Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Blo14g00365 ATGAATGATCTCTTCTCCGGTTCGTTCAAAAAGTATGCAGACCTGAAGCAGCAGGCCCACCTAGACGGCATGGAGGCCGGAAAGGAGAGCGTAAATCTTGACAAGTTCTTCGACGACATCGACAATGTGAAGGAAGACATGAAACAAGTGGAAAAGCTCTACAAGAAACTGCAGGAAGCAAATGAGGAATGCAAAGTCGTCCACAATGCCAAAACCATGAAAGAACTGAGAGCAAGAATGGATCAAGACGCCAGCCAGGTTTTAAAAAGAGTCAAAATGATCAAAGCAAAGCTGGAAGCCCTCGAACGATCAAATGCAGCCCATCGTAGCCTTCCAGGGTGTGGCCCAGGCTCATCTGCCGACAGAACAAGAACCTCGGTCGTAAGTGGATTGGGGAAGAAACTAAAAGACATAATGGATGATTTTCAGAGCTTAAGAAGTAGAATGAATGCAGAATATAAGGAAACAGTTGAACGCAGGTATTTCACAATCACAGGAGAGAAGGCAGATGAAGAAACCATTGAAAATCTTATCTCAAGTGGAGAAAGCGAAAATTTTCTGCAGAAAGCAATTCAAGAACAGGGCAGAGGCCAAATAATGGACACCATATCTGAAATACAAGAAAGACACGATGCAGTGAAGGAGATCGAGAAGAACCTCCTTGAGCTTCACCAGATATTTCTGGACATGGCTGCTCTGGTCGAGGCTCAGGGGCATCAGCTCAATGACATAGAGAGTCACGTTGCCCATGCAAATTCGTTCGTCCGGCGAGGGACGGAGCAGCTTCAAGAGGCCAGAGAAAGTCAGAAGAGCTCGAGGAAATGGACCTGCATTGCCGTAGTTCTTGGTGCAGTTCTTGTTGCTGTTCTTCTCTTCCCACTTCTAACCTCCATTTTGCCTCACCTGTTGTAG 912 46.16 MNDLFSGSFKKYADLKQQAHLDGMEAGKESVNLDKFFDDIDNVKEDMKQVEKLYKKLQEANEECKVVHNAKTMKELRARMDQDASQVLKRVKMIKAKLEALERSNAAHRSLPGCGPGSSADRTRTSVVSGLGKKLKDIMDDFQSLRSRMNAEYKETVERRYFTITGEKADEETIENLISSGESENFLQKAIQEQGRGQIMDTISEIQERHDAVKEIEKNLLELHQIFLDMAALVEAQGHQLNDIESHVAHANSFVRRGTEQLQEARESQKSSRKWTCIAVVLGAVLVAVLLFPLLTSILPHLL 303
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
14 3972538 3973449 + BLOR14683 Blo14g00365 69878

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Blo14g00365 303 CDD SNARE_syntaxin1-like 202 264 - -
Blo14g00365 303 PANTHER SYNTAXIN-124-RELATED 6 294 - -
Blo14g00365 303 Coils Coil 84 104 - -
Blo14g00365 303 CDD SynN 33 190 IPR006011 GO:0016020
Blo14g00365 303 Gene3D - 193 296 - -
Blo14g00365 303 SMART tSNARE_6 198 265 IPR000727 -
Blo14g00365 303 Pfam SNARE domain 240 291 IPR000727 -
Blo14g00365 303 PANTHER SYNTAXIN 6 294 IPR045242 -
Blo14g00365 303 ProSitePatterns Syntaxin / epimorphin family signature. 209 248 IPR006012 GO:0005484|GO:0006886|GO:0016020
Blo14g00365 303 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 203 265 IPR000727 -
Blo14g00365 303 Coils Coil 33 70 - -
Blo14g00365 303 SUPERFAMILY t-snare proteins 32 258 IPR010989 GO:0016020|GO:0016192
Blo14g00365 303 SMART SynN_4 28 154 IPR006011 GO:0016020
Blo14g00365 303 Gene3D - 33 160 - -
Blo14g00365 303 Pfam Syntaxin 35 238 IPR006011 GO:0016020
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Blo14g00365 K08486 STX1B_2_3; syntaxin 1B/2/3 - csv:101217140 526.554
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Blo09g00464 Blo-Chr9:15786007 Blo14g00365 Blo-Chr14:3972538 4.30E-124 dispersed
Blo12g00540 Blo-Chr12:23357511 Blo14g00365 Blo-Chr14:3972538 2.83E-114 dispersed
Blo14g00365 Blo-Chr14:3972538 Blo15g00503 Blo-Chr15:8565426 8.42E-75 dispersed
Blo14g00365 Blo-Chr14:3972538 Blo08g00183 Blo-Chr8:2085505 0 transposed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Blo18g00047 . 82 420 SNARE and Associated Proteins AT3G24350 60.1 5.5e-93 338.2
Blo17g00037 BCT 445 752 SNARE and Associated Proteins AT3G24350 62.3 1.9e-90 329.7
Blo04g00912 BCT 1 286 SNARE and Associated Proteins AT2G18260 53.8 5.1e-76 281.6
Blo15g00703 . 102 394 SNARE and Associated Proteins AT2G18260 50.2 4.3e-75 278.5
Blo01g00722 . 1 289 SNARE and Associated Proteins AT2G18260 50.2 1.5e-72 270.0
Blo16g00051 BCT 1 271 SNARE and Associated Proteins AT2G18260 51.6 6.1e-69 258.1
Blo09g00464 . 22 278 SNARE and Associated Proteins AT3G11820 81.3 3.2e-113 405.2
Blo12g00540 . 1 261 SNARE and Associated Proteins AT3G11820 73.6 7.1e-105 377.5
Blo08g00183 . 954 1204 SNARE and Associated Proteins AT3G11820 66.1 3.3e-94 342.0
Blo14g00365 . 31 281 SNARE and Associated Proteins AT3G11820 65.7 1.3e-93 340.1
Blo09g00464 . 29 278 SNARE and Associated Proteins AT3G52400 70.0 2.4e-90 329.3
Blo12g00540 . 13 261 SNARE and Associated Proteins AT3G52400 65.5 7.5e-84 307.8
Blo14g00365 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 9.1e-82 300.8
Blo08g00183 . 924 1204 SNARE and Associated Proteins AT3G52400 56.4 1.2e-81 300.4
Blo14g00365 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 7.8e-109 390.6
Blo08g00183 . 924 1218 SNARE and Associated Proteins AT4G03330 67.1 2.8e-106 382.1
Blo09g00464 . 1 278 SNARE and Associated Proteins AT4G03330 58.0 5.1e-84 308.1
Blo12g00540 . 10 261 SNARE and Associated Proteins AT4G03330 56.7 1.7e-74 276.6
Blo15g00503 . 136 373 SNARE and Associated Proteins AT4G03330 50.8 1.0e-55 214.2
Blo14g00365 . 1 299 SNARE and Associated Proteins AT1G61290 78.3 1.2e-125 446.4
Blo08g00183 . 924 1226 SNARE and Associated Proteins AT1G61290 77.6 5.0e-124 441.0
Blo09g00464 . 1 272 SNARE and Associated Proteins AT1G61290 63.5 3.1e-89 325.5
Blo12g00540 . 13 261 SNARE and Associated Proteins AT1G61290 61.8 6.9e-81 297.7
Blo14g00365 . 1 299 SNARE and Associated Proteins AT1G11250 76.6 1.8e-121 432.6
Blo08g00183 . 924 1226 SNARE and Associated Proteins AT1G11250 75.9 8.7e-121 430.3
Blo09g00464 . 1 272 SNARE and Associated Proteins AT1G11250 64.3 1.2e-93 340.1
Blo12g00540 . 3 261 SNARE and Associated Proteins AT1G11250 61.0 2.2e-84 309.3
Blo15g00503 . 96 396 SNARE and Associated Proteins AT3G03800 59.8 7.7e-88 320.9
Blo12g00540 . 13 277 SNARE and Associated Proteins AT3G03800 51.5 4.0e-60 228.8
Blo15g00503 . 97 293 SNARE and Associated Proteins AT5G08080 60.4 8.4e-52 200.7
Blo02g00982 . 1 263 SNARE and Associated Proteins AT5G16830 61.3 1.4e-75 280.0
Blo03g00106 . 225 443 SNARE and Associated Proteins AT5G16830 57.3 4.7e-60 228.4
Blo02g00982 . 1 274 SNARE and Associated Proteins AT5G46860 69.7 5.9e-84 307.8
Blo03g00106 . 225 414 SNARE and Associated Proteins AT5G46860 76.3 7.5e-71 264.2
Blo02g00982 . 1 257 SNARE and Associated Proteins AT4G17730 65.8 8.9e-77 283.9
Blo03g00106 . 225 414 SNARE and Associated Proteins AT4G17730 76.2 3.5e-73 271.9
Blo18g00562 BCT 1 182 SNARE and Associated Proteins AT4G17730 51.5 1.1e-42 170.6
Blo02g00982 . 65 256 SNARE and Associated Proteins AT1G32270 59.4 9.2e-50 194.5
Blo03g00106 . 289 440 SNARE and Associated Proteins AT1G32270 64.5 1.2e-44 177.6
Blo04g00243 . 1 337 SNARE and Associated Proteins AT5G05760 65.8 2.4e-111 399.1
Blo18g00047 . 82 420 SNARE and Associated Proteins AT3G24350 60.1 5.5e-93 338.2
Blo17g00037 BCT 445 752 SNARE and Associated Proteins AT3G24350 62.3 1.9e-90 329.7
Blo18g00633 . 1 341 SNARE and Associated Proteins AT5G26980 74.8 9.1e-124 440.3
Blo17g00673 . 115 418 SNARE and Associated Proteins AT5G26980 71.4 1.6e-112 402.9
Blo18g00633 . 1 339 SNARE and Associated Proteins AT4G02195 62.8 2.1e-99 359.4
Blo17g00673 . 115 416 SNARE and Associated Proteins AT4G02195 60.9 7.1e-92 334.3
Blo18g00633 . 1 339 SNARE and Associated Proteins AT3G05710 74.9 4.5e-126 448.0
Blo17g00673 . 115 416 SNARE and Associated Proteins AT3G05710 71.7 2.6e-113 405.6
Blo03g00538 . 1 220 SNARE and Associated Proteins AT1G16240 72.7 2.3e-84 308.9
Blo07g00879 . 34 267 SNARE and Associated Proteins AT1G16240 58.5 7.1e-70 260.8
Blo03g00538 . 1 220 SNARE and Associated Proteins AT1G79590 71.8 2.0e-84 309.3
Blo07g00879 . 34 267 SNARE and Associated Proteins AT1G79590 59.8 1.6e-70 263.1
Blo03g00554 . 55 234 SNARE and Associated Proteins AT1G28490 66.1 5.8e-60 227.6
Blo03g01454 . 55 215 SNARE and Associated Proteins AT1G28490 60.9 1.6e-49 193.0
Blo07g01404 . 1 248 SNARE and Associated Proteins AT3G09740 72.4 4.0e-93 338.2
Blo14g00167 . 1 233 SNARE and Associated Proteins AT3G09740 61.0 4.8e-70 261.5
Blo07g01404 . 1 248 SNARE and Associated Proteins AT3G45280 60.4 5.5e-74 274.6
Blo14g00167 . 1 236 SNARE and Associated Proteins AT3G45280 57.7 1.4e-66 250.0
Blo07g01404 . 1 248 SNARE and Associated Proteins AT3G61450 60.6 5.2e-77 284.6
Blo14g00167 . 1 235 SNARE and Associated Proteins AT3G61450 53.8 3.6e-62 235.3
Blo04g00134 . 624 868 SNARE and Associated Proteins AT1G51740 72.4 2.7e-91 332.0
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0005716 1 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 2 1 1 37
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Blo14g00365 Blo_Chr14 FPKM 14.917812 15.363294 11.109466 11.324156 14.827335 13.693817 15.204885 10.438266 9.198784 9.312659