Gene search
Sequence information

Select | Gene | Cds | Cds_length | GC_content | Pep | Pep_length |
---|---|---|---|---|---|---|
Blo17g00522 | ATGGAAGTGGAAGATAGCGACGAAGGCGGCGATATCTTGATTCCTCCGCCGAATTTCTCCATGGTTGAGGATGGAATTTTTAGATCCAGTTTTCCTCATCCTTCCAACTTTTCTTTTATCCGGACGCTGAATCTTCGCTCAGTCTTGTATTTGTGTACAGATCCATATCCAGAAGAAAATATGGAGTTTCTTGGAGCCCAAAATATTCAGCTTTTCCAATTTGGAATAGAAGGGAAAACGGATCCTCCTGTGTCTATTCCGAAGGCTACGATCATGAACGCTTTGAAAGTTCTAATCGATGTTAGGAATCACCCCATCTTGATCCATTGCAAGGCGGGGAAGCATCGAACGGGCTGTCTTGTTGGTTGCCTGCGGAAATTGCAGAACTGGTGTTTGTCCTCTGTGCTGGAGGAGTATGGGCGCTTTGCCGGTGTGAAATCAAGGAAGGCTGATTTGAGATTCATAGAGACATTTGATATTTTCTTACTGAGACAATGCCTTTACAGCATCATATATCAGTATCAAGGATACAGCTCGAAGAAAAGGCGGCTTCTCTACAAAGAAGAGACCGTACAAACATCGTCGAAAATCGCATCAATATAG | 603 | 43.62 | MEVEDSDEGGDILIPPPNFSMVEDGIFRSSFPHPSNFSFIRTLNLRSVLYLCTDPYPEENMEFLGAQNIQLFQFGIEGKTDPPVSIPKATIMNALKVLIDVRNHPILIHCKAGKHRTGCLVGCLRKLQNWCLSSVLEEYGRFAGVKSRKADLRFIETFDIFLLRQCLYSIIYQYQGYSSKKRRLLYKEETVQTSSKIASI | 200 |
Gff information

Chromosome | Start | End | Strand | Old_gene | Gene | Num |
---|---|---|---|---|---|---|
17 | 8376526 | 8378518 | - | BLOR08068 | Blo17g00522 | 72910 |
Annotation information

Select | Seq ID | Length | Analysis | Description | Start | End | IPR | GO |
---|---|---|---|---|---|---|---|---|
Blo17g00522 | 200 | PRINTS | Plant and fungal dual specificity phosphatase signature | 50 | 63 | IPR020428 | GO:0016791 | |
Blo17g00522 | 200 | PRINTS | Plant and fungal dual specificity phosphatase signature | 69 | 83 | IPR020428 | GO:0016791 | |
Blo17g00522 | 200 | PRINTS | Plant and fungal dual specificity phosphatase signature | 86 | 100 | IPR020428 | GO:0016791 | |
Blo17g00522 | 200 | PRINTS | Plant and fungal dual specificity phosphatase signature | 13 | 30 | IPR020428 | GO:0016791 | |
Blo17g00522 | 200 | PANTHER | TYROSINE-PROTEIN PHOSPHATASE | 10 | 182 | - | - | |
Blo17g00522 | 200 | CDD | PFA-DSP_Siw14 | 13 | 159 | - | - | |
Blo17g00522 | 200 | Gene3D | Protein tyrosine phosphatase superfamily | 12 | 161 | IPR029021 | - | |
Blo17g00522 | 200 | SUPERFAMILY | (Phosphotyrosine protein) phosphatases II | 13 | 160 | IPR029021 | - | |
Blo17g00522 | 200 | ProSitePatterns | Tyrosine specific protein phosphatases active site. | 108 | 118 | IPR016130 | GO:0016311|GO:0016791 | |
Blo17g00522 | 200 | ProSiteProfiles | Tyrosine specific protein phosphatases domain profile. | 89 | 121 | IPR000387 | GO:0016311|GO:0016791 | |
Blo17g00522 | 200 | Pfam | Tyrosine phosphatase family | 13 | 161 | IPR004861 | - | |
Blo17g00522 | 200 | ProSiteProfiles | Dual specificity protein phosphatase domain profile. | 18 | 174 | IPR020422 | GO:0006470|GO:0008138 | |
Blo17g00522 | 200 | PANTHER | TYROSINE-PROTEIN PHOSPHATASE DSP5 | 10 | 182 | - | - |
Duplication type information

Select | Gene1 | Location1 | Gene2 | Location2 | E-value | Duplicated-type |
---|---|---|---|---|---|---|
Blo02g00060 | Blo-Chr2:402999 | Blo17g00522 | Blo-Chr17:8376526 | 2.46E-50 | dispersed | |
Blo04g01214 | Blo-Chr4:22899915 | Blo17g00522 | Blo-Chr17:8376526 | 1.30E-44 | dispersed | |
Blo17g00522 | Blo-Chr17:8376526 | Blo13g00337 | Blo-Chr13:19362324 | 2.16E-67 | transposed |
Pathway information

Select | Query | KO | Definition | Second KO | KEGG Genes ID | GHOSTX Score |
---|---|---|---|---|---|---|
Blo17g00522 | K18045 | - | cit:102621872 | 306.219 |