145 512.7
Blo12g00800 . 18 470 EF-hand Containing Proteins AT4G04720 57.0 3.4e-144 508.8
Blo07g01139 CCT 37 495 EF-hand Containing Proteins AT4G04720 54.5 5.9e-144 508.1
Blo16g00202 BCT 63 561 EF-hand Containing Proteins AT4G04720 50.9 1.9e-142 503.1
Blo02g00160 . 95 547 EF-hand Containing Proteins AT4G04720 56.8 5.1e-140 495.0
Blo12g00582 . 42 498 EF-hand Containing Proteins AT4G04720 52.7 2.5e-139 492.7
Blo01g01057 CCT 41 495 EF-hand Containing Proteins AT4G04720 53.4 6.9e-137 484.6
Blo11g00138 . 39 495 EF-hand Containing Proteins AT4G04720 52.7 1.5e-136 483.4
Blo12g00391 . 41 508 EF-hand Containing Proteins AT4G04720 52.0 1.0e-135 480.7
Blo12g00256 . 48 495 EF-hand Containing Proteins AT4G04720 51.8 3.6e-133 472.2
Blo07g00904 BCT 60 519 EF-hand Containing Proteins AT4G04710 66.6 2.9e-177 618.6
Blo13g00983 . 78 570 EF-hand Containing Proteins AT4G04710 62.6 1.2e-170 596.7
Blo10g00833 BCT 64 526 EF-hand Containing Proteins AT4G04710 63.7 1.9e-165 579.3
Blo14g00295 BCT 62 521 EF-hand Containing Proteins AT4G04710 58.1 2.9e-153 538.9
Blo08g00131 BCT 62 521 EF-hand Containing Proteins AT4G04710 58.4 1.1e-152 537.0
Blo12g00874 . 62 520 EF-hand Containing Proteins AT4G04710 57.3 2.0e-149 526.2
Blo07g01294 . 124 592 EF-hand Containing Proteins AT4G04710 54.2 2.7e-143 505.8
Blo09g00457 . 154 605 EF-hand Containing Proteins AT4G04710 56.4 4.4e-141 498.4
Blo01g01253 . 108 580 EF-hand Containing Proteins AT4G04710 51.8 8.0e-135 477.6
Blo16g00559 . 9 502 EF-hand Containing Proteins AT4G04710 50.6 5.9e-130 461.5
Blo15g00417 . 88 545 EF-hand Containing Proteins AT4G04710 52.5 5.5e-128 454.9
Blo12g00800 . 6 470 EF-hand Containing Proteins AT4G04710 50.7 1.7e-121 433.3
Blo03g00231 . 63 496 EF-hand Containing Proteins AT4G04710 52.3 1.9e-120 429.9
Blo07g00904 BCT 49 519 EF-hand Containing Proteins AT4G04740 70.9 2.1e-199 692.2
Blo13g00983 . 48 563 EF-hand Containing Proteins AT4G04740 65.1 4.2e-195 677.9
Blo10g00833 BCT 8 528 EF-hand Containing Proteins AT4G04740 62.6 6.1e-186 647.5
Blo08g00131 BCT 22 522 EF-hand Containing Proteins AT4G04740 58.5 2.8e-175 612.1
Blo12g00874 . 62 516 EF-hand Containing Proteins AT4G04740 63.3 2.9e-172 602.1
Blo14g00295 BCT 24 522 EF-hand Containing Proteins AT4G04740 58.9 8.5e-172 600.5
Blo07g01294 . 79 587 EF-hand Containing Proteins AT4G04740 53.5 1.2e-154 543.5
Blo09g00457 . 154 605 EF-hand Containing Proteins AT4G04740 57.0 2.2e-151 532.7
Blo08g00105 . 52 508 EF-hand Containing Proteins AT4G04740 53.8 1.0e-145 513.8
Blo07g01139 CCT 37 503 EF-hand Containing Proteins AT4G04740 53.7 1.8e-145 513.1
Blo04g00755 BCT 28 513 EF-hand Containing Proteins AT4G04740 52.9 1.2e-144 510.4
Blo03g00231 . 35 499 EF-hand Containing Proteins AT4G04740 55.1 2.0e-141 499.6
Blo12g00582 . 50 507 EF-hand Containing Proteins AT4G04740 52.8 4.5e-141 498.4
Blo16g00559 . 21 502 EF-hand Containing Proteins AT4G04740 54.0 6.6e-140 494.6
Blo01g01253 . 89 580 EF-hand Containing Proteins AT4G04740 50.1 1.5e-139 493.4
Blo09g00453 . 136 631 EF-hand Containing Proteins AT4G04740 50.9 1.9e-139 493.0
Blo02g01128 . 36 501 EF-hand Containing Proteins AT4G04740 54.9 4.3e-139 491.9
Blo15g00417 . 94 545 EF-hand Containing Proteins AT4G04740 55.0 6.1e-138 488.0
Blo11g00138 . 47 504 EF-hand Containing Proteins AT4G04740 52.2 1.2e-136 483.8
Blo01g01057 CCT 37 503 EF-hand Containing Proteins AT4G04740 52.0 3.4e-136 482.3
Blo12g00391 . 37 516 EF-hand Containing Proteins AT4G04740 50.9 1.3e-135 480.3
Blo12g00800 . 18 470 EF-hand Containing Proteins AT4G04740 54.2 1.6e-133 473.4
Blo04g00371 . 107 551 EF-hand Containing Proteins AT4G04740 53.4 7.8e-133 471.1
Blo02g00160 . 95 546 EF-hand Containing Proteins AT4G04740 52.8 8.3e-127 451.1
Blo12g00256 . 1 520 EF-hand Containing Proteins AT2G31500 65.0 6.3e-200 694.1
Blo08g00105 . 1 523 EF-hand Containing Proteins AT2G31500 57.0 2.2e-176 615.9
Blo12g00582 . 42 522 EF-hand Containing Proteins AT2G31500 61.2 1.9e-175 612.8
Blo11g00138 . 39 510 EF-hand Containing Proteins AT2G31500 60.4 2.6e-169 592.4
Blo04g00755 BCT 41 528 EF-hand Containing Proteins AT2G31500 57.9 9.8e-169 590.5
Blo07g01139 CCT 1 519 EF-hand Containing Proteins AT2G31500 55.3 8.6e-165 577.4
Blo01g01057 CCT 1 526 EF-hand Containing Proteins AT2G31500 53.9 2.0e-161 566.2
Blo16g00202 BCT 59 585 EF-hand Containing Proteins AT2G31500 51.9 4.1e-159 558.5
Blo12g00391 . 37 528 EF-hand Containing Proteins AT2G31500 56.4 1.1e-156 550.4
Blo08g00131 BCT 58 514 EF-hand Containing Proteins AT2G31500 51.1 3.7e-131 465.7
Blo15g00417 . 106 562 EF-hand Containing Proteins AT2G31500 50.7 2.5e-124 443.0
Blo02g00160 . 107 566 EF-hand Containing Proteins AT2G31500 51.0 2.1e-118 423.3
Blo04g00371 . 112 551 EF-hand Containing Proteins AT2G31500 51.2 3.0e-117 419.5
Blo03g00231 . 1 422 EF-hand Containing Proteins AT2G31500 50.2 2.9e-112 402.9
Blo09g00457 . 138 544 EF-hand Containing Proteins AT2G35890 70.1 6.7e-169 590.9
Blo07g01294 . 110 516 EF-hand Containing Proteins AT2G35890 64.7 7.2e-155 544.3
Blo09g00453 . 124 584 EF-hand Containing Proteins AT2G35890 57.8 2.9e-148 522.3
Blo04g00371 . 87 459 EF-hand Containing Proteins AT2G35890 67.0 6.6e-148 521.2
Blo01g01253 . 104 517 EF-hand Containing Proteins AT2G35890 60.6 1.7e-143 506.5
Blo16g00559 . 24 382 EF-hand Containing Proteins AT2G35890 66.0 3.1e-137 485.7
Blo12g00800 . 18 377 EF-hand Containing Proteins AT2G35890 64.7 2.0e-136 483.0
Blo02g00160 . 62 453 EF-hand Containing Proteins AT2G35890 60.7 1.1e-134 477.2
Blo15g00417 . 90 451 EF-hand Containing Proteins AT2G35890 64.6 2.4e-134 476.1
Blo08g00131 BCT 70 450 EF-hand Containing Proteins AT2G35890 59.9 2.0e-133 473.0
Blo14g00295 BCT 70 450 EF-hand Containing Proteins AT2G35890 58.9 3.0e-132 469.2
Blo13g00467 . 387 799 EF-hand Containing Proteins AT2G35890 58.1 8.0e-130 461.1
Blo07g00904 BCT 60 452 EF-hand Containing Proteins AT2G35890 53.0 1.5e-123 440.3
Blo08g00105 . 43 433 EF-hand Containing Proteins AT2G35890 54.3 1.6e-122 436.8
Blo03g00231 . 63 422 EF-hand Containing Proteins AT2G35890 58.1 1.4e-121 433.7
Blo12g00582 . 42 427 EF-hand Containing Proteins AT2G35890 54.0 2.6e-120 429.5
Blo02g01128 . 49 406 EF-hand Containing Proteins AT2G35890 56.1 4.4e-120 428.7
Blo13g00983 . 81 499 EF-hand Containing Proteins AT2G35890 50.4 9.9e-120 427.6
Blo04g00755 BCT 56 438 EF-hand Containing Proteins AT2G35890 54.1 1.7e-119 426.8
Blo12g00874 . 71 440 EF-hand Containing Proteins AT2G35890 53.6 2.4e-118 422.9
Blo11g00138 . 39 432 EF-hand Containing Proteins AT2G35890 51.4 2.3e-116 416.4
Blo10g00833 BCT 64 456 EF-hand Containing Proteins AT2G35890 50.5 2.3e-116 416.4
Blo07g01139 CCT 27 429 EF-hand Containing Proteins AT2G35890 52.2 3.3e-115 412.5
Blo01g01057 CCT 49 429 EF-hand Containing Proteins AT2G35890 52.6 3.6e-114 409.1
Blo12g00391 . 25 442 EF-hand Containing Proteins AT2G35890 50.5 1.8e-113 406.8
Blo09g00114 . 26 303 EF-hand Containing Proteins AT2G35890 50.4 6.7e-76 282.0
Blo04g00322 . 90 287 EF-hand Containing Proteins AT2G35890 52.6 6.7e-52 202.2
Blo15g00417 . 83 564 EF-hand Containing Proteins AT4G38230 86.9 1.0e-235 812.8
Blo02g00160 . 84 573 EF-hand Containing Proteins AT4G38230 80.6 1.1e-216 749.6
Blo13g00467 . 388 915 EF-hand Containing Proteins AT4G38230 75.0 1.4e-216 749.2
Blo07g01294 . 120 595 EF-hand Containing Proteins AT4G38230 66.8 1.1e-186 649.8
Blo09g00457 . 148 623 EF-hand Containing Proteins AT4G38230 67.4 7.4e-186 647.1
Blo16g00559 . 16 517 EF-hand Containing Proteins AT4G38230 66.1 2.9e-182 635.2
Blo01g01253 . 104 591 EF-hand Containing Proteins AT4G38230 61.1 5.1e-171 597.8
Blo09g00453 . 130 631 EF-hand Containing Proteins AT4G38230 60.2 1.3e-169 593.2
Blo12g00800 . 19 488 EF-hand Containing Proteins AT4G38230 65.1 2.0e-167 585.9
Blo04g00371 . 92 551 EF-hand Containing Proteins AT4G38230 66.5 1.0e-166 583.6
Blo14g00295 BCT 62 514 EF-hand Containing Proteins AT4G38230 61.1 1.1e-165 580.1
Blo08g00131 BCT 62 514 EF-hand Containing Proteins AT4G38230 61.4 1.1e-165 580.1
Blo07g00904 BCT 64 516 EF-hand Containing Proteins AT4G38230 60.0 1.0e-158 557.0
Blo13g00983 . 85 564 EF-hand Containing Proteins AT4G38230 55.7 3.1e-152 535.4
Blo12g00874 . 63 512 EF-hand Containing Proteins AT4G38230 56.1 3.3e-146 515.4
Blo10g00833 BCT 68 520 EF-hand Containing Proteins AT4G38230 54.3 2.9e-142 502.3
Blo02g01128 . 49 512 EF-hand Containing Proteins AT4G38230 57.5 3.6e-140 495.4
Blo03g00231 . 63 512 EF-hand Containing Proteins AT4G38230 58.4 4.0e-139 491.9
Blo08g00105 . 36 498 EF-hand Containing Proteins AT4G38230 51.4 7.5e-138 487.6
Blo04g00755 BCT 59 503 EF-hand Containing Proteins AT4G38230 54.7 1.7e-137 486.5
Blo07g01139 CCT 32 494 EF-hand Containing Proteins AT4G38230 52.9 1.8e-136 483.0
Blo01g01057 CCT 48 494 EF-hand Containing Proteins AT4G38230 52.8 2.8e-132 469.2
Blo12g00391 . 48 526 EF-hand Containing Proteins AT4G38230 50.7 2.6e-130 462.6
Blo09g00114 . 37 300 EF-hand Containing Proteins AT4G38230 51.1 1.5e-77 287.3
Blo07g00904 BCT 54 520 EF-hand Containing Proteins AT4G04700 59.9 3.0e-155 545.4
Blo10g00833 BCT 67 526 EF-hand Containing Proteins AT4G04700 59.4 2.1e-148 522.7
Blo13g00983 . 79 570 EF-hand Containing Proteins AT4G04700 56.0 1.5e-146 516.5
Blo12g00874 . 62 511 EF-hand Containing Proteins AT4G04700 57.5 2.6e-146 515.8
Blo08g00131 BCT 62 512 EF-hand Containing Proteins AT4G04700 54.1 1.1e-136 483.8
Blo14g00295 BCT 62 512 EF-hand Containing Proteins AT4G04700 53.2 2.7e-135 479.2
Blo03g00231 . 63 497 EF-hand Containing Proteins AT4G04700 51.0 2.2e-113 406.4
Blo02g00160 . 95 453 EF-hand Containing Proteins AT4G04700 50.4 9.9e-98 354.4
Blo16g00080 . 57 440 EF-hand Containing Proteins AT5G66210 83.6 6.8e-191 663.7
Blo06g00303 . 101 467 EF-hand Containing Proteins AT5G66210 80.7 1.4e-175 612.8
Blo05g00614 . 121 505 EF-hand Containing Proteins AT5G66210 51.7 2.3e-106 382.9
Blo07g01221 BCT 91 474 EF-hand Containing Proteins AT5G66210 52.6 3.4e-105 379.0
Blo16g00377 . 128 492 EF-hand Containing Proteins AT5G66210 54.5 4.4e-105 378.6
Blo09g00365 BCT 91 471 EF-hand Containing Proteins AT5G66210 51.7 1.3e-104 377.1
Blo01g00249 BCT 147 507 EF-hand Containing Proteins AT5G66210 51.6 8.6e-101 364.4
Blo07g00904 BCT 231 517 EF-hand Containing Proteins AT1G76040 68.6 3.1e-111 398.7
Blo12g00874 . 230 520 EF-hand Containing Proteins AT1G76040 68.0 1.2e-110 396.7
Blo13g00983 . 281 563 EF-hand Containing Proteins AT1G76040 67.8 2.0e-110 396.0
Blo14g00295 BCT 229 524 EF-hand Containing Proteins AT1G76040 58.8 1.7e-98 356.3
Blo10g00833 BCT 235 525 EF-hand Containing Proteins AT1G76040 60.8 5.1e-98 354.8
Blo08g00131 BCT 229 524 EF-hand Containing Proteins AT1G76040 58.4 1.5e-97 353.2
Blo09g00457 . 323 617 EF-hand Containing Proteins AT1G76040 55.4 1.9e-92 336.3
Blo16g00559 . 191 512 EF-hand Containing Proteins AT1G76040 57.0 1.0e-90 330.5
Blo07g01294 . 295 576 EF-hand Containing Proteins AT1G76040 56.2 5.6e-89 324.7
Blo13g00467 . 612 906 EF-hand Containing Proteins AT1G76040 60.5 1.4e-87 320.1
Blo15g00417 . 262 555 EF-hand Containing Proteins AT1G76040 58.6 8.9e-87 317.4
Blo09g00453 . 364 652 EF-hand Containing Proteins AT1G76040 52.4 2.7e-83 305.8
Blo04g00755 BCT 218 504 EF-hand Containing Proteins AT1G76040 52.4 2.3e-82 302.8
Blo12g00800 . 186 470 EF-hand Containing Proteins AT1G76040 58.4 7.3e-81 297.7
Blo03g00231 . 230 512 EF-hand Containing Proteins AT1G76040 58.3 4.7e-80 295.0
Blo02g01128 . 216 501 EF-hand Containing Proteins AT1G76040 57.7 3.1e-79 292.4
Blo04g00371 . 267 555 EF-hand Containing Proteins AT1G76040 55.5 4.2e-76 282.0
Blo02g00160 . 262 546 EF-hand Containing Proteins AT1G76040 54.2 9.6e-73 270.8
Blo04g00755 BCT 1 544 EF-hand Containing Proteins AT1G74740 79.9 1.6e-253 872.1
Blo16g00202 BCT 1 601 EF-hand Containing Proteins AT1G74740 72.8 6.8e-249 856.7
Blo07g01139 CCT 35 524 EF-hand Containing Proteins AT1G74740 71.4 1.0e-207 719.9
Blo08g00105 . 1 530 EF-hand Containing Proteins AT1G74740 66.8 5.0e-207 717.6
Blo12g00582 . 1 528 EF-hand Containing Proteins AT1G74740 66.4 4.6e-205 711.1
Blo01g01057 CCT 36 526 EF-hand Containing Proteins AT1G74740 69.7 4.5e-200 694.5
Blo12g00391 . 36 530 EF-hand Containing Proteins AT1G74740 69.0 3.9e-196 681.4
Blo11g00138 . 1 514 EF-hand Containing Proteins AT1G74740 65.2 2.0e-195 679.1
Blo12g00256 . 1 527 EF-hand Containing Proteins AT1G74740 55.1 5.2e-172 601.3
Blo14g00295 BCT 57 514 EF-hand Containing Proteins AT1G74740 58.0 9.2e-153 537.3
Blo08g00131 BCT 57 514 EF-hand Containing Proteins AT1G74740 57.1 5.6e-150 528.1
Blo09g00457 . 153 629 EF-hand Containing Proteins AT1G74740 55.7 2.3e-148 522.7
Blo07g00904 BCT 76 522 EF-hand Containing Proteins AT1G74740 56.3 5.8e-147 518.1
Blo07g01294 . 136 576 EF-hand Containing Proteins AT1G74740 57.8 1.7e-146 516.5
Blo01g01253 . 106 580 EF-hand Containing Proteins AT1G74740 52.5 6.6e-143 504.6
Blo13g00983 . 93 563 EF-hand Containing Proteins AT1G74740 53.5 3.6e-141 498.8
Blo16g00559 . 21 502 EF-hand Containing Proteins AT1G74740 52.2 5.4e-137 485.0
Blo12g00874 . 71 512 EF-hand Containing Proteins AT1G74740 51.1 1.0e-135 480.7
Blo15g00417 . 100 545 EF-hand Containing Proteins AT1G74740 55.1 2.3e-135 479.6
Blo09g00453 . 146 637 EF-hand Containing Proteins AT1G74740 50.6 4.3e-134 475.3
Blo10g00833 BCT 79 521 EF-hand Containing Proteins AT1G74740 51.6 6.8e-132 468.0
Blo13g00467 . 407 896 EF-hand Containing Proteins AT1G74740 50.2 7.1e-129 458.0
Blo04g00371 . 94 551 EF-hand Containing Proteins AT1G74740 52.2 2.7e-128 456.1
Blo02g00160 . 101 546 EF-hand Containing Proteins AT1G74740 52.7 5.3e-124 441.8
Blo03g00231 . 48 498 EF-hand Containing Proteins AT1G74740 50.8 2.1e-120 429.9
Blo07g00432 . 29 308 EF-hand Containing Proteins AT1G74740 50.4 1.7e-77 287.3
Blo12g00582 . 1 407 EF-hand Containing Proteins AT3G57530 80.2 4.8e-197 684.1
Blo11g00138 . 1 404 EF-hand Containing Proteins AT3G57530 77.1 3.3e-190 661.4
Blo08g00105 . 1 409 EF-hand Containing Proteins AT3G57530 74.9 4.7e-184 641.0
Blo04g00755 BCT 1 411 EF-hand Containing Proteins AT3G57530 66.7 2.6e-158 555.4
Blo07g01139 CCT 1 403 EF-hand Containing Proteins AT3G57530 65.5 1.1e-156 550.1
Blo01g01057 CCT 1 403 EF-hand Containing Proteins AT3G57530 63.7 4.3e-153 538.1
Blo12g00391 . 1 416 EF-hand Containing Proteins AT3G57530 62.8 5.2e-151 531.2
Blo12g00256 . 34 405 EF-hand Containing Proteins AT3G57530 64.8 2.0e-150 529.3
Blo16g00202 BCT 1 471 EF-hand Containing Proteins AT3G57530 57.9 6.4e-149 524.2
Blo09g00457 . 156 520 EF-hand Containing Proteins AT3G57530 59.3 8.1e-128 454.1
Blo14g00295 BCT 52 426 EF-hand Containing Proteins AT3G57530 58.7 2.6e-126 449.1
Blo07g01294 . 128 492 EF-hand Containing Proteins AT3G57530 57.9 1.7e-125 446.4
Blo08g00131 BCT 52 426 EF-hand Containing Proteins AT3G57530 57.9 1.4e-124 443.4
Blo04g00371 . 100 460 EF-hand Containing Proteins AT3G57530 58.3 1.2e-123 440.3
Blo01g01253 . 106 471 EF-hand Containing Proteins AT3G57530 56.9 2.7e-123 439.1
Blo16g00559 . 30 382 EF-hand Containing Proteins AT3G57530 58.6 4.6e-123 438.3
Blo12g00800 . 13 379 EF-hand Containing Proteins AT3G57530 57.3 3.0e-122 435.6
Blo07g00904 BCT 64 428 EF-hand Containing Proteins AT3G57530 55.5 1.4e-119 426.8
Blo02g00160 . 87 453 EF-hand Containing Proteins AT3G57530 57.3 1.4e-119 426.8
Blo03g00231 . 63 422 EF-hand Containing Proteins AT3G57530 57.9 1.5e-118 423.3
Blo15g00417 . 94 449 EF-hand Containing Proteins AT3G57530 56.9 3.4e-118 422.2
Blo10g00833 BCT 68 432 EF-hand Containing Proteins AT3G57530 53.6 1.4e-116 416.8
Blo02g01128 . 49 404 EF-hand Containing Proteins AT3G57530 55.7 3.2e-116 415.6
Blo12g00874 . 70 427 EF-hand Containing Proteins AT3G57530 53.9 1.1e-113 407.1
Blo13g00983 . 93 475 EF-hand Containing Proteins AT3G57530 52.1 4.3e-113 405.2
Blo13g00467 . 406 799 EF-hand Containing Proteins AT3G57530 52.5 5.6e-113 404.8
Blo07g00904 BCT 1 467 EF-hand Containing Proteins AT1G50700 75.2 7.2e-202 700.3
Blo10g00833 BCT 54 471 EF-hand Containing Proteins AT1G50700 76.8 1.8e-192 669.1
Blo13g00983 . 85 514 EF-hand Containing Proteins AT1G50700 73.7 1.9e-186 649.0
Blo12g00874 . 62 463 EF-hand Containing Proteins AT1G50700 71.9 8.3e-174 607.1
Blo14g00295 BCT 1 465 EF-hand Containing Proteins AT1G50700 63.5 6.6e-171 597.4
Blo08g00131 BCT 1 465 EF-hand Containing Proteins AT1G50700 63.8 8.6e-171 597.0
Blo07g01294 . 89 531 EF-hand Containing Proteins AT1G50700 57.5 2.6e-151 532.3
Blo09g00457 . 155 559 EF-hand Containing Proteins AT1G50700 62.7 1.3e-150 530.0
Blo03g00231 . 1 422 EF-hand Containing Proteins AT1G50700 62.5 9.3e-149 523.9
Blo16g00559 . 17 427 EF-hand Containing Proteins AT1G50700 60.8 4.9e-142 501.5
Blo09g00453 . 137 599 EF-hand Containing Proteins AT1G50700 52.9 2.7e-140 495.7
Blo02g01128 . 49 406 EF-hand Containing Proteins AT1G50700 66.2 1.3e-139 493.4
Blo04g00371 . 83 461 EF-hand Containing Proteins AT1G50700 61.7 3.3e-138 488.8
Blo01g01253 . 108 532 EF-hand Containing Proteins AT1G50700 56.0 9.6e-138 487.3
Blo15g00417 . 94 497 EF-hand Containing Proteins AT1G50700 58.2 1.4e-136 483.4
Blo04g00755 BCT 63 453 EF-hand Containing Proteins AT1G50700 58.7 2.0e-135 479.6
Blo08g00105 . 43 448 EF-hand Containing Proteins AT1G50700 56.2 1.7e-134 476.5
Blo12g00800 . 21 379 EF-hand Containing Proteins AT1G50700 63.2 7.1e-133 471.1
Blo12g00582 . 13 447 EF-hand Containing Proteins AT1G50700 53.2 3.5e-132 468.8
Blo16g00202 BCT 63 510 EF-hand Containing Proteins AT1G50700 52.2 3.9e-131 465.3
Blo07g01139 CCT 34 444 EF-hand Containing Proteins AT1G50700 54.5 1.9e-130 463.0
Blo13g00467 . 398 848 EF-hand Containing Proteins AT1G50700 52.3 3.3e-130 462.2
Blo02g00160 . 95 453 EF-hand Containing Proteins AT1G50700 61.8 1.6e-129 459.9
Blo11g00138 . 1 444 EF-hand Containing Proteins AT1G50700 50.3 5.3e-128 454.9
Blo12g00256 . 48 444 EF-hand Containing Proteins AT1G50700 54.4 1.5e-127 453.4
Blo12g00391 . 31 457 EF-hand Containing Proteins AT1G50700 51.4 9.3e-125 444.1
Blo01g01057 CCT 45 444 EF-hand Containing Proteins AT1G50700 54.0 1.2e-124 443.7
Blo08g00131 BCT 1 526 EF-hand Containing Proteins AT5G19360 81.7 8.4e-252 866.3
Blo14g00295 BCT 1 526 EF-hand Containing Proteins AT5G19360 81.6 2.1e-250 861.7
Blo07g00904 BCT 40 521 EF-hand Containing Proteins AT5G19360 69.7 3.7e-199 691.4
Blo13g00983 . 85 563 EF-hand Containing Proteins AT5G19360 65.6 2.7e-186 648.7
Blo12g00874 . 48 517 EF-hand Containing Proteins AT5G19360 62.8 3.8e-180 628.2
Blo10g00833 BCT 68 520 EF-hand Containing Proteins AT5G19360 66.0 2.5e-179 625.5
Blo07g01294 . 128 576 EF-hand Containing Proteins AT5G19360 64.7 5.5e-179 624.4
Blo09g00457 . 164 621 EF-hand Containing Proteins AT5G19360 63.6 8.0e-178 620.5
Blo01g01253 . 98 581 EF-hand Containing Proteins AT5G19360 60.4 5.5e-171 597.8
Blo03g00231 . 47 499 EF-hand Containing Proteins AT5G19360 65.1 9.5e-171 597.0
Blo02g01128 . 15 504 EF-hand Containing Proteins AT5G19360 60.2 8.8e-169 590.5
Blo15g00417 . 94 546 EF-hand Containing Proteins AT5G19360 60.4 2.9e-164 575.5
Blo09g00453 . 138 645 EF-hand Containing Proteins AT5G19360 54.4 9.5e-163 570.5
Blo16g00559 . 24 503 EF-hand Containing Proteins AT5G19360 58.2 3.6e-162 568.5
Blo07g01139 CCT 32 494 EF-hand Containing Proteins AT5G19360 59.0 3.0e-161 565.5
Blo08g00105 . 52 498 EF-hand Containing Proteins AT5G19360 58.8 1.6e-157 553.1
Blo04g00755 BCT 1 503 EF-hand Containing Proteins AT5G19360 54.8 1.0e-156 550.4
Blo13g00467 . 336 897 EF-hand Containing Proteins AT5G19360 51.2 1.2e-154 543.5
Blo01g01057 CCT 34 494 EF-hand Containing Proteins AT5G19360 57.9 1.8e-153 539.7
Blo12g00582 . 1 497 EF-hand Containing Proteins AT5G19360 53.5 6.8e-153 537.7
Blo04g00371 . 70 552 EF-hand Containing Proteins AT5G19360 55.6 2.0e-152 536.2
Blo12g00391 . 32 507 EF-hand Containing Proteins AT5G19360 56.4 4.4e-152 535.0
Blo02g00160 . 95 547 EF-hand Containing Proteins AT5G19360 57.3 9.2e-150 527.3
Blo11g00138 . 39 494 EF-hand Containing Proteins AT5G19360 56.1 1.7e-148 523.1
Blo16g00202 BCT 59 560 EF-hand Containing Proteins AT5G19360 52.6 3.9e-148 521.9
Blo12g00800 . 27 470 EF-hand Containing Proteins AT5G19360 56.9 7.3e-147 517.7
Blo12g00256 . 48 495 EF-hand Containing Proteins AT5G19360 54.9 8.9e-145 510.8
Blo09g00114 . 37 303 EF-hand Containing Proteins AT5G19360 50.2 1.3e-79 294.3
Blo07g00432 . 35 309 EF-hand Containing Proteins AT5G19360 50.2 8.5e-79 291.6
Blo04g00322 . 125 287 EF-hand Containing Proteins AT5G19360 54.8 4.5e-48 189.5
Blo04g00667 CCT 7 507 EF-hand Containing Proteins AT4G28220 68.4 1.4e-203 706.1
Blo01g00828 . 5 516 EF-hand Containing Proteins AT4G28220 63.7 3.1e-187 651.7
Blo02g00094 BCT,CCT 49 518 EF-hand Containing Proteins AT4G28220 62.1 8.8e-174 607.1
Blo01g00828 . 7 583 EF-hand Containing Proteins AT2G20800 68.2 5.3e-231 797.3
Blo02g00094 BCT,CCT 4 585 EF-hand Containing Proteins AT2G20800 68.5 4.5e-230 794.3
Blo04g00667 CCT 1 574 EF-hand Containing Proteins AT2G20800 60.6 5.0e-205 711.1
Blo04g00309 BCT,CCT 1 791 EF-hand Containing Proteins AT2G35800 65.2 3.2e-282 968.0
Blo13g00731 BCT,CCT 1 794 EF-hand Containing Proteins AT2G35800 63.2 1.1e-279 959.5
Blo13g00914 CCT 78 677 EF-hand Containing Proteins AT2G35800 62.9 6.0e-212 734.6
Blo02g00324 BCT 25 491 EF-hand Containing Proteins AT1G01280 78.0 7.7e-218 753.4
Blo03g00397 . 38 536 EF-hand Containing Proteins AT5G44620 54.2 3.0e-161 565.5
Blo03g00406 . 64 563 EF-hand Containing Proteins AT5G44620 54.4 3.3e-160 562.0
Blo16g00635 . 40 570 EF-hand Containing Proteins AT1G02150 50.8 2.2e-143 506.1
Blo01g00592 . 1 988 EF-hand Containing Proteins AT1G06220 86.7 0.0e+00 1740.3
Blo01g00592 . 1 988 EF-hand Containing Proteins AT5G25230 83.2 0.0e+00 1661.4
Blo11g00798 . 1 326 EF-hand Containing Proteins AT1G69030 55.4 5.5e-65 245.0
Blo06g01203 . 91 253 EF-hand Containing Proteins AT1G69030 55.8 1.5e-41 167.2
Blo11g00395 . 1 743 EF-hand Containing Proteins AT3G59820 63.3 1.2e-235 813.1
Blo04g01336 . 1 692 EF-hand Containing Proteins AT3G59820 64.0 5.8e-230 794.3
Blo09g00477 . 116 416 EF-hand Containing Proteins AT5G06260 60.6 3.9e-109 391.7
Blo10g00846 CCT 1 554 EF-hand Containing Proteins AT3G20290 80.8 4.3e-267 917.1
Blo03g01458 CCT 1 546 EF-hand Containing Proteins AT3G20290 78.0 7.9e-253 869.8
Blo14g00564 . 187 471 EF-hand Containing Proteins AT3G20290 57.5 9.1e-100 361.3
Blo12g00475 BCT 1 123 EF-hand Containing Proteins AT3G20290 75.6 6.2e-48 189.1
Blo10g00846 CCT 8 554 EF-hand Containing Proteins AT4G05520 73.4 6.5e-239 823.5
Blo03g01458 CCT 5 546 EF-hand Containing Proteins AT4G05520 69.7 5.0e-223 770.8
Blo14g00564 . 187 471 EF-hand Containing Proteins AT4G05520 52.8 3.2e-89 326.2
Blo12g00475 BCT 1 130 EF-hand Containing Proteins AT4G05520 70.0 1.2e-46 184.9
Blo12g00918 . 1 972 EF-hand Containing Proteins AT1G47550 76.7 0.0e+00 1410.2
Blo01g01548 BCT 256 1061 EF-hand Containing Proteins AT1G47550 84.4 0.0e+00 1338.2
Blo12g00918 . 1 972 EF-hand Containing Proteins AT1G47560 75.4 0.0e+00 1382.9
Blo01g01548 BCT 256 1061 EF-hand Containing Proteins AT1G47560 82.8 0.0e+00 1314.7
Blo15g00005 . 99 449 EF-hand Containing Proteins AT1G02270 63.8 1.2e-134 476.5
Blo01g00259 . 87 434 EF-hand Containing Proteins AT1G02270 62.1 1.2e-129 459.9
Blo15g00005 . 9 345 EF-hand Containing Proteins AT5G54130 78.0 1.1e-157 553.1
Blo01g00259 . 20 331 EF-hand Containing Proteins AT5G54130 69.9 1.1e-125 446.8
Blo01g01584 BCT 1 793 EF-hand Containing Proteins AT1G05150 79.1 4.6e-313 1070.5
Blo12g00896 BCT 1 793 EF-hand Containing Proteins AT1G05150 79.8 3.6e-310 1060.8
Blo01g01584 BCT 1 793 EF-hand Containing Proteins AT2G32450 77.6 1.0e-304 1042.7
Blo12g00896 BCT 1 793 EF-hand Containing Proteins AT2G32450 77.6 3.3e-300 1027.7
Blo16g00693 . 15 586 EF-hand Containing Proteins AT1G23160 54.9 2.0e-182 636.0
Blo02g00215 . 15 586 EF-hand Containing Proteins AT1G23160 54.1 2.2e-181 632.5
Blo10g00050 . 6 590 EF-hand Containing Proteins AT1G23160 50.2 1.1e-167 587.0
Blo07g00928 BCT,CCT,ECH 15 597 EF-hand Containing Proteins AT1G23160 51.2 2.4e-167 585.9
Blo10g00791 BCT,CCT,ECH 15 597 EF-hand Containing Proteins AT1G23160 50.2 7.2e-164 574.3
Blo03g01430 BCT,CCT,ECH 15 582 EF-hand Containing Proteins AT1G23160 50.2 1.5e-156 550.1
Blo18g00574 . 1 302 EF-hand Containing Proteins AT3G04860 60.3 2.1e-103 372.5
Blo11g00468 . 1 299 EF-hand Containing Proteins AT3G04860 58.7 3.3e-101 365.2
Blo18g00574 . 1 302 EF-hand Containing Proteins AT5G28150 61.6 3.6e-103 371.7
Blo11g00468 . 1 299 EF-hand Containing Proteins AT5G28150 58.1 6.3e-100 360.9
Blo10g00021 . 1 291 EF-hand Containing Proteins AT5G28150 50.5 5.6e-80 294.7
Blo11g00628 . 1 836 EF-hand Containing Proteins AT3G01780 85.2 0.0e+00 1426.8
Blo08g00026 . 1 555 EF-hand Containing Proteins AT5G22840 63.7 7.9e-197 683.7
Blo05g00674 . 6 412 EF-hand Containing Proteins AT5G22840 52.9 2.3e-135 479.6
Blo02g00268 . 39 186 EF-hand Containing Proteins AT1G64850 73.6 1.2e-60 229.6
Blo03g01254 . 1 788 EF-hand Containing Proteins AT3G46220 62.9 2.4e-271 931.8
Blo14g00238 . 12 563 EF-hand Containing Proteins AT3G44330 73.9 5.1e-239 823.9
Blo07g00806 BCT 2 1834 EF-hand Containing Proteins AT3G14270 60.3 0.0e+00 2013.8
Blo10g00959 BCT 2 1893 EF-hand Containing Proteins AT3G14270 57.7 0.0e+00 1995.3
Blo08g00138 . 48 1003 EF-hand Containing Proteins AT1G80680 58.2 0.0e+00 1099.7
Blo13g01031 BCT 1 1017 EF-hand Containing Proteins AT2G30110 81.1 0.0e+00 1711.8
Blo14g00071 BCT 2 899 EF-hand Containing Proteins AT2G30110 82.2 0.0e+00 1541.9
Blo14g00070 . 89 251 EF-hand Containing Proteins AT2G30110 68.1 1.5e-50 198.7
Blo15g00027 . 211 333 EF-hand Containing Proteins AT2G30110 56.8 1.9e-40 165.2
Blo04g00309 BCT,CCT 1 791 EF-hand Containing Proteins AT2G35800 65.2 3.2e-282 968.0
Blo13g00731 BCT,CCT 1 794 EF-hand Containing Proteins AT2G35800 63.2 1.1e-279 959.5
Blo13g00914 CCT 78 677 EF-hand Containing Proteins AT2G35800 62.9 6.0e-212 734.6
Blo17g00573 BCT 17 494 EF-hand Containing Proteins AT5G07320 66.3 1.8e-184 642.5
Blo18g00559 BCT 8 496 EF-hand Containing Proteins AT5G07320 62.6 1.0e-171 600.1
Blo17g00573 BCT 16 494 EF-hand Containing Proteins AT5G51050 67.8 3.6e-188 654.8
Blo18g00559 BCT 17 496 EF-hand Containing Proteins AT5G51050 66.3 1.6e-180 629.4
Blo17g00573 BCT 174 494 EF-hand Containing Proteins AT5G61810 67.3 1.9e-119 426.0
Blo18g00559 BCT 188 496 EF-hand Containing Proteins AT5G61810 66.1 1.2e-113 406.8
Blo03g01173 . 5 577 EF-hand Containing Proteins AT5G58670 54.6 1.0e-178 623.6
Blo13g00796 . 3 580 EF-hand Containing Proteins AT5G58670 52.3 7.8e-171 597.4
Blo04g00235 BCT,CCT 3 569 EF-hand Containing Proteins AT5G58670 53.2 1.2e-166 583.6
Blo07g00877 . 166 682 EF-hand Containing Proteins AT4G26700 76.3 8.4e-223 770.0
Blo04g00638 . 167 631 EF-hand Containing Proteins AT4G26700 77.6 1.6e-210 729.2
Blo13g00423 . 166 605 EF-hand Containing Proteins AT4G26700 72.3 3.2e-190 661.8
Blo07g00877 . 3 669 EF-hand Containing Proteins AT5G55400 70.8 8.1e-274 939.9
Blo04g00638 . 1 632 EF-hand Containing Proteins AT5G55400 71.8 3.1e-265 911.4
Blo13g00423 . 1 632 EF-hand Containing Proteins AT5G55400 64.4 2.1e-245 845.5
Blo11g00438 BCT 204 531 EF-hand Containing Proteins AT1G03960 80.8 2.8e-160 561.6
Blo10g00275 BCT 1 274 EF-hand Containing Proteins AT1G03960 81.8 4.0e-135 478.0
Blo11g00438 BCT 193 531 EF-hand Containing Proteins AT5G44090 81.4 3.0e-170 595.5
Blo10g00275 BCT 1 274 EF-hand Containing Proteins AT5G44090 83.6 2.1e-139 493.0
Blo10g00274 . 49 273 EF-hand Containing Proteins AT5G44090 59.1 5.5e-71 265.8
Blo11g00439 . 517 672 EF-hand Containing Proteins AT5G44090 56.4 1.2e-41 168.3
Blo11g00438 BCT 191 531 EF-hand Containing Proteins AT1G54450 85.0 1.2e-176 616.7
Blo10g00275 BCT 1 274 EF-hand Containing Proteins AT1G54450 88.3 1.8e-145 513.1
Blo10g00274 . 10 273 EF-hand Containing Proteins AT1G54450 62.0 1.3e-90 330.9
Blo11g00439 . 484 671 EF-hand Containing Proteins AT1G54450 63.7 1.9e-65 247.3
Blo11g00438 BCT 193 531 EF-hand Containing Proteins AT5G28850 84.7 1.6e-173 606.3
Blo10g00275 BCT 1 274 EF-hand Containing Proteins AT5G28850 89.1 4.8e-146 515.0
Blo10g00274 . 3 273 EF-hand Containing Proteins AT5G28850 65.6 4.8e-93 339.0
Blo11g00439 . 481 672 EF-hand Containing Proteins AT5G28850 70.3 1.3e-69 261.2
Blo11g00438 BCT 193 531 EF-hand Containing Proteins AT5G28900 84.7 1.6e-173 606.3
Blo10g00275 BCT 1 274 EF-hand Containing Proteins AT5G28900 89.1 4.8e-146 515.0
Blo10g00274 . 3 273 EF-hand Containing Proteins AT5G28900 65.6 4.8e-93 339.0
Blo11g00439 . 481 672 EF-hand Containing Proteins AT5G28900 70.3 1.3e-69 261.2
Blo07g00183 BCT 1 465 EF-hand Containing Proteins AT5G18580 84.4 5.7e-231 797.0
Blo02g00520 BCT 69 494 EF-hand Containing Proteins AT5G18580 91.3 1.3e-230 795.8
Blo19g00164 . 1 133 EF-hand Containing Proteins AT1G32410 67.2 2.6e-46 181.8
Blo10g00524 . 52 201 EF-hand Containing Proteins AT3G18430 80.7 4.3e-67 251.1
Blo07g00689 . 48 220 EF-hand Containing Proteins AT3G18430 69.9 5.4e-62 234.2
Blo07g00337 BCT 3 216 EF-hand Containing Proteins AT1G64480 57.7 4.7e-62 234.6
Blo09g00028 BCT 4 242 EF-hand Containing Proteins AT1G64480 53.1 3.5e-57 218.4
Blo01g00804 . 14 208 EF-hand Containing Proteins AT1G64480 55.9 4.5e-57 218.0
Blo10g00879 . 638 830 EF-hand Containing Proteins AT1G64480 54.4 2.5e-55 212.2
Blo07g00864 . 13 205 EF-hand Containing Proteins AT1G64480 54.4 3.2e-55 211.8
Blo17g00289 BCT 103 295 EF-hand Containing Proteins AT1G64480 56.5 2.7e-54 208.8
Blo02g01009 . 61 226 EF-hand Containing Proteins AT1G64480 56.6 9.7e-52 200.3
Blo03g00134 . 67 233 EF-hand Containing Proteins AT1G64480 56.3 1.7e-51 199.5
Blo11g00141 . 1535 1684 EF-hand Containing Proteins AT1G64480 55.3 4.1e-42 168.3
Blo07g00337 BCT 27 236 EF-hand Containing Proteins AT5G24270 66.2 2.9e-72 268.5
Blo09g00028 BCT 28 262 EF-hand Containing Proteins AT5G24270 59.6 3.0e-69 258.5
Blo03g00134 . 68 258 EF-hand Containing Proteins AT5G24270 59.7 5.0e-64 241.1
Blo07g00864 . 37 215 EF-hand Containing Proteins AT5G24270 62.6 1.9e-63 239.2
Blo10g00879 . 662 840 EF-hand Containing Proteins AT5G24270 62.6 3.2e-63 238.4
Blo01g00804 . 40 218 EF-hand Containing Proteins AT5G24270 61.5 1.0e-61 233.4
Blo02g01009 . 59 229 EF-hand Containing Proteins AT5G24270 63.7 8.8e-61 230.3
Blo17g00289 BCT 130 295 EF-hand Containing Proteins AT5G24270 63.3 1.0e-56 216.9
Blo18g00285 BCT 36 200 EF-hand Containing Proteins AT5G24270 50.9 1.3e-40 163.3
Blo17g00289 BCT 99 257 EF-hand Containing Proteins AT4G33000 67.3 1.6e-54 209.5
Blo07g00337 BCT 6 156 EF-hand Containing Proteins AT4G33000 63.6 1.2e-46 183.3
Blo01g00804 . 8 170 EF-hand Containing Proteins AT4G33000 58.2 1.3e-45 179.9
Blo10g00879 . 654 792 EF-hand Containing Proteins AT4G33000 64.7 2.5e-44 175.6
Blo07g00864 . 29 167 EF-hand Containing Proteins AT4G33000 64.0 5.6e-44 174.5
Blo11g00141 . 1542 1680 EF-hand Containing Proteins AT4G33000 64.0 1.6e-43 172.9
Blo09g00028 BCT 1 181 EF-hand Containing Proteins AT4G33000 51.6 2.6e-41 165.6
Blo02g01009 . 61 188 EF-hand Containing Proteins AT4G33000 60.2 7.1e-39 157.5
Blo03g00134 . 65 195 EF-hand Containing Proteins AT4G33000 57.3 1.6e-38 156.4
Blo01g00804 . 1 226 EF-hand Containing Proteins AT4G16350 73.0 1.6e-87 319.3
Blo07g00864 . 1 223 EF-hand Containing Proteins AT4G16350 69.9 3.3e-80 295.0
Blo10g00879 . 637 848 EF-hand Containing Proteins AT4G16350 72.6 9.7e-80 293.5
Blo11g00141 . 1511 1728 EF-hand Containing Proteins AT4G16350 57.5 4.0e-57 218.4
Blo03g00134 . 67 250 EF-hand Containing Proteins AT4G16350 58.2 8.3e-55 210.7
Blo02g01009 . 59 226 EF-hand Containing Proteins AT4G16350 58.9 3.0e-49 192.2
Blo17g00289 BCT 123 295 EF-hand Containing Proteins AT4G16350 53.2 9.8e-48 187.2
Blo01g00804 . 1 226 EF-hand Containing Proteins AT5G55990 87.6 3.6e-111 397.9
Blo10g00879 . 637 848 EF-hand Containing Proteins AT5G55990 91.5 2.1e-106 382.1
Blo07g00864 . 1 223 EF-hand Containing Proteins AT5G55990 86.7 1.5e-104 375.9
Blo11g00141 . 1511 1684 EF-hand Containing Proteins AT5G55990 81.6 1.4e-73 273.1
Blo07g00337 BCT 1 234 EF-hand Containing Proteins AT5G55990 55.3 5.5e-67 251.1
Blo03g00134 . 67 250 EF-hand Containing Proteins AT5G55990 67.4 1.2e-66 250.0
Blo09g00028 BCT 9 260 EF-hand Containing Proteins AT5G55990 50.4 4.1e-62 235.0
Blo17g00289 BCT 99 295 EF-hand Containing Proteins AT5G55990 58.9 3.8e-60 228.4
Blo02g01009 . 59 226 EF-hand Containing Proteins AT5G55990 64.9 6.1e-58 221.1
Blo18g00285 BCT 36 206 EF-hand Containing Proteins AT5G55990 51.5 4.0e-41 165.2
Blo10g00879 . 671 848 EF-hand Containing Proteins AT4G26560 70.2 2.4e-72 268.9
Blo07g00864 . 46 223 EF-hand Containing Proteins AT4G26560 69.1 3.0e-70 261.9
Blo01g00804 . 49 226 EF-hand Containing Proteins AT4G26560 68.1 7.3e-69 257.3
Blo03g00134 . 74 250 EF-hand Containing Proteins AT4G26560 50.5 9.3e-48 187.2
Blo11g00141 . 1559 1684 EF-hand Containing Proteins AT4G26560 59.0 1.3e-38 156.8
Blo01g00804 . 1 226 EF-hand Containing Proteins AT4G26570 84.8 1.0e-108 389.8
Blo10g00879 . 639 848 EF-hand Containing Proteins AT4G26570 90.2 5.2e-105 377.5
Blo07g00864 . 1 223 EF-hand Containing Proteins AT4G26570 85.2 8.8e-105 376.7
Blo11g00141 . 1511 1684 EF-hand Containing Proteins AT4G26570 79.8 2.6e-72 268.9
Blo03g00134 . 67 250 EF-hand Containing Proteins AT4G26570 66.5 4.7e-66 248.1
Blo07g00337 BCT 10 234 EF-hand Containing Proteins AT4G26570 55.9 6.9e-65 244.2
Blo09g00028 BCT 9 260 EF-hand Containing Proteins AT4G26570 50.4 1.2e-61 233.4
Blo17g00289 BCT 110 295 EF-hand Containing Proteins AT4G26570 60.5 8.7e-60 227.3
Blo02g01009 . 59 226 EF-hand Containing Proteins AT4G26570 64.0 3.1e-57 218.8
Blo18g00285 BCT 36 206 EF-hand Containing Proteins AT4G26570 52.6 8.2e-42 167.5
Blo03g00134 . 66 253 EF-hand Containing Proteins AT4G17615 83.0 2.0e-87 318.9
Blo01g00804 . 16 225 EF-hand Containing Proteins AT4G17615 63.8 1.8e-75 279.3
Blo10g00879 . 638 847 EF-hand Containing Proteins AT4G17615 63.3 5.2e-75 277.7
Blo07g00864 . 22 222 EF-hand Containing Proteins AT4G17615 65.2 7.5e-74 273.9
Blo02g01009 . 61 226 EF-hand Containing Proteins AT4G17615 81.3 1.3e-73 273.1
Blo07g00337 BCT 1 233 EF-hand Containing Proteins AT4G17615 57.7 4.5e-71 264.6
Blo17g00289 BCT 102 295 EF-hand Containing Proteins AT4G17615 56.7 6.8e-59 224.2
Blo11g00141 . 1538 1730 EF-hand Containing Proteins AT4G17615 51.2 9.8e-50 193.7
Blo18g00285 BCT 36 206 EF-hand Containing Proteins AT4G17615 52.0 4.0e-43 171.8
Blo03g00134 . 66 198 EF-hand Containing Proteins AT5G47100 81.2 6.1e-58 220.7
Blo02g01009 . 61 191 EF-hand Containing Proteins AT5G47100 79.4 1.1e-54 209.9
Blo07g00337 BCT 1 155 EF-hand Containing Proteins AT5G47100 65.4 2.7e-53 205.3
Blo01g00804 . 31 172 EF-hand Containing Proteins AT5G47100 65.5 1.8e-49 192.6
Blo07g00864 . 28 169 EF-hand Containing Proteins AT5G47100 64.8 2.3e-49 192.2
Blo10g00879 . 653 794 EF-hand Containing Proteins AT5G47100 64.8 2.3e-49 192.2
Blo11g00141 . 1541 1680 EF-hand Containing Proteins AT5G47100 65.0 9.8e-48 186.8
Blo17g00289 BCT 102 259 EF-hand Containing Proteins AT5G47100 58.1 5.4e-46 181.0
Blo09g00028 BCT 9 180 EF-hand Containing Proteins AT5G47100 54.1 3.5e-45 178.3
Blo07g00864 . 25 205 EF-hand Containing Proteins AT4G01420 50.3 7.8e-46 180.6
Blo17g00289 BCT 119 295 EF-hand Containing Proteins AT4G01420 51.4 1.2e-43 173.3
Blo10g00489 . 1 141 EF-hand Containing Proteins AT2G44310 62.4 6.2e-40 160.6
Blo04g00550 BCT 14 362 EF-hand Containing Proteins AT4G38810 69.0 9.0e-131 463.8
Blo13g00527 BCT 15 363 EF-hand Containing Proteins AT4G38810 67.5 2.4e-128 455.7
Blo17g00012 . 35 412 EF-hand Containing Proteins AT4G32060 64.9 2.6e-124 442.6
Blo16g00902 . 64 412 EF-hand Containing Proteins AT4G32060 59.0 1.2e-110 397.1
Blo05g00543 . 1 830 EF-hand Containing Proteins AT4G39420 72.5 0.0e+00 1184.1
Blo03g01561 . 69 583 EF-hand Containing Proteins AT1G53210 61.5 9.9e-177 617.1
Blo02g00057 . 58 573 EF-hand Containing Proteins AT1G53210 55.6 9.0e-162 567.4
Blo16g00609 . 12 567 EF-hand Containing Proteins AT1G53210 52.1 1.8e-157 553.1
Blo04g01306 . 107 690 EF-hand Containing Proteins AT4G25970 74.3 1.0e-256 882.9
Blo13g00242 . 1 181 EF-hand Containing Proteins AT4G25970 71.3 9.7e-69 258.5
Blo04g01306 . 98 646 EF-hand Containing Proteins AT5G57190 73.0 6.3e-240 827.0
Blo13g00242 . 1 123 EF-hand Containing Proteins AT5G57190 72.4 1.1e-47 188.3
Blo07g00932 BCT 6 116 EF-hand Containing Proteins AT4G27280 71.4 1.0e-41 166.4
Blo10g00788 BCT 12 116 EF-hand Containing Proteins AT4G27280 71.7 1.1e-38 156.4
Blo10g00786 . 12 116 EF-hand Containing Proteins AT4G27280 70.8 1.8e-38 155.6
Blo10g00787 . 12 116 EF-hand Containing Proteins AT4G27280 69.8 3.1e-38 154.8
Blo07g00932 BCT 4 116 EF-hand Containing Proteins AT5G54490 67.5 2.3e-38 155.2
Blo10g00788 BCT 8 116 EF-hand Containing Proteins AT5G54490 66.4 2.0e-37 152.1
Blo10g00786 . 8 116 EF-hand Containing Proteins AT5G54490 65.5 3.4e-37 151.4
Blo10g00787 . 8 116 EF-hand Containing Proteins AT5G54490 64.5 5.7e-37 150.6
Blo16g00520 . 1 335 EF-hand Containing Proteins AT3G17470 57.1 1.4e-111 400.2
Blo09g00132 CCT,ECH 11 518 EF-hand Containing Proteins AT5G62250 54.9 1.0e-143 507.3
Blo15g00142 CCT,ECH 11 467 EF-hand Containing Proteins AT5G62250 52.2 2.0e-118 423.3
Blo04g00002 . 1 323 EF-hand Containing Proteins AT5G08580 59.8 1.8e-118 422.9
Blo07g00083 . 7 210 EF-hand Containing Proteins AT2G43290 63.7 6.0e-55 211.1
Blo02g00425 . 1 148 EF-hand Containing Proteins AT2G43290 75.2 1.3e-52 203.4
Blo01g00199 . 1239 1387 EF-hand Containing Proteins AT2G43290 64.9 1.7e-41 166.4
Blo02g00425 . 1 150 EF-hand Containing Proteins AT3G07490 80.7 2.6e-60 228.4
Blo07g00083 . 63 212 EF-hand Containing Proteins AT3G07490 76.0 2.5e-55 211.8
Blo01g00199 . 1246 1387 EF-hand Containing Proteins AT3G07490 67.6 6.9e-45 177.2
Blo02g00425 . 1 149 EF-hand Containing Proteins AT4G12860 63.1 7.0e-50 193.7
Blo07g00083 . 63 211 EF-hand Containing Proteins AT4G12860 59.1 8.1e-46 180.3
Blo01g00199 . 1246 1387 EF-hand Containing Proteins AT4G12860 53.5 4.3e-39 157.9
Blo13g00174 . 18 168 EF-hand Containing Proteins AT1G18210 61.0 5.3e-46 181.0
Blo09g00242 . 16 195 EF-hand Containing Proteins AT4G20780 62.8 1.8e-58 222.6
Blo09g00242 . 16 195 EF-hand Containing Proteins AT5G44460 61.1 1.6e-53 206.1
Blo02g01060 . 1 134 EF-hand Containing Proteins AT1G12310 83.6 4.6e-62 234.2
Blo02g01060 . 1 134 EF-hand Containing Proteins AT1G62820 82.1 3.9e-61 231.1
Blo14g00306 BCT 37 148 EF-hand Containing Proteins AT1G66410 85.7 4.9e-48 187.2
Blo07g01194 BCT 1 108 EF-hand Containing Proteins AT1G66410 82.4 3.1e-42 167.9
Blo07g01195 . 37 149 EF-hand Containing Proteins AT1G66410 77.9 9.0e-42 166.4
Blo09g00340 . 37 149 EF-hand Containing Proteins AT1G66410 77.9 9.0e-42 166.4
Blo09g00341 . 99 211 EF-hand Containing Proteins AT1G66410 77.9 9.0e-42 166.4
Blo12g00644 . 363 475 EF-hand Containing Proteins AT1G66410 77.9 1.5e-41 165.6
Blo08g00141 BCT 713 825 EF-hand Containing Proteins AT1G66410 77.0 2.0e-41 165.2
Blo12g00644 . 344 475 EF-hand Containing Proteins AT5G37780 89.4 2.2e-50 195.3
Blo07g01195 . 26 149 EF-hand Containing Proteins AT5G37780 93.5 4.1e-49 191.0
Blo09g00340 . 26 149 EF-hand Containing Proteins AT5G37780 93.5 4.1e-49 191.0
Blo08g00141 BCT 693 825 EF-hand Containing Proteins AT5G37780 88.0 4.1e-49 191.0
Blo09g00341 . 89 211 EF-hand Containing Proteins AT5G37780 93.5 2.0e-48 188.7
Blo07g01194 BCT 1 108 EF-hand Containing Proteins AT5G37780 96.3 3.7e-42 167.9
Blo14g00306 BCT 26 148 EF-hand Containing Proteins AT5G37780 71.5 2.4e-41 165.2
Blo07g01195 . 1 149 EF-hand Containing Proteins AT2G27030 98.7 1.3e-63 239.6
Blo09g00340 . 1 149 EF-hand Containing Proteins AT2G27030 98.7 1.3e-63 239.6
Blo14g00306 BCT 1 148 EF-hand Containing Proteins AT2G27030 72.3 2.6e-51 198.7
Blo08g00141 BCT 702 825 EF-hand Containing Proteins AT2G27030 97.6 7.1e-49 190.7
Blo09g00341 . 89 211 EF-hand Containing Proteins AT2G27030 98.4 1.6e-48 189.5
Blo12g00644 . 352 475 EF-hand Containing Proteins AT2G27030 96.8 2.1e-48 189.1
Blo07g00237 CCT,ECH 1 147 EF-hand Containing Proteins AT2G27030 74.1 2.0e-43 172.6
Blo07g01194 BCT 1 108 EF-hand Containing Proteins AT2G27030 93.5 6.0e-40 161.0
Blo07g01195 . 1 149 EF-hand Containing Proteins AT2G41110 91.3 8.5e-62 233.4
Blo09g00340 . 1 149 EF-hand Containing Proteins AT2G41110 91.3 8.5e-62 233.4
Blo08g00141 BCT 701 825 EF-hand Containing Proteins AT2G41110 96.8 1.3e-49 193.0
Blo14g00306 BCT 1 148 EF-hand Containing Proteins AT2G41110 66.9 1.7e-49 192.6
Blo09g00341 . 84 211 EF-hand Containing Proteins AT2G41110 95.3 2.8e-49 191.8
Blo12g00644 . 352 475 EF-hand Containing Proteins AT2G41110 96.8 8.2e-49 190.3
Blo07g00237 CCT,ECH 1 148 EF-hand Containing Proteins AT2G41110 68.1 1.7e-41 166.0
Blo07g01194 BCT 1 108 EF-hand Containing Proteins AT2G41110 93.5 4.1e-40 161.4
Blo07g01195 . 1 149 EF-hand Containing Proteins AT3G56800 98.7 3.8e-64 241.1
Blo09g00340 . 1 149 EF-hand Containing Proteins AT3G56800 98.7 3.8e-64 241.1
Blo14g00306 BCT 1 148 EF-hand Containing Proteins AT3G56800 72.3 9.6e-52 199.9
Blo08g00141 BCT 702 825 EF-hand Containing Proteins AT3G56800 97.6 2.0e-49 192.2
Blo09g00341 . 89 211 EF-hand Containing Proteins AT3G56800 98.4 4.5e-49 191.0
Blo12g00644 . 352 475 EF-hand Containing Proteins AT3G56800 96.8 5.8e-49 190.7
Blo07g00237 CCT,ECH 1 148 EF-hand Containing Proteins AT3G56800 73.6 7.4e-44 173.7
Blo07g01194 BCT 1 108 EF-hand Containing Proteins AT3G56800 93.5 2.9e-40 161.8
Blo14g00306 BCT 37 148 EF-hand Containing Proteins AT3G43810 85.7 4.9e-48 187.2
Blo07g01194 BCT 1 108 EF-hand Containing Proteins AT3G43810 85.2 3.6e-43 171.0
Blo07g01195 . 37 149 EF-hand Containing Proteins AT3G43810 81.4 8.1e-43 169.9
Blo09g00340 . 37 149 EF-hand Containing Proteins AT3G43810 81.4 8.1e-43 169.9
Blo09g00341 . 99 211 EF-hand Containing Proteins AT3G43810 81.4 8.1e-43 169.9
Blo12g00644 . 363 475 EF-hand Containing Proteins AT3G43810 81.4 1.4e-42 169.1
Blo08g00141 BCT 713 825 EF-hand Containing Proteins AT3G43810 80.5 1.8e-42 168.7
Blo14g00306 BCT 1 148 EF-hand Containing Proteins AT2G41090 56.8 4.9e-40 161.4
Blo04g01047 . 36 168 EF-hand Containing Proteins AT4G37010 70.7 6.3e-47 184.1
Blo06g00945 . 805 958 EF-hand Containing Proteins AT3G25600 62.3 3.8e-46 181.4
Blo02g00978 BCT 7 161 EF-hand Containing Proteins AT1G32250 74.1 3.0e-62 235.0
Blo03g00105 BCT 1 162 EF-hand Containing Proteins AT1G32250 67.9 1.8e-54 209.1
Blo02g00978 BCT 5 161 EF-hand Containing Proteins AT3G03000 75.8 2.1e-63 238.8
Blo03g00105 BCT 6 162 EF-hand Containing Proteins AT3G03000 72.6 1.4e-56 216.1
Blo01g00770 . 15 182 EF-hand Containing Proteins AT1G24620 63.7 1.3e-53 206.5
Blo11g00969 . 1 110 EF-hand Containing Proteins AT1G24620 68.2 3.4e-38 155.2
Blo07g00859 . 1 246 EF-hand Containing Proteins AT4G26470 64.8 5.5e-83 304.7
Blo01g01281 . 90 237 EF-hand Containing Proteins AT3G10300 81.1 1.7e-68 256.9
Blo12g00572 . 85 225 EF-hand Containing Proteins AT3G10300 83.1 5.6e-64 241.9
Blo03g01049 BCT 58 206 EF-hand Containing Proteins AT3G10300 51.7 8.9e-38 154.8
Blo03g01321 BCT 65 206 EF-hand Containing Proteins AT3G10300 51.4 2.6e-37 153.3
Blo01g01281 . 87 271 EF-hand Containing Proteins AT5G04170 83.2 1.7e-86 316.6
Blo12g00572 . 79 225 EF-hand Containing Proteins AT5G04170 81.8 8.1e-65 244.6
Blo03g01049 BCT 50 240 EF-hand Containing Proteins AT5G04170 55.5 1.4e-53 207.2
Blo03g01321 BCT 50 240 EF-hand Containing Proteins AT5G04170 53.9 1.6e-52 203.8
Blo05g00322 CCT 86 532 EF-hand Containing Proteins AT2G47860 57.2 2.2e-139 492.7
Blo10g00044 CCT 463 882 EF-hand Containing Proteins AT2G47860 56.3 4.1e-125 445.3
Blo03g01305 . 375 957 EF-hand Containing Proteins AT3G44820 60.1 4.7e-196 681.4
Blo04g01146 . 1 557 EF-hand Containing Proteins AT5G13260 51.0 4.3e-86 315.8
Blo11g00476 BCT 323 551 EF-hand Containing Proteins AT5G13260 51.3 4.8e-61 232.6
Blo17g00555 . 237 740 EF-hand Containing Proteins AT5G13960 65.9 9.7e-202 699.9
Blo11g00494 . 136 633 EF-hand Containing Proteins AT3G05310 56.5 1.4e-158 556.6
Blo10g00354 . 148 645 EF-hand Containing Proteins AT3G05310 56.3 5.7e-157 551.2
Blo10g00354 . 11 646 EF-hand Containing Proteins AT5G27540 71.6 2.9e-270 927.9
Blo11g00494 . 5 634 EF-hand Containing Proteins AT5G27540 70.4 2.8e-265 911.4
Blo11g00494 . 2 632 EF-hand Containing Proteins AT3G63150 61.6 9.7e-234 806.6
Blo10g00354 . 5 644 EF-hand Containing Proteins AT3G63150 60.3 1.1e-229 793.1
Blo01g00828 . 7 583 EF-hand Containing Proteins AT2G20800 68.2 5.3e-231 797.3
Blo02g00094 BCT,CCT 4 585 EF-hand Containing Proteins AT2G20800 68.5 4.5e-230 794.3
Blo04g00667 CCT 1 574 EF-hand Containing Proteins AT2G20800 60.6 5.0e-205 711.1
Blo01g00828 . 1 583 EF-hand Containing Proteins AT4G05020 70.5 2.4e-250 861.7
Blo02g00094 BCT,CCT 1 585 EF-hand Containing Proteins AT4G05020 64.4 7.9e-225 776.9
Blo04g00667 CCT 9 574 EF-hand Containing Proteins AT4G05020 62.1 9.3e-218 753.4
Blo04g00667 CCT 7 507 EF-hand Containing Proteins AT4G28220 68.4 1.4e-203 706.1
Blo01g00828 . 5 516 EF-hand Containing Proteins AT4G28220 63.7 3.1e-187 651.7
Blo02g00094 BCT,CCT 49 518 EF-hand Containing Proteins AT4G28220 62.1 8.8e-174 607.1
Blo09g00170 . 1 296 EF-hand Containing Proteins AT5G07440 85.5 2.0e-152 535.4
Blo11g00097 . 1 297 EF-hand Containing Proteins AT5G07440 76.8 6.5e-135 477.2
Blo01g01622 . 1 384 EF-hand Containing Proteins AT1G76250 58.5 3.6e-131 465.3
Blo03g00397 . 38 536 EF-hand Containing Proteins AT5G44620 54.2 3.0e-161 565.5
Blo03g00406 . 64 563 EF-hand Containing Proteins AT5G44620 54.4 3.3e-160 562.0
Blo02g00324 BCT 25 491 EF-hand Containing Proteins AT1G01280 78.0 7.7e-218 753.4
Blo04g00755 BCT 1 544 EF-hand Containing Proteins AT1G18890 80.9 2.5e-259 891.3
Blo16g00202 BCT 1 601 EF-hand Containing Proteins AT1G18890 73.5 8.4e-255 876.3
Blo08g00105 . 1 530 EF-hand Containing Proteins AT1G18890 66.5 1.5e-206 716.1
Blo07g01139 CCT 36 524 EF-hand Containing Proteins AT1G18890 71.0 4.0e-204 708.0
Blo12g00582 . 1 528 EF-hand Containing Proteins AT1G18890 65.5 2.8e-202 701.8
Blo01g01057 CCT 37 526 EF-hand Containing Proteins AT1G18890 69.2 5.0e-199 691.0
Blo12g00391 . 36 530 EF-hand Containing Proteins AT1G18890 68.2 2.4e-193 672.2
Blo11g00138 . 1 514 EF-hand Containing Proteins AT1G18890 64.1 2.7e-192 668.7
Blo12g00256 . 34 527 EF-hand Containing Proteins AT1G18890 59.6 2.3e-175 612.5
Blo14g00295 BCT 35 514 EF-hand Containing Proteins AT1G18890 57.1 2.2e-154 542.7
Blo09g00457 . 168 631 EF-hand Containing Proteins AT1G18890 58.8 1.1e-153 540.4
Blo08g00131 BCT 31 514 EF-hand Containing Proteins AT1G18890 55.6 1.0e-151 533.9
Blo07g01294 . 136 576 EF-hand Containing Proteins AT1G18890 58.9 7.3e-150 527.7
Blo07g00904 BCT 76 522 EF-hand Containing Proteins AT1G18890 57.1 2.4e-148 522.7
Blo13g00983 . 93 563 EF-hand Containing Proteins AT1G18890 54.1 5.6e-142 501.5
Blo01g01253 . 103 580 EF-hand Containing Proteins AT1G18890 52.4 8.1e-141 497.7
Blo16g00559 . 24 502 EF-hand Containing Proteins AT1G18890 52.5 1.7e-138 490.0
Blo09g00453 . 146 637 EF-hand Containing Proteins AT1G18890 51.6 2.4e-137 486.1
Blo12g00874 . 71 512 EF-hand Containing Proteins AT1G18890 51.8 3.2e-137 485.7
Blo15g00417 . 102 545 EF-hand Containing Proteins AT1G18890 55.2 5.1e-135 478.4
Blo10g00833 BCT 79 521 EF-hand Containing Proteins AT1G18890 52.7 1.9e-134 476.5
Blo04g00371 . 112 551 EF-hand Containing Proteins AT1G18890 53.8 1.9e-129 459.9
Blo02g00160 . 103 546 EF-hand Containing Proteins AT1G18890 53.8 3.0e-127 452.6
Blo12g00800 . 26 470 EF-hand Containing Proteins AT1G18890 50.8 7.4e-126 448.0
Blo02g01128 . 55 501 EF-hand Containing Proteins AT1G18890 50.2 3.7e-125 445.7
Blo12g00800 . 8 494 EF-hand Containing Proteins AT1G35670 81.1 2.6e-202 701.8
Blo16g00559 . 24 530 EF-hand Containing Proteins AT1G35670 68.8 5.0e-190 661.0
Blo15g00417 . 94 564 EF-hand Containing Proteins AT1G35670 65.0 9.9e-162 567.0
Blo09g00457 . 155 623 EF-hand Containing Proteins AT1G35670 61.1 2.9e-161 565.5
Blo02g00160 . 95 569 EF-hand Containing Proteins AT1G35670 69.5 1.1e-160 563.5
Blo07g01294 . 107 598 EF-hand Containing Proteins AT1G35670 57.1 9.3e-160 560.5
Blo04g00371 . 97 577 EF-hand Containing Proteins AT1G35670 66.9 1.2e-159 560.1
Blo13g00467 . 398 915 EF-hand Containing Proteins AT1G35670 58.2 5.3e-155 544.7
Blo09g00453 . 137 631 EF-hand Containing Proteins AT1G35670 53.9 2.0e-146 516.2
Blo01g01253 . 108 595 EF-hand Containing Proteins AT1G35670 53.8 1.3e-145 513.5
Blo08g00131 BCT 51 515 EF-hand Containing Proteins AT1G35670 54.8 8.7e-142 500.7
Blo14g00295 BCT 51 515 EF-hand Containing Proteins AT1G35670 53.5 5.7e-141 498.0
Blo07g00904 BCT 50 516 EF-hand Containing Proteins AT1G35670 52.7 5.0e-137 485.0
Blo02g01128 . 43 501 EF-hand Containing Proteins AT1G35670 63.6 1.9e-136 483.0
Blo03g00231 . 59 418 EF-hand Containing Proteins AT1G35670 62.5 7.7e-130 461.1
Blo04g00755 BCT 58 525 EF-hand Containing Proteins AT1G35670 50.3 2.2e-129 459.5
Blo12g00874 . 75 513 EF-hand Containing Proteins AT1G35670 52.0 2.5e-128 456.1
Blo10g00833 BCT 65 423 EF-hand Containing Proteins AT1G35670 57.9 4.5e-122 435.3
Blo07g00904 BCT 1 467 EF-hand Containing Proteins AT1G50700 75.2 7.2e-202 700.3
Blo10g00833 BCT 54 471 EF-hand Containing Proteins AT1G50700 76.8 1.8e-192 669.1
Blo13g00983 . 85 514 EF-hand Containing Proteins AT1G50700 73.7 1.9e-186 649.0
Blo12g00874 . 62 463 EF-hand Containing Proteins AT1G50700 71.9 8.3e-174 607.1
Blo14g00295 BCT 1 465 EF-hand Containing Proteins AT1G50700 63.5 6.6e-171 597.4
Blo08g00131 BCT 1 465 EF-hand Containing Proteins AT1G50700 63.8 8.6e-171 597.0
Blo07g01294 . 89 531 EF-hand Containing Proteins AT1G50700 57.5 2.6e-151 532.3
Blo09g00457 . 155 559 EF-hand Containing Proteins AT1G50700 62.7 1.3e-150 530.0
Blo03g00231 . 1 422 EF-hand Containing Proteins AT1G50700 62.5 9.3e-149 523.9
Blo16g00559 . 17 427 EF-hand Containing Proteins AT1G50700 60.8 4.9e-142 501.5
Blo09g00453 . 137 599 EF-hand Containing Proteins AT1G50700 52.9 2.7e-140 495.7
Blo02g01128 . 49 406 EF-hand Containing Proteins AT1G50700 66.2 1.3e-139 493.4
Blo04g00371 . 83 461 EF-hand Containing Proteins AT1G50700 61.7 3.3e-138 488.8
Blo01g01253 . 108 532 EF-hand Containing Proteins AT1G50700 56.0 9.6e-138 487.3
Blo15g00417 . 94 497 EF-hand Containing Proteins AT1G50700 58.2 1.4e-136 483.4
Blo04g00755 BCT 63 453 EF-hand Containing Proteins AT1G50700 58.7 2.0e-135 479.6
Blo08g00105 . 43 448 EF-hand Containing Proteins AT1G50700 56.2 1.7e-134 476.5
Blo12g00800 . 21 379 EF-hand Containing Proteins AT1G50700 63.2 7.1e-133 471.1
Blo12g00582 . 13 447 EF-hand Containing Proteins AT1G50700 53.2 3.5e-132 468.8
Blo16g00202 BCT 63 510 EF-hand Containing Proteins AT1G50700 52.2 3.9e-131 465.3
Blo07g01139 CCT 34 444 EF-hand Containing Proteins AT1G50700 54.5 1.9e-130 463.0
Blo13g00467 . 398 848 EF-hand Containing Proteins AT1G50700 52.3 3.3e-130 462.2
Blo02g00160 . 95 453 EF-hand Containing Proteins AT1G50700 61.8 1.6e-129 459.9
Blo11g00138 . 1 444 EF-hand Containing Proteins AT1G50700 50.3 5.3e-128 454.9
Blo12g00256 . 48 444 EF-hand Containing Proteins AT1G50700 54.4 1.5e-127 453.4
Blo12g00391 . 31 457 EF-hand Containing Proteins AT1G50700 51.4 9.3e-125 444.1
Blo01g01057 CCT 45 444 EF-hand Containing Proteins AT1G50700 54.0 1.2e-124 443.7
Blo07g00904 BCT 62 522 EF-hand Containing Proteins AT1G61950 74.2 4.7e-205 711.1
Blo13g00983 . 65 562 EF-hand Containing Proteins AT1G61950 68.3 8.1e-197 683.7
Blo10g00833 BCT 66 522 EF-hand Containing Proteins AT1G61950 68.8 9.9e-187 650.2
Blo12g00874 . 63 511 EF-hand Containing Proteins AT1G61950 66.4 2.1e-181 632.5
Blo14g00295 BCT 61 512 EF-hand Containing Proteins AT1G61950 66.2 4.5e-179 624.8
Blo08g00131 BCT 61 512 EF-hand Containing Proteins AT1G61950 65.6 2.9e-178 622.1
Blo07g01294 . 124 576 EF-hand Containing Proteins AT1G61950 58.9 6.7e-159 557.8
Blo09g00457 . 152 605 EF-hand Containing Proteins AT1G61950 59.4 5.7e-158 554.7
Blo03g00231 . 63 498 EF-hand Containing Proteins AT1G61950 59.0 2.6e-147 519.2
Blo04g00755 BCT 41 502 EF-hand Containing Proteins AT1G61950 55.8 7.7e-147 517.7
Blo01g01253 . 82 578 EF-hand Containing Proteins AT1G61950 51.9 1.7e-146 516.5
Blo09g00453 . 134 638 EF-hand Containing Proteins AT1G61950 51.7 3.8e-146 515.4
Blo15g00417 . 94 543 EF-hand Containing Proteins AT1G61950 56.9 5.0e-146 515.0
Blo16g00559 . 16 500 EF-hand Containing Proteins AT1G61950 53.0 1.9e-145 513.1
Blo02g01128 . 49 499 EF-hand Containing Proteins AT1G61950 55.3 3.9e-143 505.4
Blo13g00467 . 395 894 EF-hand Containing Proteins AT1G61950 52.0 9.7e-142 500.7
Blo16g00202 BCT 59 559 EF-hand Containing Proteins AT1G61950 50.4 2.4e-140 496.1
Blo08g00105 . 52 497 EF-hand Containing Proteins AT1G61950 52.8 4.1e-140 495.4
Blo07g01139 CCT 41 493 EF-hand Containing Proteins AT1G61950 52.6 4.7e-136 481.9
Blo04g00371 . 107 549 EF-hand Containing Proteins AT1G61950 53.0 2.3e-135 479.6
Blo12g00582 . 42 496 EF-hand Containing Proteins AT1G61950 51.3 6.7e-135 478.0
Blo11g00138 . 39 493 EF-hand Containing Proteins AT1G61950 51.5 2.0e-134 476.5
Blo02g00160 . 95 544 EF-hand Containing Proteins AT1G61950 53.8 2.0e-134 476.5
Blo12g00256 . 48 492 EF-hand Containing Proteins AT1G61950 51.8 3.3e-134 475.7
Blo12g00800 . 27 468 EF-hand Containing Proteins AT1G61950 51.8 7.0e-132 468.0
Blo01g01057 CCT 37 493 EF-hand Containing Proteins AT1G61950 51.0 7.2e-129 458.0
Blo12g00391 . 37 506 EF-hand Containing Proteins AT1G61950 50.1 1.6e-128 456.8
Blo04g00755 BCT 1 544 EF-hand Containing Proteins AT1G74740 79.9 1.6e-253 872.1
Blo16g00202 BCT 1 601 EF-hand Containing Proteins AT1G74740 72.8 6.8e-249 856.7
Blo07g01139 CCT 35 524 EF-hand Containing Proteins AT1G74740 71.4 1.0e-207 719.9
Blo08g00105 . 1 530 EF-hand Containing Proteins AT1G74740 66.8 5.0e-207 717.6
Blo12g00582 . 1 528 EF-hand Containing Proteins AT1G74740 66.4 4.6e-205 711.1
Blo01g01057 CCT 36 526 EF-hand Containing Proteins AT1G74740 69.7 4.5e-200 694.5
Blo12g00391 . 36 530 EF-hand Containing Proteins AT1G74740 69.0 3.9e-196 681.4
Blo11g00138 . 1 514 EF-hand Containing Proteins AT1G74740 65.2 2.0e-195 679.1
Blo12g00256 . 1 527 EF-hand Containing Proteins AT1G74740 55.1 5.2e-172 601.3
Blo14g00295 BCT 57 514 EF-hand Containing Proteins AT1G74740 58.0 9.2e-153 537.3
Blo08g00131 BCT 57 514 EF-hand Containing Proteins AT1G74740 57.1 5.6e-150 528.1
Blo09g00457 . 153 629 EF-hand Containing Proteins AT1G74740 55.7 2.3e-148 522.7
Blo07g00904 BCT 76 522 EF-hand Containing Proteins AT1G74740 56.3 5.8e-147 518.1
Blo07g01294 . 136 576 EF-hand Containing Proteins AT1G74740 57.8 1.7e-146 516.5
Blo01g01253 . 106 580 EF-hand Containing Proteins AT1G74740 52.5 6.6e-143 504.6
Blo13g00983 . 93 563 EF-hand Containing Proteins AT1G74740 53.5 3.6e-141 498.8
Blo16g00559 . 21 502 EF-hand Containing Proteins AT1G74740 52.2 5.4e-137 485.0
Blo12g00874 . 71 512 EF-hand Containing Proteins AT1G74740 51.1 1.0e-135 480.7
Blo15g00417 . 100 545 EF-hand Containing Proteins AT1G74740 55.1 2.3e-135 479.6
Blo09g00453 . 146 637 EF-hand Containing Proteins AT1G74740 50.6 4.3e-134 475.3
Blo10g00833 BCT 79 521 EF-hand Containing Proteins AT1G74740 51.6 6.8e-132 468.0
Blo13g00467 . 407 896 EF-hand Containing Proteins AT1G74740 50.2 7.1e-129 458.0
Blo04g00371 . 94 551 EF-hand Containing Proteins AT1G74740 52.2 2.7e-128 456.1
Blo02g00160 . 101 546 EF-hand Containing Proteins AT1G74740 52.7 5.3e-124 441.8
Blo03g00231 . 48 498 EF-hand Containing Proteins AT1G74740 50.8 2.1e-120 429.9
Blo07g00432 . 29 308 EF-hand Containing Proteins AT1G74740 50.4 1.7e-77 287.3
Blo07g00904 BCT 231 517 EF-hand Containing Proteins AT1G76040 68.6 3.1e-111 398.7
Blo12g00874 . 230 520 EF-hand Containing Proteins AT1G76040 68.0 1.2e-110 396.7
Blo13g00983 . 281 563 EF-hand Containing Proteins AT1G76040 67.8 2.0e-110 396.0
Blo14g00295 BCT 229 524 EF-hand Containing Proteins AT1G76040 58.8 1.7e-98 356.3
Blo10g00833 BCT 235 525 EF-hand Containing Proteins AT1G76040 60.8 5.1e-98 354.8
Blo08g00131 BCT 229 524 EF-hand Containing Proteins AT1G76040 58.4 1.5e-97 353.2
Blo09g00457 . 323 617 EF-hand Containing Proteins AT1G76040 55.4 1.9e-92 336.3
Blo16g00559 . 191 512 EF-hand Containing Proteins AT1G76040 57.0 1.0e-90 330.5
Blo07g01294 . 295 576 EF-hand Containing Proteins AT1G76040 56.2 5.6e-89 324.7
Blo13g00467 . 612 906 EF-hand Containing Proteins AT1G76040 60.5 1.4e-87 320.1
Blo15g00417 . 262 555 EF-hand Containing Proteins AT1G76040 58.6 8.9e-87 317.4
Blo09g00453 . 364 652 EF-hand Containing Proteins AT1G76040 52.4 2.7e-83 305.8
Blo04g00755 BCT 218 504 EF-hand Containing Proteins AT1G76040 52.4 2.3e-82 302.8
Blo12g00800 . 186 470 EF-hand Containing Proteins AT1G76040 58.4 7.3e-81 297.7
Blo03g00231 . 230 512 EF-hand Containing Proteins AT1G76040 58.3 4.7e-80 295.0
Blo02g01128 . 216 501 EF-hand Containing Proteins AT1G76040 57.7 3.1e-79 292.4
Blo04g00371 . 267 555 EF-hand Containing Proteins AT1G76040 55.5 4.2e-76 282.0
Blo02g00160 . 262 546 EF-hand Containing Proteins AT1G76040 54.2 9.6e-73 270.8
Blo15g00417 . 1 565 EF-hand Containing Proteins AT2G17290 78.4 3.0e-236 814.7
Blo02g00160 . 1 569 EF-hand Containing Proteins AT2G17290 80.7 6.7e-228 786.9
Blo13g00467 . 336 916 EF-hand Containing Proteins AT2G17290 68.4 7.9e-213 736.9
Blo07g01294 . 128 597 EF-hand Containing Proteins AT2G17290 62.9 9.8e-171 597.0
Blo12g00800 . 19 491 EF-hand Containing Proteins AT2G17290 70.8 1.1e-169 593.6
Blo04g00371 . 100 577 EF-hand Containing Proteins AT2G17290 70.9 1.9e-169 592.8
Blo09g00457 . 156 617 EF-hand Containing Proteins AT2G17290 63.2 3.5e-168 588.6
Blo16g00559 . 23 517 EF-hand Containing Proteins AT2G17290 61.6 2.3e-167 585.9
Blo01g01253 . 95 592 EF-hand Containing Proteins AT2G17290 56.8 1.2e-155 547.0
Blo09g00453 . 138 631 EF-hand Containing Proteins AT2G17290 56.7 6.0e-152 534.6
Blo14g00295 BCT 62 515 EF-hand Containing Proteins AT2G17290 57.3 3.6e-149 525.4
Blo08g00131 BCT 62 515 EF-hand Containing Proteins AT2G17290 57.5 4.7e-149 525.0
Blo07g00904 BCT 49 516 EF-hand Containing Proteins AT2G17290 55.1 4.2e-145 511.9
Blo02g01128 . 49 501 EF-hand Containing Proteins AT2G17290 65.8 2.1e-141 499.6
Blo13g00983 . 63 563 EF-hand Containing Proteins AT2G17290 51.6 9.9e-139 490.7
Blo03g00231 . 63 418 EF-hand Containing Proteins AT2G17290 65.7 3.8e-138 488.8
Blo12g00874 . 63 513 EF-hand Containing Proteins AT2G17290 54.2 1.6e-136 483.4
Blo10g00833 BCT 53 423 EF-hand Containing Proteins AT2G17290 59.5 5.8e-131 464.9
Blo08g00105 . 57 498 EF-hand Containing Proteins AT2G17290 51.8 2.1e-128 456.4
Blo12g00582 . 36 497 EF-hand Containing Proteins AT2G17290 50.9 6.0e-128 454.9
Blo04g00755 BCT 59 503 EF-hand Containing Proteins AT2G17290 52.9 9.6e-126 447.6
Blo11g00138 . 52 494 EF-hand Containing Proteins AT2G17290 51.1 3.4e-123 439.1
Blo07g01139 CCT 48 494 EF-hand Containing Proteins AT2G17290 50.1 1.9e-121 433.3
Blo04g00322 . 109 287 EF-hand Containing Proteins AT2G17290 52.2 1.5e-46 184.5
Blo16g00080 . 62 539 EF-hand Containing Proteins AT2G17890 86.2 4.4e-238 820.8
Blo06g00303 . 90 514 EF-hand Containing Proteins AT2G17890 69.5 9.6e-185 643.7
Blo09g00365 BCT 87 539 EF-hand Containing Proteins AT2G17890 51.2 2.0e-121 433.3
Blo03g00231 . 70 422 EF-hand Containing Proteins AT2G17890 50.3 4.0e-98 355.9
Blo12g00256 . 1 520 EF-hand Containing Proteins AT2G31500 65.0 6.3e-200 694.1
Blo08g00105 . 1 523 EF-hand Containing Proteins AT2G31500 57.0 2.2e-176 615.9
Blo12g00582 . 42 522 EF-hand Containing Proteins AT2G31500 61.2 1.9e-175 612.8
Blo11g00138 . 39 510 EF-hand Containing Proteins AT2G31500 60.4 2.6e-169 592.4
Blo04g00755 BCT 41 528 EF-hand Containing Proteins AT2G31500 57.9 9.8e-169 590.5
Blo07g01139 CCT 1 519 EF-hand Containing Proteins AT2G31500 55.3 8.6e-165 577.4
Blo01g01057 CCT 1 526 EF-hand Containing Proteins AT2G31500 53.9 2.0e-161 566.2
Blo16g00202 BCT 59 585 EF-hand Containing Proteins AT2G31500 51.9 4.1e-159 558.5
Blo12g00391 . 37 528 EF-hand Containing Proteins AT2G31500 56.4 1.1e-156 550.4
Blo08g00131 BCT 58 514 EF-hand Containing Proteins AT2G31500 51.1 3.7e-131 465.7
Blo15g00417 . 106 562 EF-hand Containing Proteins AT2G31500 50.7 2.5e-124 443.0
Blo02g00160 . 107 566 EF-hand Containing Proteins AT2G31500 51.0 2.1e-118 423.3
Blo04g00371 . 112 551 EF-hand Containing Proteins AT2G31500 51.2 3.0e-117 419.5
Blo03g00231 . 1 422 EF-hand Containing Proteins AT2G31500 50.2 2.9e-112 402.9
Blo09g00457 . 138 544 EF-hand Containing Proteins AT2G35890 70.1 6.7e-169 590.9
Blo07g01294 . 110 516 EF-hand Containing Proteins AT2G35890 64.7 7.2e-155 544.3
Blo09g00453 . 124 584 EF-hand Containing Proteins AT2G35890 57.8 2.9e-148 522.3
Blo04g00371 . 87 459 EF-hand Containing Proteins AT2G35890 67.0 6.6e-148 521.2
Blo01g01253 . 104 517 EF-hand Containing Proteins AT2G35890 60.6 1.7e-143 506.5
Blo16g00559 . 24 382 EF-hand Containing Proteins AT2G35890 66.0 3.1e-137 485.7
Blo12g00800 . 18 377 EF-hand Containing Proteins AT2G35890 64.7 2.0e-136 483.0
Blo02g00160 . 62 453 EF-hand Containing Proteins AT2G35890 60.7 1.1e-134 477.2
Blo15g00417 . 90 451 EF-hand Containing Proteins AT2G35890 64.6 2.4e-134 476.1
Blo08g00131 BCT 70 450 EF-hand Containing Proteins AT2G35890 59.9 2.0e-133 473.0
Blo14g00295 BCT 70 450 EF-hand Containing Proteins AT2G35890 58.9 3.0e-132 469.2
Blo13g00467 . 387 799 EF-hand Containing Proteins AT2G35890 58.1 8.0e-130 461.1
Blo07g00904 BCT 60 452 EF-hand Containing Proteins AT2G35890 53.0 1.5e-123 440.3
Blo08g00105 . 43 433 EF-hand Containing Proteins AT2G35890 54.3 1.6e-122 436.8
Blo03g00231 . 63 422 EF-hand Containing Proteins AT2G35890 58.1 1.4e-121 433.7
Blo12g00582 . 42 427 EF-hand Containing Proteins AT2G35890 54.0 2.6e-120 429.5
Blo02g01128 . 49 406 EF-hand Containing Proteins AT2G35890 56.1 4.4e-120 428.7
Blo13g00983 . 81 499 EF-hand Containing Proteins AT2G35890 50.4 9.9e-120 427.6
Blo04g00755 BCT 56 438 EF-hand Containing Proteins AT2G35890 54.1 1.7e-119 426.8
Blo12g00874 . 71 440 EF-hand Containing Proteins AT2G35890 53.6 2.4e-118 422.9
Blo11g00138 . 39 432 EF-hand Containing Proteins AT2G35890 51.4 2.3e-116 416.4
Blo10g00833 BCT 64 456 EF-hand Containing Proteins AT2G35890 50.5 2.3e-116 416.4
Blo07g01139 CCT 27 429 EF-hand Containing Proteins AT2G35890 52.2 3.3e-115 412.5
Blo01g01057 CCT 49 429 EF-hand Containing Proteins AT2G35890 52.6 3.6e-114 409.1
Blo12g00391 . 25 442 EF-hand Containing Proteins AT2G35890 50.5 1.8e-113 406.8
Blo09g00114 . 26 303 EF-hand Containing Proteins AT2G35890 50.4 6.7e-76 282.0
Blo04g00322 . 90 287 EF-hand Containing Proteins AT2G35890 52.6 6.7e-52 202.2
Blo07g01294 . 1 587 EF-hand Containing Proteins AT2G38910 74.8 9.9e-254 872.8
Blo09g00453 . 1 631 EF-hand Containing Proteins AT2G38910 67.5 2.8e-232 801.6
Blo09g00457 . 138 605 EF-hand Containing Proteins AT2G38910 74.4 3.0e-210 728.4
Blo04g00371 . 1 569 EF-hand Containing Proteins AT2G38910 63.2 6.1e-203 704.1
Blo01g01253 . 104 583 EF-hand Containing Proteins AT2G38910 65.8 1.8e-186 649.4
Blo15g00417 . 78 557 EF-hand Containing Proteins AT2G38910 65.4 2.7e-182 635.6
Blo16g00559 . 24 507 EF-hand Containing Proteins AT2G38910 64.1 1.0e-181 633.6
Blo13g00467 . 395 908 EF-hand Containing Proteins AT2G38910 59.7 5.1e-173 604.7
Blo08g00131 BCT 54 512 EF-hand Containing Proteins AT2G38910 62.1 6.2e-171 597.8
Blo14g00295 BCT 59 512 EF-hand Containing Proteins AT2G38910 61.5 1.4e-170 596.7
Blo02g00160 . 79 554 EF-hand Containing Proteins AT2G38910 62.3 4.1e-167 585.1
Blo12g00800 . 18 475 EF-hand Containing Proteins AT2G38910 62.7 2.7e-166 582.4
Blo07g00904 BCT 62 514 EF-hand Containing Proteins AT2G38910 61.1 2.3e-165 579.3
Blo13g00983 . 81 561 EF-hand Containing Proteins AT2G38910 57.0 1.7e-160 563.1
Blo12g00874 . 59 510 EF-hand Containing Proteins AT2G38910 57.4 6.6e-157 551.2
Blo10g00833 BCT 66 500 EF-hand Containing Proteins AT2G38910 57.7 1.0e-149 527.3
Blo07g01139 CCT 25 492 EF-hand Containing Proteins AT2G38910 53.8 2.4e-143 506.1
Blo08g00105 . 57 496 EF-hand Containing Proteins AT2G38910 54.3 4.6e-142 501.9
Blo04g00755 BCT 61 501 EF-hand Containing Proteins AT2G38910 55.0 7.9e-142 501.1
Blo03g00231 . 60 499 EF-hand Containing Proteins AT2G38910 56.1 1.5e-140 496.9
Blo12g00582 . 55 495 EF-hand Containing Proteins AT2G38910 54.0 2.5e-140 496.1
Blo11g00138 . 52 492 EF-hand Containing Proteins AT2G38910 53.2 5.3e-138 488.4
Blo02g01128 . 46 502 EF-hand Containing Proteins AT2G38910 52.5 2.6e-137 486.1
Blo01g01057 CCT 43 492 EF-hand Containing Proteins AT2G38910 52.2 6.4e-136 481.5
Blo12g00391 . 43 505 EF-hand Containing Proteins AT2G38910 51.1 4.6e-134 475.3
Blo12g00256 . 53 492 EF-hand Containing Proteins AT2G38910 50.9 3.9e-133 472.2
Blo04g00322 . 90 287 EF-hand Containing Proteins AT2G38910 50.2 1.1e-47 188.3
Blo12g00582 . 1 528 EF-hand Containing Proteins AT2G41860 75.8 4.2e-235 810.8
Blo11g00138 . 1 509 EF-hand Containing Proteins AT2G41860 74.7 3.0e-225 778.1
Blo08g00105 . 1 526 EF-hand Containing Proteins AT2G41860 72.1 4.0e-225 777.7
Blo04g00755 BCT 1 531 EF-hand Containing Proteins AT2G41860 64.3 2.9e-199 691.8
Blo16g00202 BCT 1 588 EF-hand Containing Proteins AT2G41860 58.5 1.8e-193 672.5
Blo07g01139 CCT 1 522 EF-hand Containing Proteins AT2G41860 61.9 3.5e-189 658.3
Blo01g01057 CCT 1 522 EF-hand Containing Proteins AT2G41860 60.8 2.6e-184 642.1
Blo12g00256 . 1 522 EF-hand Containing Proteins AT2G41860 58.2 6.4e-183 637.5
Blo12g00391 . 1 530 EF-hand Containing Proteins AT2G41860 59.7 2.1e-178 622.5
Blo14g00295 BCT 1 527 EF-hand Containing Proteins AT2G41860 50.8 5.3e-145 511.5
Blo09g00457 . 156 605 EF-hand Containing Proteins AT2G41860 55.2 1.3e-143 506.9
Blo08g00131 BCT 62 527 EF-hand Containing Proteins AT2G41860 54.9 8.4e-143 504.2
Blo07g00904 BCT 49 522 EF-hand Containing Proteins AT2G41860 52.9 1.1e-142 503.8
Blo07g01294 . 122 576 EF-hand Containing Proteins AT2G41860 53.4 6.1e-141 498.0
Blo01g01253 . 106 580 EF-hand Containing Proteins AT2G41860 51.0 3.4e-136 482.3
Blo13g00983 . 85 563 EF-hand Containing Proteins AT2G41860 51.9 5.9e-136 481.5
Blo10g00833 BCT 40 521 EF-hand Containing Proteins AT2G41860 50.1 3.2e-134 475.7
Blo12g00874 . 70 512 EF-hand Containing Proteins AT2G41860 51.7 7.9e-133 471.1
Blo16g00559 . 31 502 EF-hand Containing Proteins AT2G41860 51.3 1.4e-132 470.3
Blo15g00417 . 88 545 EF-hand Containing Proteins AT2G41860 52.1 1.5e-131 466.8
Blo02g00160 . 89 546 EF-hand Containing Proteins AT2G41860 50.1 6.3e-122 434.9
Blo03g00231 . 63 498 EF-hand Containing Proteins AT2G41860 51.1 4.7e-117 418.7
Blo04g00371 . 1 575 EF-hand Containing Proteins AT3G10660 68.4 2.0e-215 745.7
Blo07g01294 . 1 596 EF-hand Containing Proteins AT3G10660 59.4 2.3e-206 715.7
Blo09g00457 . 1 616 EF-hand Containing Proteins AT3G10660 57.2 7.8e-199 690.6
Blo09g00453 . 1 630 EF-hand Containing Proteins AT3G10660 55.7 1.5e-186 649.8
Blo15g00417 . 94 563 EF-hand Containing Proteins AT3G10660 68.0 6.6e-174 607.8
Blo01g01253 . 94 581 EF-hand Containing Proteins AT3G10660 62.1 4.3e-173 605.1
Blo02g00160 . 95 567 EF-hand Containing Proteins AT3G10660 72.7 6.2e-172 601.3
Blo12g00800 . 18 470 EF-hand Containing Proteins AT3G10660 73.3 3.4e-170 595.5
Blo16g00559 . 15 517 EF-hand Containing Proteins AT3G10660 61.8 1.7e-169 593.2
Blo13g00467 . 396 914 EF-hand Containing Proteins AT3G10660 60.1 1.4e-163 573.5
Blo08g00131 BCT 35 522 EF-hand Containing Proteins AT3G10660 56.8 4.0e-155 545.4
Blo14g00295 BCT 62 522 EF-hand Containing Proteins AT3G10660 58.8 5.3e-155 545.0
Blo07g00904 BCT 60 517 EF-hand Containing Proteins AT3G10660 55.2 2.6e-146 516.2
Blo02g01128 . 49 501 EF-hand Containing Proteins AT3G10660 64.5 3.3e-141 499.2
Blo12g00874 . 59 513 EF-hand Containing Proteins AT3G10660 55.0 2.8e-140 496.1
Blo13g00983 . 83 563 EF-hand Containing Proteins AT3G10660 51.9 1.1e-139 494.2
Blo03g00231 . 63 422 EF-hand Containing Proteins AT3G10660 65.3 1.5e-138 490.3
Blo07g01139 CCT 25 516 EF-hand Containing Proteins AT3G10660 52.0 1.2e-135 480.7
Blo04g00755 BCT 63 504 EF-hand Containing Proteins AT3G10660 54.6 4.8e-132 468.8
Blo08g00105 . 57 499 EF-hand Containing Proteins AT3G10660 52.8 6.3e-132 468.4
Blo12g00582 . 55 498 EF-hand Containing Proteins AT3G10660 52.9 1.4e-131 467.2
Blo10g00833 BCT 64 521 EF-hand Containing Proteins AT3G10660 50.9 1.4e-131 467.2
Blo11g00138 . 52 495 EF-hand Containing Proteins AT3G10660 51.8 6.1e-127 451.8
Blo01g01057 CCT 47 516 EF-hand Containing Proteins AT3G10660 50.4 6.1e-127 451.8
Blo12g00391 . 27 508 EF-hand Containing Proteins AT3G10660 50.1 2.5e-125 446.4
Blo06g00303 . 116 467 EF-hand Containing Proteins AT3G10660 50.6 4.1e-99 359.4
Blo04g00322 . 90 287 EF-hand Containing Proteins AT3G10660 56.0 3.1e-54 210.3
Blo07g00904 BCT 51 524 EF-hand Containing Proteins AT3G20410 81.5 1.6e-229 792.3
Blo13g00983 . 1 563 EF-hand Containing Proteins AT3G20410 66.4 1.1e-211 733.0
Blo10g00833 BCT 55 527 EF-hand Containing Proteins AT3G20410 75.1 1.8e-209 725.7
Blo12g00874 . 10 518 EF-hand Containing Proteins AT3G20410 65.1 3.3e-195 678.3
Blo08g00131 BCT 24 517 EF-hand Containing Proteins AT3G20410 65.8 5.3e-193 671.0
Blo14g00295 BCT 1 517 EF-hand Containing Proteins AT3G20410 62.2 2.6e-192 668.7
Blo09g00457 . 155 616 EF-hand Containing Proteins AT3G20410 60.5 8.6e-167 583.9
Blo07g01294 . 127 576 EF-hand Containing Proteins AT3G20410 59.9 4.4e-163 571.6
Blo03g00231 . 63 499 EF-hand Containing Proteins AT3G20410 61.6 1.2e-155 547.0
Blo02g01128 . 38 504 EF-hand Containing Proteins AT3G20410 58.5 7.5e-155 544.3
Blo15g00417 . 94 546 EF-hand Containing Proteins AT3G20410 57.5 3.2e-153 538.9
Blo16g00559 . 8 503 EF-hand Containing Proteins AT3G20410 54.1 5.4e-153 538.1
Blo01g01253 . 108 589 EF-hand Containing Proteins AT3G20410 54.5 6.0e-152 534.6
Blo08g00105 . 52 508 EF-hand Containing Proteins AT3G20410 55.4 3.9e-151 531.9
Blo04g00755 BCT 63 513 EF-hand Containing Proteins AT3G20410 56.0 7.3e-150 527.7
Blo04g00371 . 46 552 EF-hand Containing Proteins AT3G20410 52.5 8.1e-149 524.2
Blo16g00202 BCT 63 570 EF-hand Containing Proteins AT3G20410 50.8 2.9e-146 515.8
Blo12g00582 . 50 507 EF-hand Containing Proteins AT3G20410 54.1 1.1e-145 513.8
Blo12g00800 . 30 471 EF-hand Containing Proteins AT3G20410 56.2 3.9e-143 505.4
Blo07g01139 CCT 47 504 EF-hand Containing Proteins AT3G20410 53.5 1.9e-142 503.1
Blo12g00256 . 48 505 EF-hand Containing Proteins AT3G20410 53.1 2.5e-142 502.7
Blo11g00138 . 47 504 EF-hand Containing Proteins AT3G20410 52.8 2.1e-141 499.6
Blo02g00160 . 95 547 EF-hand Containing Proteins AT3G20410 54.6 8.1e-141 497.7
Blo01g01057 CCT 53 504 EF-hand Containing Proteins AT3G20410 53.5 2.9e-138 489.2
Blo12g00391 . 47 517 EF-hand Containing Proteins AT3G20410 51.5 1.9e-137 486.5
Blo07g01139 CCT 1 412 EF-hand Containing Proteins AT3G51850 85.0 1.1e-206 716.1
Blo01g01057 CCT 1 409 EF-hand Containing Proteins AT3G51850 82.2 8.0e-197 683.3
Blo12g00391 . 1 422 EF-hand Containing Proteins AT3G51850 80.9 1.4e-196 682.6
Blo04g00755 BCT 1 411 EF-hand Containing Proteins AT3G51850 70.0 3.4e-163 571.6
Blo12g00582 . 1 403 EF-hand Containing Proteins AT3G51850 67.9 6.4e-162 567.4
Blo11g00138 . 1 400 EF-hand Containing Proteins AT3G51850 68.2 1.1e-158 556.6
Blo08g00105 . 1 416 EF-hand Containing Proteins AT3G51850 65.8 1.1e-158 556.6
Blo16g00202 BCT 1 470 EF-hand Containing Proteins AT3G51850 60.7 4.9e-154 541.2
Blo12g00256 . 1 404 EF-hand Containing Proteins AT3G51850 57.1 1.9e-137 486.1
Blo14g00295 BCT 1 422 EF-hand Containing Proteins AT3G51850 56.9 5.8e-131 464.5
Blo08g00131 BCT 55 433 EF-hand Containing Proteins AT3G51850 59.6 1.3e-127 453.4
Blo09g00457 . 148 527 EF-hand Containing Proteins AT3G51850 58.7 1.1e-126 450.3
Blo04g00371 . 67 460 EF-hand Containing Proteins AT3G51850 54.2 9.0e-124 440.7
Blo01g01253 . 93 469 EF-hand Containing Proteins AT3G51850 56.0 6.5e-122 434.5
Blo07g01294 . 84 499 EF-hand Containing Proteins AT3G51850 51.9 1.1e-121 433.7
Blo07g00904 BCT 68 436 EF-hand Containing Proteins AT3G51850 56.9 1.2e-120 430.3
Blo02g00160 . 102 453 EF-hand Containing Proteins AT3G51850 59.7 3.3e-118 422.2
Blo16g00559 . 30 382 EF-hand Containing Proteins AT3G51850 57.5 9.6e-118 420.6
Blo03g00231 . 57 422 EF-hand Containing Proteins AT3G51850 56.3 3.7e-117 418.7
Blo15g00417 . 101 451 EF-hand Containing Proteins AT3G51850 59.0 8.2e-117 417.5
Blo12g00800 . 27 379 EF-hand Containing Proteins AT3G51850 56.1 8.2e-117 417.5
Blo02g01128 . 45 406 EF-hand Containing Proteins AT3G51850 55.2 4.5e-115 411.8
Blo13g00983 . 78 474 EF-hand Containing Proteins AT3G51850 51.6 1.1e-113 407.1
Blo12g00874 . 67 426 EF-hand Containing Proteins AT3G51850 52.2 1.3e-111 400.2
Blo13g00467 . 406 799 EF-hand Containing Proteins AT3G51850 51.5 3.7e-109 392.1
Blo12g00582 . 1 407 EF-hand Containing Proteins AT3G57530 80.2 4.8e-197 684.1
Blo11g00138 . 1 404 EF-hand Containing Proteins AT3G57530 77.1 3.3e-190 661.4
Blo08g00105 . 1 409 EF-hand Containing Proteins AT3G57530 74.9 4.7e-184 641.0
Blo04g00755 BCT 1 411 EF-hand Containing Proteins AT3G57530 66.7 2.6e-158 555.4
Blo07g01139 CCT 1 403 EF-hand Containing Proteins AT3G57530 65.5 1.1e-156 550.1
Blo01g01057 CCT 1 403 EF-hand Containing Proteins AT3G57530 63.7 4.3e-153 538.1
Blo12g00391 . 1 416 EF-hand Containing Proteins AT3G57530 62.8 5.2e-151 531.2
Blo12g00256 . 34 405 EF-hand Containing Proteins AT3G57530 64.8 2.0e-150 529.3
Blo16g00202 BCT 1 471 EF-hand Containing Proteins AT3G57530 57.9 6.4e-149 524.2
Blo09g00457 . 156 520 EF-hand Containing Proteins AT3G57530 59.3 8.1e-128 454.1
Blo14g00295 BCT 52 426 EF-hand Containing Proteins AT3G57530 58.7 2.6e-126 449.1
Blo07g01294 . 128 492 EF-hand Containing Proteins AT3G57530 57.9 1.7e-125 446.4
Blo08g00131 BCT 52 426 EF-hand Containing Proteins AT3G57530 57.9 1.4e-124 443.4
Blo04g00371 . 100 460 EF-hand Containing Proteins AT3G57530 58.3 1.2e-123 440.3
Blo01g01253 . 106 471 EF-hand Containing Proteins AT3G57530 56.9 2.7e-123 439.1
Blo16g00559 . 30 382 EF-hand Containing Proteins AT3G57530 58.6 4.6e-123 438.3
Blo12g00800 . 13 379 EF-hand Containing Proteins AT3G57530 57.3 3.0e-122 435.6
Blo07g00904 BCT 64 428 EF-hand Containing Proteins AT3G57530 55.5 1.4e-119 426.8
Blo02g00160 . 87 453 EF-hand Containing Proteins AT3G57530 57.3 1.4e-119 426.8
Blo03g00231 . 63 422 EF-hand Containing Proteins AT3G57530 57.9 1.5e-118 423.3
Blo15g00417 . 94 449 EF-hand Containing Proteins AT3G57530 56.9 3.4e-118 422.2
Blo10g00833 BCT 68 432 EF-hand Containing Proteins AT3G57530 53.6 1.4e-116 416.8
Blo02g01128 . 49 404 EF-hand Containing Proteins AT3G57530 55.7 3.2e-116 415.6
Blo12g00874 . 70 427 EF-hand Containing Proteins AT3G57530 53.9 1.1e-113 407.1
Blo13g00983 . 93 475 EF-hand Containing Proteins AT3G57530 52.1 4.3e-113 405.2
Blo13g00467 . 406 799 EF-hand Containing Proteins AT3G57530 52.5 5.6e-113 404.8
Blo07g00904 BCT 54 520 EF-hand Containing Proteins AT4G04700 59.9 3.0e-155 545.4
Blo10g00833 BCT 67 526 EF-hand Containing Proteins AT4G04700 59.4 2.1e-148 522.7
Blo13g00983 . 79 570 EF-hand Containing Proteins AT4G04700 56.0 1.5e-146 516.5
Blo12g00874 . 62 511 EF-hand Containing Proteins AT4G04700 57.5 2.6e-146 515.8
Blo08g00131 BCT 62 512 EF-hand Containing Proteins AT4G04700 54.1 1.1e-136 483.8
Blo14g00295 BCT 62 512 EF-hand Containing Proteins AT4G04700 53.2 2.7e-135 479.2
Blo03g00231 . 63 497 EF-hand Containing Proteins AT4G04700 51.0 2.2e-113 406.4
Blo02g00160 . 95 453 EF-hand Containing Proteins AT4G04700 50.4 9.9e-98 354.4
Blo07g00904 BCT 60 519 EF-hand Containing Proteins AT4G04710 66.6 2.9e-177 618.6
Blo13g00983 . 78 570 EF-hand Containing Proteins AT4G04710 62.6 1.2e-170 596.7
Blo10g00833 BCT 64 526 EF-hand Containing Proteins AT4G04710 63.7 1.9e-165 579.3
Blo14g00295 BCT 62 521 EF-hand Containing Proteins AT4G04710 58.1 2.9e-153 538.9
Blo08g00131 BCT 62 521 EF-hand Containing Proteins AT4G04710 58.4 1.1e-152 537.0
Blo12g00874 . 62 520 EF-hand Containing Proteins AT4G04710 57.3 2.0e-149 526.2
Blo07g01294 . 124 592 EF-hand Containing Proteins AT4G04710 54.2 2.7e-143 505.8
Blo09g00457 . 154 605 EF-hand Containing Proteins AT4G04710 56.4 4.4e-141 498.4
Blo01g01253 . 108 580 EF-hand Containing Proteins AT4G04710 51.8 8.0e-135 477.6
Blo16g00559 . 9 502 EF-hand Containing Proteins AT4G04710 50.6 5.9e-130 461.5
Blo15g00417 . 88 545 EF-hand Containing Proteins AT4G04710 52.5 5.5e-128 454.9
Blo12g00800 . 6 470 EF-hand Containing Proteins AT4G04710 50.7 1.7e-121 433.3
Blo03g00231 . 63 496 EF-hand Containing Proteins AT4G04710 52.3 1.9e-120 429.9
Blo07g00904 BCT 51 519 EF-hand Containing Proteins AT4G04720 79.5 3.5e-221 764.6
Blo13g00983 . 80 570 EF-hand Containing Proteins AT4G04720 77.8 1.2e-218 756.1
Blo10g00833 BCT 8 526 EF-hand Containing Proteins AT4G04720 67.9 1.5e-203 706.1
Blo08g00131 BCT 38 521 EF-hand Containing Proteins AT4G04720 67.8 1.6e-194 676.0
Blo12g00874 . 25 524 EF-hand Containing Proteins AT4G04720 67.5 5.8e-192 667.5
Blo14g00295 BCT 42 521 EF-hand Containing Proteins AT4G04720 67.1 2.2e-191 665.6
Blo07g01294 . 44 576 EF-hand Containing Proteins AT4G04720 55.2 2.6e-168 589.0
Blo09g00457 . 154 610 EF-hand Containing Proteins AT4G04720 61.6 4.9e-167 584.7
Blo16g00559 . 7 503 EF-hand Containing Proteins AT4G04720 56.8 7.4e-155 544.3
Blo03g00231 . 40 499 EF-hand Containing Proteins AT4G04720 60.4 8.2e-154 540.8
Blo15g00417 . 94 546 EF-hand Containing Proteins AT4G04720 59.7 4.0e-153 538.5
Blo01g01253 . 90 581 EF-hand Containing Proteins AT4G04720 54.6 7.6e-152 534.3
Blo09g00453 . 136 631 EF-hand Containing Proteins AT4G04720 54.3 1.0e-151 533.9
Blo04g00755 BCT 34 504 EF-hand Containing Proteins AT4G04720 55.1 1.0e-148 523.9
Blo02g01128 . 49 504 EF-hand Containing Proteins AT4G04720 57.5 2.3e-148 522.7
Blo13g00467 . 367 897 EF-hand Containing Proteins AT4G04720 52.0 6.3e-146 514.6
Blo08g00105 . 52 499 EF-hand Containing Proteins AT4G04720 55.4 8.2e-146 514.2
Blo04g00371 . 99 552 EF-hand Containing Proteins AT4G04720 56.9 2.4e-145 512.7
Blo12g00800 . 18 470 EF-hand Containing Proteins AT4G04720 57.0 3.4e-144 508.8
Blo07g01139 CCT 37 495 EF-hand Containing Proteins AT4G04720 54.5 5.9e-144 508.1
Blo16g00202 BCT 63 561 EF-hand Containing Proteins AT4G04720 50.9 1.9e-142 503.1
Blo02g00160 . 95 547 EF-hand Containing Proteins AT4G04720 56.8 5.1e-140 495.0
Blo12g00582 . 42 498 EF-hand Containing Proteins AT4G04720 52.7 2.5e-139 492.7
Blo01g01057 CCT 41 495 EF-hand Containing Proteins AT4G04720 53.4 6.9e-137 484.6
Blo11g00138 . 39 495 EF-hand Containing Proteins AT4G04720 52.7 1.5e-136 483.4
Blo12g00391 . 41 508 EF-hand Containing Proteins AT4G04720 52.0 1.0e-135 480.7
Blo12g00256 . 48 495 EF-hand Containing Proteins AT4G04720 51.8 3.6e-133 472.2
Blo07g00904 BCT 49 519 EF-hand Containing Proteins AT4G04740 70.9 2.1e-199 692.2
Blo13g00983 . 48 563 EF-hand Containing Proteins AT4G04740 65.1 4.2e-195 677.9
Blo10g00833 BCT 8 528 EF-hand Containing Proteins AT4G04740 62.6 6.1e-186 647.5
Blo08g00131 BCT 22 522 EF-hand Containing Proteins AT4G04740 58.5 2.8e-175 612.1
Blo12g00874 . 62 516 EF-hand Containing Proteins AT4G04740 63.3 2.9e-172 602.1
Blo14g00295 BCT 24 522 EF-hand Containing Proteins AT4G04740 58.9 8.5e-172 600.5
Blo07g01294 . 79 587 EF-hand Containing Proteins AT4G04740 53.5 1.2e-154 543.5
Blo09g00457 . 154 605 EF-hand Containing Proteins AT4G04740 57.0 2.2e-151 532.7
Blo08g00105 . 52 508 EF-hand Containing Proteins AT4G04740 53.8 1.0e-145 513.8
Blo07g01139 CCT 37 503 EF-hand Containing Proteins AT4G04740 53.7 1.8e-145 513.1
Blo04g00755 BCT 28 513 EF-hand Containing Proteins AT4G04740 52.9 1.2e-144 510.4
Blo03g00231 . 35 499 EF-hand Containing Proteins AT4G04740 55.1 2.0e-141 499.6
Blo12g00582 . 50 507 EF-hand Containing Proteins AT4G04740 52.8 4.5e-141 498.4
Blo16g00559 . 21 502 EF-hand Containing Proteins AT4G04740 54.0 6.6e-140 494.6
Blo01g01253 . 89 580 EF-hand Containing Proteins AT4G04740 50.1 1.5e-139 493.4
Blo09g00453 . 136 631 EF-hand Containing Proteins AT4G04740 50.9 1.9e-139 493.0
Blo02g01128 . 36 501 EF-hand Containing Proteins AT4G04740 54.9 4.3e-139 491.9
Blo15g00417 . 94 545 EF-hand Containing Proteins AT4G04740 55.0 6.1e-138 488.0
Blo11g00138 . 47 504 EF-hand Containing Proteins AT4G04740 52.2 1.2e-136 483.8
Blo01g01057 CCT 37 503 EF-hand Containing Proteins AT4G04740 52.0 3.4e-136 482.3
Blo12g00391 . 37 516 EF-hand Containing Proteins AT4G04740 50.9 1.3e-135 480.3
Blo12g00800 . 18 470 EF-hand Containing Proteins AT4G04740 54.2 1.6e-133 473.4
Blo04g00371 . 107 551 EF-hand Containing Proteins AT4G04740 53.4 7.8e-133 471.1
Blo02g00160 . 95 546 EF-hand Containing Proteins AT4G04740 52.8 8.3e-127 451.1
Blo12g00800 . 18 494 EF-hand Containing Proteins AT4G09570 82.2 1.3e-201 699.5
Blo16g00559 . 24 528 EF-hand Containing Proteins AT4G09570 69.4 1.3e-190 662.9
Blo15g00417 . 94 564 EF-hand Containing Proteins AT4G09570 65.7 2.6e-162 568.9
Blo02g00160 . 95 573 EF-hand Containing Proteins AT4G09570 69.5 1.7e-161 566.2
Blo07g01294 . 105 598 EF-hand Containing Proteins AT4G09570 57.5 3.2e-160 562.0
Blo09g00457 . 155 631 EF-hand Containing Proteins AT4G09570 60.2 3.2e-160 562.0
Blo04g00371 . 97 578 EF-hand Containing Proteins AT4G09570 66.6 3.0e-158 555.4
Blo13g00467 . 398 915 EF-hand Containing Proteins AT4G09570 58.6 1.8e-155 546.2
Blo09g00453 . 113 631 EF-hand Containing Proteins AT4G09570 52.4 4.5e-146 515.0
Blo01g01253 . 108 601 EF-hand Containing Proteins AT4G09570 53.4 3.2e-144 508.8
Blo14g00295 BCT 52 515 EF-hand Containing Proteins AT4G09570 53.9 7.5e-141 497.7
Blo08g00131 BCT 52 515 EF-hand Containing Proteins AT4G09570 54.7 1.7e-140 496.5
Blo07g00904 BCT 50 516 EF-hand Containing Proteins AT4G09570 52.5 1.2e-135 480.3
Blo02g01128 . 43 501 EF-hand Containing Proteins AT4G09570 63.0 5.2e-134 474.9
Blo12g00874 . 75 513 EF-hand Containing Proteins AT4G09570 52.0 2.5e-128 456.1
Blo03g00231 . 59 418 EF-hand Containing Proteins AT4G09570 62.5 3.3e-128 455.7
Blo04g00755 BCT 58 503 EF-hand Containing Proteins AT4G09570 51.0 6.8e-126 448.0
Blo12g00582 . 55 497 EF-hand Containing Proteins AT4G09570 50.1 2.2e-124 443.0
Blo10g00833 BCT 65 423 EF-hand Containing Proteins AT4G09570 58.2 1.1e-120 430.6
Blo07g00904 BCT 52 467 EF-hand Containing Proteins AT4G21940 76.4 8.6e-190 660.2
Blo13g00983 . 3 514 EF-hand Containing Proteins AT4G21940 65.5 2.8e-188 655.2
Blo10g00833 BCT 55 471 EF-hand Containing Proteins AT4G21940 72.4 8.9e-179 623.6
Blo12g00874 . 62 463 EF-hand Containing Proteins AT4G21940 70.4 4.4e-170 594.7
Blo08g00131 BCT 43 465 EF-hand Containing Proteins AT4G21940 66.7 1.7e-169 592.8
Blo14g00295 BCT 51 465 EF-hand Containing Proteins AT4G21940 66.5 1.6e-167 586.3
Blo07g01294 . 124 531 EF-hand Containing Proteins AT4G21940 59.6 5.6e-149 524.6
Blo09g00457 . 152 559 EF-hand Containing Proteins AT4G21940 60.3 7.3e-149 524.2
Blo03g00231 . 63 422 EF-hand Containing Proteins AT4G21940 66.4 1.3e-140 496.9
Blo16g00559 . 24 427 EF-hand Containing Proteins AT4G21940 59.2 1.5e-138 490.0
Blo01g01253 . 94 532 EF-hand Containing Proteins AT4G21940 54.4 2.0e-138 489.6
Blo09g00453 . 134 599 EF-hand Containing Proteins AT4G21940 51.3 2.6e-138 489.2
Blo15g00417 . 94 497 EF-hand Containing Proteins AT4G21940 57.7 1.1e-136 483.8
Blo04g00755 BCT 50 453 EF-hand Containing Proteins AT4G21940 57.0 1.9e-136 483.0
Blo02g01128 . 49 406 EF-hand Containing Proteins AT4G21940 64.2 2.4e-136 482.6
Blo08g00105 . 52 448 EF-hand Containing Proteins AT4G21940 56.2 4.3e-133 471.9
Blo12g00800 . 18 379 EF-hand Containing Proteins AT4G21940 62.4 6.2e-132 468.0
Blo16g00202 BCT 63 510 EF-hand Containing Proteins AT4G21940 51.3 3.1e-131 465.7
Blo04g00371 . 97 461 EF-hand Containing Proteins AT4G21940 59.2 9.0e-131 464.2
Blo07g01139 CCT 41 444 EF-hand Containing Proteins AT4G21940 54.0 2.0e-130 463.0
Blo13g00467 . 395 848 EF-hand Containing Proteins AT4G21940 51.3 6.4e-129 458.0
Blo02g00160 . 95 453 EF-hand Containing Proteins AT4G21940 61.3 1.4e-128 456.8
Blo12g00256 . 48 444 EF-hand Containing Proteins AT4G21940 53.4 2.3e-126 449.5
Blo12g00582 . 42 447 EF-hand Containing Proteins AT4G21940 52.7 3.9e-126 448.7
Blo12g00391 . 39 457 EF-hand Containing Proteins AT4G21940 52.4 3.3e-125 445.7
Blo01g01057 CCT 39 444 EF-hand Containing Proteins AT4G21940 53.4 3.3e-125 445.7
Blo11g00138 . 39 444 EF-hand Containing Proteins AT4G21940 53.0 5.6e-125 444.9
Blo14g00295 BCT 60 524 EF-hand Containing Proteins AT4G23650 72.3 5.6e-203 704.1
Blo08g00131 BCT 60 524 EF-hand Containing Proteins AT4G23650 72.3 1.8e-201 699.1
Blo07g00904 BCT 53 519 EF-hand Containing Proteins AT4G23650 68.7 1.6e-189 659.4
Blo02g01128 . 40 511 EF-hand Containing Proteins AT4G23650 69.3 7.8e-189 657.1
Blo03g00231 . 61 498 EF-hand Containing Proteins AT4G23650 73.7 1.1e-187 653.3
Blo13g00983 . 75 563 EF-hand Containing Proteins AT4G23650 63.2 7.1e-182 634.0
Blo12g00874 . 61 515 EF-hand Containing Proteins AT4G23650 62.4 4.4e-176 614.8
Blo10g00833 BCT 68 520 EF-hand Containing Proteins AT4G23650 64.0 8.6e-172 600.5
Blo09g00457 . 156 615 EF-hand Containing Proteins AT4G23650 62.3 8.6e-172 600.5
Blo07g01294 . 128 576 EF-hand Containing Proteins AT4G23650 61.6 6.2e-170 594.3
Blo15g00417 . 94 546 EF-hand Containing Proteins AT4G23650 59.5 1.4e-158 556.6
Blo01g01253 . 120 584 EF-hand Containing Proteins AT4G23650 57.9 5.4e-158 554.7
Blo16g00559 . 14 503 EF-hand Containing Proteins AT4G23650 55.0 1.1e-153 540.4
Blo09g00453 . 138 638 EF-hand Containing Proteins AT4G23650 52.4 1.5e-152 536.6
Blo04g00755 BCT 63 503 EF-hand Containing Proteins AT4G23650 57.9 2.9e-151 532.3
Blo08g00105 . 52 498 EF-hand Containing Proteins AT4G23650 56.4 2.9e-151 532.3
Blo13g00467 . 399 905 EF-hand Containing Proteins AT4G23650 53.7 9.3e-150 527.3
Blo04g00371 . 96 552 EF-hand Containing Proteins AT4G23650 56.8 3.5e-149 525.4
Blo12g00582 . 42 497 EF-hand Containing Proteins AT4G23650 57.0 1.0e-148 523.9
Blo07g01139 CCT 41 494 EF-hand Containing Proteins AT4G23650 55.7 8.7e-148 520.8
Blo02g00160 . 95 556 EF-hand Containing Proteins AT4G23650 56.6 3.7e-146 515.4
Blo01g01057 CCT 41 494 EF-hand Containing Proteins AT4G23650 56.0 5.3e-145 511.5
Blo11g00138 . 39 494 EF-hand Containing Proteins AT4G23650 54.8 6.9e-145 511.1
Blo16g00202 BCT 63 560 EF-hand Containing Proteins AT4G23650 51.2 1.7e-143 506.5
Blo12g00391 . 41 507 EF-hand Containing Proteins AT4G23650 54.6 6.5e-143 504.6
Blo12g00800 . 6 478 EF-hand Containing Proteins AT4G23650 53.6 2.7e-141 499.2
Blo12g00256 . 48 495 EF-hand Containing Proteins AT4G23650 51.6 1.9e-134 476.5
Blo06g00303 . 122 495 EF-hand Containing Proteins AT4G23650 50.3 7.7e-104 374.8
Blo09g00114 . 42 303 EF-hand Containing Proteins AT4G23650 50.4 5.8e-75 278.9
Blo04g00322 . 115 287 EF-hand Containing Proteins AT4G23650 52.8 9.3e-49 191.8
Blo15g00417 . 1 564 EF-hand Containing Proteins AT4G35310 80.4 7.0e-249 856.7
Blo02g00160 . 1 569 EF-hand Containing Proteins AT4G35310 77.3 1.3e-231 799.3
Blo13g00467 . 336 915 EF-hand Containing Proteins AT4G35310 71.0 1.7e-226 782.3
Blo07g01294 . 124 597 EF-hand Containing Proteins AT4G35310 67.0 1.0e-186 650.2
Blo09g00457 . 152 628 EF-hand Containing Proteins AT4G35310 65.4 1.5e-182 636.3
Blo16g00559 . 11 517 EF-hand Containing Proteins AT4G35310 63.5 4.3e-182 634.8
Blo04g00371 . 100 577 EF-hand Containing Proteins AT4G35310 68.4 2.0e-174 609.4
Blo01g01253 . 95 592 EF-hand Containing Proteins AT4G35310 61.0 1.8e-172 602.8
Blo12g00800 . 19 491 EF-hand Containing Proteins AT4G35310 66.4 2.9e-170 595.5
Blo09g00453 . 134 631 EF-hand Containing Proteins AT4G35310 60.8 1.2e-168 590.1
Blo14g00295 BCT 33 515 EF-hand Containing Proteins AT4G35310 59.4 4.8e-165 578.2
Blo08g00131 BCT 62 515 EF-hand Containing Proteins AT4G35310 61.0 5.0e-162 568.2
Blo07g00904 BCT 27 516 EF-hand Containing Proteins AT4G35310 56.9 3.4e-158 555.4
Blo13g00983 . 63 563 EF-hand Containing Proteins AT4G35310 54.0 7.5e-150 527.7
Blo12g00874 . 63 513 EF-hand Containing Proteins AT4G35310 56.4 7.7e-147 517.7
Blo10g00833 BCT 53 520 EF-hand Containing Proteins AT4G35310 53.8 1.8e-143 506.5
Blo02g01128 . 49 511 EF-hand Containing Proteins AT4G35310 59.6 1.1e-140 497.3
Blo03g00231 . 63 499 EF-hand Containing Proteins AT4G35310 62.5 2.4e-140 496.1
Blo12g00582 . 55 497 EF-hand Containing Proteins AT4G35310 54.0 2.8e-136 482.6
Blo04g00755 BCT 59 503 EF-hand Containing Proteins AT4G35310 54.9 1.0e-135 480.7
Blo08g00105 . 46 498 EF-hand Containing Proteins AT4G35310 51.9 4.4e-134 475.3
Blo07g01139 CCT 48 494 EF-hand Containing Proteins AT4G35310 53.0 2.9e-133 472.6
Blo11g00138 . 6 494 EF-hand Containing Proteins AT4G35310 50.2 3.2e-132 469.2
Blo01g01057 CCT 49 494 EF-hand Containing Proteins AT4G35310 52.5 4.3e-129 458.8
Blo12g00391 . 48 507 EF-hand Containing Proteins AT4G35310 51.6 1.4e-127 453.8
Blo16g00080 . 36 539 EF-hand Containing Proteins AT4G36070 76.5 7.1e-225 776.9
Blo06g00303 . 78 518 EF-hand Containing Proteins AT4G36070 64.8 8.3e-181 630.6
Blo15g00417 . 83 564 EF-hand Containing Proteins AT4G38230 86.9 1.0e-235 812.8
Blo02g00160 . 84 573 EF-hand Containing Proteins AT4G38230 80.6 1.1e-216 749.6
Blo13g00467 . 388 915 EF-hand Containing Proteins AT4G38230 75.0 1.4e-216 749.2
Blo07g01294 . 120 595 EF-hand Containing Proteins AT4G38230 66.8 1.1e-186 649.8
Blo09g00457 . 148 623 EF-hand Containing Proteins AT4G38230 67.4 7.4e-186 647.1
Blo16g00559 . 16 517 EF-hand Containing Proteins AT4G38230 66.1 2.9e-182 635.2
Blo01g01253 . 104 591 EF-hand Containing Proteins AT4G38230 61.1 5.1e-171 597.8
Blo09g00453 . 130 631 EF-hand Containing Proteins AT4G38230 60.2 1.3e-169 593.2
Blo12g00800 . 19 488 EF-hand Containing Proteins AT4G38230 65.1 2.0e-167 585.9
Blo04g00371 . 92 551 EF-hand Containing Proteins AT4G38230 66.5 1.0e-166 583.6
Blo14g00295 BCT 62 514 EF-hand Containing Proteins AT4G38230 61.1 1.1e-165 580.1
Blo08g00131 BCT 62 514 EF-hand Containing Proteins AT4G38230 61.4 1.1e-165 580.1
Blo07g00904 BCT 64 516 EF-hand Containing Proteins AT4G38230 60.0 1.0e-158 557.0
Blo13g00983 . 85 564 EF-hand Containing Proteins AT4G38230 55.7 3.1e-152 535.4
Blo12g00874 . 63 512 EF-hand Containing Proteins AT4G38230 56.1 3.3e-146 515.4
Blo10g00833 BCT 68 520 EF-hand Containing Proteins AT4G38230 54.3 2.9e-142 502.3
Blo02g01128 . 49 512 EF-hand Containing Proteins AT4G38230 57.5 3.6e-140 495.4
Blo03g00231 . 63 512 EF-hand Containing Proteins AT4G38230 58.4 4.0e-139 491.9
Blo08g00105 . 36 498 EF-hand Containing Proteins AT4G38230 51.4 7.5e-138 487.6
Blo04g00755 BCT 59 503 EF-hand Containing Proteins AT4G38230 54.7 1.7e-137 486.5
Blo07g01139 CCT 32 494 EF-hand Containing Proteins AT4G38230 52.9 1.8e-136 483.0
Blo01g01057 CCT 48 494 EF-hand Containing Proteins AT4G38230 52.8 2.8e-132 469.2
Blo12g00391 . 48 526 EF-hand Containing Proteins AT4G38230 50.7 2.6e-130 462.6
Blo09g00114 . 37 300 EF-hand Containing Proteins AT4G38230 51.1 1.5e-77 287.3
Blo04g00371 . 1 580 EF-hand Containing Proteins AT5G04870 74.4 5.6e-223 770.8
Blo07g01294 . 1 595 EF-hand Containing Proteins AT5G04870 62.8 3.2e-210 728.4
Blo09g00457 . 1 626 EF-hand Containing Proteins AT5G04870 60.1 2.5e-199 692.2
Blo09g00453 . 1 631 EF-hand Containing Proteins AT5G04870 59.4 5.6e-191 664.5
Blo01g01253 . 1 581 EF-hand Containing Proteins AT5G04870 55.1 2.1e-177 619.4
Blo15g00417 . 94 563 EF-hand Containing Proteins AT5G04870 68.4 9.6e-175 610.5
Blo02g00160 . 95 567 EF-hand Containing Proteins AT5G04870 73.2 6.9e-173 604.4
Blo12g00800 . 18 470 EF-hand Containing Proteins AT5G04870 73.5 1.1e-170 597.0
Blo16g00559 . 15 517 EF-hand Containing Proteins AT5G04870 61.0 6.7e-168 587.8
Blo13g00467 . 396 914 EF-hand Containing Proteins AT5G04870 59.9 1.9e-162 569.7
Blo08g00131 BCT 33 522 EF-hand Containing Proteins AT5G04870 57.6 1.8e-157 553.1
Blo14g00295 BCT 62 522 EF-hand Containing Proteins AT5G04870 59.2 1.5e-156 550.1
Blo07g00904 BCT 48 517 EF-hand Containing Proteins AT5G04870 55.5 2.8e-150 529.3
Blo13g00983 . 83 563 EF-hand Containing Proteins AT5G04870 53.1 5.7e-143 505.0
Blo02g01128 . 49 501 EF-hand Containing Proteins AT5G04870 64.9 4.8e-142 501.9
Blo03g00231 . 63 499 EF-hand Containing Proteins AT5G04870 66.1 1.6e-140 496.9
Blo12g00874 . 32 513 EF-hand Containing Proteins AT5G04870 52.4 2.5e-138 489.6
Blo07g01139 CCT 25 495 EF-hand Containing Proteins AT5G04870 52.7 2.2e-134 476.5
Blo08g00105 . 57 520 EF-hand Containing Proteins AT5G04870 52.3 4.8e-134 475.3
Blo10g00833 BCT 64 521 EF-hand Containing Proteins AT5G04870 51.7 1.1e-133 474.2
Blo12g00582 . 55 498 EF-hand Containing Proteins AT5G04870 52.9 4.5e-132 468.8
Blo04g00755 BCT 63 504 EF-hand Containing Proteins AT5G04870 54.2 4.5e-132 468.8
Blo01g01057 CCT 47 495 EF-hand Containing Proteins AT5G04870 51.7 5.7e-127 451.8
Blo11g00138 . 52 495 EF-hand Containing Proteins AT5G04870 51.7 1.7e-126 450.3
Blo12g00256 . 53 495 EF-hand Containing Proteins AT5G04870 50.3 4.8e-126 448.7
Blo12g00391 . 47 508 EF-hand Containing Proteins AT5G04870 50.8 3.1e-125 446.0
Blo06g00303 . 116 467 EF-hand Containing Proteins AT5G04870 50.3 2.3e-99 360.1
Blo09g00114 . 26 303 EF-hand Containing Proteins AT5G04870 51.1 1.9e-77 287.3
Blo04g00322 . 90 287 EF-hand Containing Proteins AT5G04870 54.6 3.2e-53 206.8
Blo14g00295 BCT 1 526 EF-hand Containing Proteins AT5G12180 82.4 8.4e-252 866.3
Blo08g00131 BCT 1 526 EF-hand Containing Proteins AT5G12180 82.1 9.3e-251 862.8
Blo07g00904 BCT 64 516 EF-hand Containing Proteins AT5G12180 72.0 1.2e-197 686.4
Blo13g00983 . 85 563 EF-hand Containing Proteins AT5G12180 65.1 2.3e-185 645.6
Blo07g01294 . 128 576 EF-hand Containing Proteins AT5G12180 64.9 1.9e-179 625.9
Blo10g00833 BCT 68 520 EF-hand Containing Proteins AT5G12180 65.8 1.9e-179 625.9
Blo12g00874 . 60 516 EF-hand Containing Proteins AT5G12180 63.5 7.3e-179 624.0
Blo09g00457 . 156 621 EF-hand Containing Proteins AT5G12180 63.2 2.1e-178 622.5
Blo01g01253 . 108 581 EF-hand Containing Proteins AT5G12180 61.5 1.5e-171 599.7
Blo03g00231 . 42 512 EF-hand Containing Proteins AT5G12180 63.5 1.4e-169 593.2
Blo02g01128 . 37 512 EF-hand Containing Proteins AT5G12180 60.7 4.0e-169 591.7
Blo15g00417 . 94 546 EF-hand Containing Proteins AT5G12180 60.8 1.3e-164 576.6
Blo07g01139 CCT 32 494 EF-hand Containing Proteins AT5G12180 60.3 1.9e-163 572.8
Blo09g00453 . 138 637 EF-hand Containing Proteins AT5G12180 55.5 1.9e-163 572.8
Blo16g00559 . 24 503 EF-hand Containing Proteins AT5G12180 58.6 1.2e-162 570.1
Blo08g00105 . 52 498 EF-hand Containing Proteins AT5G12180 59.5 1.1e-158 557.0
Blo04g00755 BCT 50 503 EF-hand Containing Proteins AT5G12180 59.6 9.3e-158 553.9
Blo01g01057 CCT 41 494 EF-hand Containing Proteins AT5G12180 59.5 4.3e-155 545.0
Blo13g00467 . 399 897 EF-hand Containing Proteins AT5G12180 54.8 1.6e-154 543.1
Blo12g00582 . 42 497 EF-hand Containing Proteins AT5G12180 58.2 2.1e-154 542.7
Blo12g00391 . 32 507 EF-hand Containing Proteins AT5G12180 57.2 1.4e-153 540.0
Blo04g00371 . 98 552 EF-hand Containing Proteins AT5G12180 58.1 5.3e-153 538.1
Blo11g00138 . 39 494 EF-hand Containing Proteins AT5G12180 56.8 1.9e-150 529.6
Blo02g00160 . 95 547 EF-hand Containing Proteins AT5G12180 57.5 7.1e-150 527.7
Blo16g00202 BCT 63 560 EF-hand Containing Proteins AT5G12180 53.6 7.1e-150 527.7
Blo12g00800 . 31 471 EF-hand Containing Proteins AT5G12180 57.0 7.4e-147 517.7
Blo12g00256 . 48 495 EF-hand Containing Proteins AT5G12180 55.1 8.1e-146 514.2
Blo09g00114 . 37 303 EF-hand Containing Proteins AT5G12180 50.9 3.8e-79 292.7
Blo07g00432 . 35 309 EF-hand Containing Proteins AT5G12180 50.9 5.0e-79 292.4
Blo04g00322 . 125 287 EF-hand Containing Proteins AT5G12180 56.5 4.2e-49 193.0
Blo08g00105 . 1 531 EF-hand Containing Proteins AT5G12480 66.9 1.4e-191 666.0
Blo12g00582 . 145 527 EF-hand Containing Proteins AT5G12480 78.9 2.8e-176 615.1
Blo11g00138 . 142 514 EF-hand Containing Proteins AT5G12480 77.5 9.7e-169 590.1
Blo04g00755 BCT 153 533 EF-hand Containing Proteins AT5G12480 70.8 2.0e-158 555.8
Blo07g01139 CCT 110 527 EF-hand Containing Proteins AT5G12480 65.4 3.3e-156 548.5
Blo16g00202 BCT 153 590 EF-hand Containing Proteins AT5G12480 62.2 1.3e-152 536.6
Blo01g01057 CCT 143 522 EF-hand Containing Proteins AT5G12480 68.1 8.0e-147 517.3
Blo12g00391 . 143 530 EF-hand Containing Proteins AT5G12480 65.4 1.7e-141 499.6
Blo12g00256 . 146 526 EF-hand Containing Proteins AT5G12480 60.6 2.3e-138 489.2
Blo09g00457 . 261 605 EF-hand Containing Proteins AT5G12480 57.9 5.8e-113 404.8
Blo07g01294 . 233 576 EF-hand Containing Proteins AT5G12480 57.1 6.4e-112 401.4
Blo14g00295 BCT 164 514 EF-hand Containing Proteins AT5G12480 55.8 1.1e-111 400.6
Blo08g00131 BCT 164 514 EF-hand Containing Proteins AT5G12480 55.5 1.2e-110 397.1
Blo07g00904 BCT 166 522 EF-hand Containing Proteins AT5G12480 54.3 1.7e-109 393.3
Blo13g00983 . 187 563 EF-hand Containing Proteins AT5G12480 51.6 1.2e-105 380.6
Blo10g00833 BCT 170 521 EF-hand Containing Proteins AT5G12480 52.3 1.2e-102 370.5
Blo01g01253 . 213 580 EF-hand Containing Proteins AT5G12480 50.3 2.1e-102 369.8
Blo12g00874 . 165 512 EF-hand Containing Proteins AT5G12480 51.3 1.8e-101 366.7
Blo15g00417 . 199 545 EF-hand Containing Proteins AT5G12480 52.6 5.1e-101 365.2
Blo09g00453 . 243 609 EF-hand Containing Proteins AT5G12480 50.1 4.0e-98 355.5
Blo02g00160 . 200 546 EF-hand Containing Proteins AT5G12480 50.9 3.3e-92 335.9
Blo04g00371 . 205 551 EF-hand Containing Proteins AT5G12480 50.1 2.8e-91 332.8
Blo08g00131 BCT 1 526 EF-hand Containing Proteins AT5G19360 81.7 8.4e-252 866.3
Blo14g00295 BCT 1 526 EF-hand Containing Proteins AT5G19360 81.6 2.1e-250 861.7
Blo07g00904 BCT 40 521 EF-hand Containing Proteins AT5G19360 69.7 3.7e-199 691.4
Blo13g00983 . 85 563 EF-hand Containing Proteins AT5G19360 65.6 2.7e-186 648.7
Blo12g00874 . 48 517 EF-hand Containing Proteins AT5G19360 62.8 3.8e-180 628.2
Blo10g00833 BCT 68 520 EF-hand Containing Proteins AT5G19360 66.0 2.5e-179 625.5
Blo07g01294 . 128 576 EF-hand Containing Proteins AT5G19360 64.7 5.5e-179 624.4
Blo09g00457 . 164 621 EF-hand Containing Proteins AT5G19360 63.6 8.0e-178 620.5
Blo01g01253 . 98 581 EF-hand Containing Proteins AT5G19360 60.4 5.5e-171 597.8
Blo03g00231 . 47 499 EF-hand Containing Proteins AT5G19360 65.1 9.5e-171 597.0
Blo02g01128 . 15 504 EF-hand Containing Proteins AT5G19360 60.2 8.8e-169 590.5
Blo15g00417 . 94 546 EF-hand Containing Proteins AT5G19360 60.4 2.9e-164 575.5
Blo09g00453 . 138 645 EF-hand Containing Proteins AT5G19360 54.4 9.5e-163 570.5
Blo16g00559 . 24 503 EF-hand Containing Proteins AT5G19360 58.2 3.6e-162 568.5
Blo07g01139 CCT 32 494 EF-hand Containing Proteins AT5G19360 59.0 3.0e-161 565.5
Blo08g00105 . 52 498 EF-hand Containing Proteins AT5G19360 58.8 1.6e-157 553.1
Blo04g00755 BCT 1 503 EF-hand Containing Proteins AT5G19360 54.8 1.0e-156 550.4
Blo13g00467 . 336 897 EF-hand Containing Proteins AT5G19360 51.2 1.2e-154 543.5
Blo01g01057 CCT 34 494 EF-hand Containing Proteins AT5G19360 57.9 1.8e-153 539.7
Blo12g00582 . 1 497 EF-hand Containing Proteins AT5G19360 53.5 6.8e-153 537.7
Blo04g00371 . 70 552 EF-hand Containing Proteins AT5G19360 55.6 2.0e-152 536.2
Blo12g00391 . 32 507 EF-hand Containing Proteins AT5G19360 56.4 4.4e-152 535.0
Blo02g00160 . 95 547 EF-hand Containing Proteins AT5G19360 57.3 9.2e-150 527.3
Blo11g00138 . 39 494 EF-hand Containing Proteins AT5G19360 56.1 1.7e-148 523.1
Blo16g00202 BCT 59 560 EF-hand Containing Proteins AT5G19360 52.6 3.9e-148 521.9
Blo12g00800 . 27 470 EF-hand Containing Proteins AT5G19360 56.9 7.3e-147 517.7
Blo12g00256 . 48 495 EF-hand Containing Proteins AT5G19360 54.9 8.9e-145 510.8
Blo09g00114 . 37 303 EF-hand Containing Proteins AT5G19360 50.2 1.3e-79 294.3
Blo07g00432 . 35 309 EF-hand Containing Proteins AT5G19360 50.2 8.5e-79 291.6
Blo04g00322 . 125 287 EF-hand Containing Proteins AT5G19360 54.8 4.5e-48 189.5
Blo08g00105 . 1 531 EF-hand Containing Proteins AT5G19450 82.5 1.5e-256 882.1
Blo12g00582 . 1 527 EF-hand Containing Proteins AT5G19450 75.9 9.5e-235 809.7
Blo11g00138 . 1 514 EF-hand Containing Proteins AT5G19450 74.8 2.3e-225 778.5
Blo04g00755 BCT 1 533 EF-hand Containing Proteins AT5G19450 65.6 2.2e-199 692.2
Blo07g01139 CCT 1 527 EF-hand Containing Proteins AT5G19450 64.9 6.4e-199 690.6
Blo16g00202 BCT 1 590 EF-hand Containing Proteins AT5G19450 60.4 9.6e-195 676.8
Blo01g01057 CCT 1 522 EF-hand Containing Proteins AT5G19450 64.3 4.6e-189 657.9
Blo12g00391 . 1 530 EF-hand Containing Proteins AT5G19450 63.0 6.2e-186 647.5
Blo12g00256 . 1 526 EF-hand Containing Proteins AT5G19450 59.0 1.7e-183 639.4
Blo09g00457 . 155 605 EF-hand Containing Proteins AT5G19450 57.6 1.4e-150 530.0
Blo14g00295 BCT 1 514 EF-hand Containing Proteins AT5G19450 53.2 1.0e-148 523.9
Blo07g01294 . 119 576 EF-hand Containing Proteins AT5G19450 54.9 1.3e-146 516.9
Blo08g00131 BCT 69 514 EF-hand Containing Proteins AT5G19450 56.5 1.1e-145 513.8
Blo07g00904 BCT 71 522 EF-hand Containing Proteins AT5G19450 54.8 3.4e-144 508.8
Blo13g00983 . 92 563 EF-hand Containing Proteins AT5G19450 52.4 2.8e-138 489.2
Blo01g01253 . 106 580 EF-hand Containing Proteins AT5G19450 51.4 4.8e-138 488.4
Blo12g00874 . 70 512 EF-hand Containing Proteins AT5G19450 52.9 1.4e-137 486.9
Blo10g00833 BCT 75 521 EF-hand Containing Proteins AT5G19450 53.2 3.5e-136 482.3
Blo15g00417 . 105 545 EF-hand Containing Proteins AT5G19450 53.4 1.2e-133 473.8
Blo09g00453 . 129 609 EF-hand Containing Proteins AT5G19450 50.7 6.1e-133 471.5
Blo02g00160 . 106 546 EF-hand Containing Proteins AT5G19450 51.8 4.0e-124 442.2
Blo12g00800 . 31 470 EF-hand Containing Proteins AT5G19450 50.3 5.7e-123 438.3
Blo16g00559 . 16 521 EF-hand Containing Proteins AT5G23580 71.5 1.4e-205 712.6
Blo12g00800 . 19 486 EF-hand Containing Proteins AT5G23580 69.6 1.8e-179 625.9
Blo09g00457 . 156 630 EF-hand Containing Proteins AT5G23580 64.0 3.3e-173 605.1
Blo07g01294 . 128 593 EF-hand Containing Proteins AT5G23580 62.8 2.1e-172 602.4
Blo15g00417 . 93 560 EF-hand Containing Proteins AT5G23580 66.9 4.7e-172 601.3
Blo13g00467 . 395 911 EF-hand Containing Proteins AT5G23580 61.9 7.8e-167 583.9
Blo01g01253 . 108 596 EF-hand Containing Proteins AT5G23580 58.8 8.0e-164 573.9
Blo08g00131 BCT 62 515 EF-hand Containing Proteins AT5G23580 60.4 7.0e-160 560.8
Blo14g00295 BCT 62 515 EF-hand Containing Proteins AT5G23580 59.5 3.0e-158 555.4
Blo04g00371 . 96 572 EF-hand Containing Proteins AT5G23580 61.8 1.5e-157 553.1
Blo02g00160 . 94 564 EF-hand Containing Proteins AT5G23580 62.8 2.1e-156 549.3
Blo09g00453 . 138 637 EF-hand Containing Proteins AT5G23580 56.4 2.1e-156 549.3
Blo07g00904 BCT 60 516 EF-hand Containing Proteins AT5G23580 56.7 2.1e-148 522.7
Blo13g00983 . 92 563 EF-hand Containing Proteins AT5G23580 54.7 1.1e-144 510.4
Blo04g00755 BCT 59 503 EF-hand Containing Proteins AT5G23580 56.1 3.5e-143 505.4
Blo12g00874 . 75 513 EF-hand Containing Proteins AT5G23580 56.3 6.6e-142 501.1
Blo07g01139 CCT 47 494 EF-hand Containing Proteins AT5G23580 55.1 6.2e-140 494.6
Blo08g00105 . 57 498 EF-hand Containing Proteins AT5G23580 52.7 9.2e-136 480.7
Blo12g00582 . 49 497 EF-hand Containing Proteins AT5G23580 52.3 2.7e-135 479.2
Blo01g01057 CCT 47 494 EF-hand Containing Proteins AT5G23580 53.8 2.3e-134 476.1
Blo10g00833 BCT 64 520 EF-hand Containing Proteins AT5G23580 52.1 2.5e-133 472.6
Blo02g01128 . 49 501 EF-hand Containing Proteins AT5G23580 56.1 5.6e-133 471.5
Blo12g00391 . 47 507 EF-hand Containing Proteins AT5G23580 52.4 1.3e-132 470.3
Blo03g00231 . 63 512 EF-hand Containing Proteins AT5G23580 55.8 5.3e-131 464.9
Blo11g00138 . 46 494 EF-hand Containing Proteins AT5G23580 50.8 3.2e-128 455.7
Blo09g00114 . 37 306 EF-hand Containing Proteins AT5G23580 50.4 4.5e-74 275.8
Blo04g00322 . 109 287 EF-hand Containing Proteins AT5G23580 53.3 8.0e-47 185.3
Blo16g00080 . 57 440 EF-hand Containing Proteins AT5G66210 83.6 6.8e-191 663.7
Blo06g00303 . 101 467 EF-hand Containing Proteins AT5G66210 80.7 1.4e-175 612.8
Blo05g00614 . 121 505 EF-hand Containing Proteins AT5G66210 51.7 2.3e-106 382.9
Blo07g01221 BCT 91 474 EF-hand Containing Proteins AT5G66210 52.6 3.4e-105 379.0
Blo16g00377 . 128 492 EF-hand Containing Proteins AT5G66210 54.5 4.4e-105 378.6
Blo09g00365 BCT 91 471 EF-hand Containing Proteins AT5G66210 51.7 1.3e-104 377.1
Blo01g00249 BCT 147 507 EF-hand Containing Proteins AT5G66210 51.6 8.6e-101 364.4
Blo05g00614 . 57 607 EF-hand Containing Proteins AT1G49580 71.8 7.7e-233 803.5
Blo04g01041 . 67 661 EF-hand Containing Proteins AT1G49580 66.6 2.5e-223 771.9
Blo16g00377 . 66 593 EF-hand Containing Proteins AT1G49580 69.0 4.1e-218 754.6
Blo02g00818 . 99 760 EF-hand Containing Proteins AT1G49580 59.8 9.1e-218 753.4
Blo07g01221 BCT 28 578 EF-hand Containing Proteins AT1G49580 66.3 3.4e-212 734.9
Blo09g00365 BCT 39 575 EF-hand Containing Proteins AT1G49580 66.5 1.1e-210 729.9
Blo01g00249 BCT 66 608 EF-hand Containing Proteins AT1G49580 62.1 5.4e-194 674.5
Blo12g00214 BCT 53 636 EF-hand Containing Proteins AT1G49580 54.1 1.0e-176 617.1
Blo06g00303 . 112 472 EF-hand Containing Proteins AT1G49580 53.1 6.5e-107 385.2
Blo01g00249 BCT 196 608 EF-hand Containing Proteins AT2G46700 80.2 4.7e-197 684.1
Blo12g00214 BCT 200 634 EF-hand Containing Proteins AT2G46700 72.2 9.4e-182 633.3
Blo05g00614 . 194 609 EF-hand Containing Proteins AT2G46700 67.4 2.5e-166 582.0
Blo04g01041 . 225 661 EF-hand Containing Proteins AT2G46700 62.7 9.5e-158 553.5
Blo09g00365 BCT 162 572 EF-hand Containing Proteins AT2G46700 64.0 4.7e-157 551.2
Blo07g01221 BCT 162 575 EF-hand Containing Proteins AT2G46700 64.0 1.4e-156 549.7
Blo02g00818 . 345 754 EF-hand Containing Proteins AT2G46700 65.6 2.6e-155 545.4
Blo16g00377 . 201 589 EF-hand Containing Proteins AT2G46700 63.4 7.3e-150 527.3
Blo06g00303 . 158 471 EF-hand Containing Proteins AT2G46700 55.8 3.9e-95 345.5
Blo05g00614 . 1 605 EF-hand Containing Proteins AT3G50530 72.7 2.9e-267 917.9
Blo04g01041 . 1 661 EF-hand Containing Proteins AT3G50530 68.6 4.8e-262 900.6
Blo16g00377 . 1 591 EF-hand Containing Proteins AT3G50530 71.9 1.6e-260 895.6
Blo09g00365 BCT 1 574 EF-hand Containing Proteins AT3G50530 65.5 3.9e-235 811.2
Blo07g01221 BCT 32 577 EF-hand Containing Proteins AT3G50530 68.9 9.5e-234 806.6
Blo02g00818 . 99 756 EF-hand Containing Proteins AT3G50530 60.8 5.4e-229 790.8
Blo01g00249 BCT 42 601 EF-hand Containing Proteins AT3G50530 60.6 1.6e-201 699.5
Blo12g00214 BCT 42 637 EF-hand Containing Proteins AT3G50530 54.3 5.3e-184 641.3
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0004503 2 1 2 2 2 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 2 1 1 1 1 1 1 6 2 1 42
       

Transcriptome


Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Blo08g00141 Blo_Chr08 FPKM 11.635015 11.013809 13.765009 16.734442 11.824299 12.930493 12.063107 18.878672 18.726517 15.259589