Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Blo17g00673 ATGAGTTCGCGGTTCTTAAGCCAATACCCGATAAGAACCGACACTCTCTTCCTTCACACCGACCCCCCGCCCCCCCCCCGCGAAGTTCTAGATCTGGAGCTTCTCGGCCAGATCTGGAACTTCTCGGCCAGAGAAGTTCCAGATCTGGAGCTGCTCGGCCAGATCTGGAGCTGCTCGGCCAGATCTGGAACTTCTCGGTTCTCGGAATCGAGAACCGCCGGGTCCGGACCCGGAACCGACCTCAGGTTCGGGTTCGGTTCTAGACCCAAACGGTTCCAGATCGGAGGGACTCTCAGGCGGGCAGGTATTTTTTTTAAGGGAGAATTCAACCTTTTCTTGTACATGGCGACGAGGAATAGAACTTTGCTGTTCAGAAAATATAGGGATGCTTTGAAGAGCGTTAGAGTTCCGGCGAGCTCTTTGCTGGCGTCGGGTTCACCGTCGACAAGTTCTGGCGGAGGAGGTGGTCCGGTTATCGAGTTGGTCACCACCTCGATCTTGCATCCAAATCGTTCTTATGCTCCGCTTAGTACGGAGGATCCGGGTTATTCAAGTAGGGGTGCTCTTACGGTTGGTCTACCTCCAGCTTGGGTGGATGTTTCTGAAGAAATATCAACAAATGTTCAGCGTGCACGGGTAAAAATGGCTGAGTTATCCAAGGCACATGCAAAGGCTTTAATGCCTTCATTTGGAGATGGTAAAGAAGTTCAAAGATTAATTGAAGCTCTTACTCAAGAGATTACAGGTCTGATTAAGAAATCTGAGAAGAGACTTCAAAGACTTTCAGCAGCAGGACCTTCTGAAGATTCCAACGTCAGAAAAAATGTTCAGCGTTCTCTTGCCACAGACCTTCAAAATCTTTCAATGGAGCTTCGGAAAAAACAATCAAGTTACCTCAATCGGCTCAGGCAGCAAAAGGAGGGTCAAGATGGGATTGACTTAGAGATGAATCTGAATGGAAGTAGATCTACTACGGAGGATGATGACTTGGATAACATGGTTGTAGGATCTGTAAATGAGCTTGCTCAAATTATGAAGGATCTTTCAGTTCTTGTTATAGACCAGCAGGGCACTATTGTTGATAGGATTGACTATAACATTCAAAATGTTGCAACTACAGTTGAGGAAGGCCTTAAACAGCTTCAGAAGGCTGAAAGAACACAAAAACAAGGAGGGATGGTAATGTGCGCATCTGTGCTTCTTATCATGTGCTTCATCATGTTGGTTCTCCTGGTCCTCAAGGAAATATTTTTGTAG 1257 46.94 MSSRFLSQYPIRTDTLFLHTDPPPPPREVLDLELLGQIWNFSAREVPDLELLGQIWSCSARSGTSRFSESRTAGSGPGTDLRFGFGSRPKRFQIGGTLRRAGIFFKGEFNLFLYMATRNRTLLFRKYRDALKSVRVPASSLLASGSPSTSSGGGGGPVIELVTTSILHPNRSYAPLSTEDPGYSSRGALTVGLPPAWVDVSEEISTNVQRARVKMAELSKAHAKALMPSFGDGKEVQRLIEALTQEITGLIKKSEKRLQRLSAAGPSEDSNVRKNVQRSLATDLQNLSMELRKKQSSYLNRLRQQKEGQDGIDLEMNLNGSRSTTEDDDLDNMVVGSVNELAQIMKDLSVLVIDQQGTIVDRIDYNIQNVATTVEEGLKQLQKAERTQKQGGMVMCASVLLIMCFIMLVLLVLKEIFL 418
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
17 17428536 17432407 + BLOR08219 Blo17g00673 73061

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Blo17g00673 418 PANTHER SYNTAXIN 115 331 IPR045242 -
Blo17g00673 418 PANTHER SYNTAXIN 334 413 IPR045242 -
Blo17g00673 418 SMART tSNARE_6 316 384 IPR000727 -
Blo17g00673 418 Gene3D - 194 335 - -
Blo17g00673 418 SUPERFAMILY t-snare proteins 193 377 IPR010989 GO:0016020|GO:0016192
Blo17g00673 418 SMART SynN_4 188 303 IPR006011 GO:0016020
Blo17g00673 418 CDD SNARE_syntaxin16 334 383 - -
Blo17g00673 418 PANTHER SYNTAXIN-43-LIKE 115 331 - -
Blo17g00673 418 Pfam SNARE domain 358 410 IPR000727 -
Blo17g00673 418 Gene3D - 336 392 - -
Blo17g00673 418 PANTHER SYNTAXIN-43-LIKE 334 413 - -
Blo17g00673 418 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 353 384 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Blo17g00673 K08489 STX16; syntaxin 16 - jre:109011309 473.011
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Blo17g00673 Blo-Chr17:17428536 Blo18g00633 Blo-Chr18:10785740 0 wgd
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Blo18g00047 . 82 420 SNARE and Associated Proteins AT3G24350 60.1 5.5e-93 338.2
Blo17g00037 BCT 445 752 SNARE and Associated Proteins AT3G24350 62.3 1.9e-90 329.7
Blo04g00912 BCT 1 286 SNARE and Associated Proteins AT2G18260 53.8 5.1e-76 281.6
Blo15g00703 . 102 394 SNARE and Associated Proteins AT2G18260 50.2 4.3e-75 278.5
Blo01g00722 . 1 289 SNARE and Associated Proteins AT2G18260 50.2 1.5e-72 270.0
Blo16g00051 BCT 1 271 SNARE and Associated Proteins AT2G18260 51.6 6.1e-69 258.1
Blo09g00464 . 22 278 SNARE and Associated Proteins AT3G11820 81.3 3.2e-113 405.2
Blo12g00540 . 1 261 SNARE and Associated Proteins AT3G11820 73.6 7.1e-105 377.5
Blo08g00183 . 954 1204 SNARE and Associated Proteins AT3G11820 66.1 3.3e-94 342.0
Blo14g00365 . 31 281 SNARE and Associated Proteins AT3G11820 65.7 1.3e-93 340.1
Blo09g00464 . 29 278 SNARE and Associated Proteins AT3G52400 70.0 2.4e-90 329.3
Blo12g00540 . 13 261 SNARE and Associated Proteins AT3G52400 65.5 7.5e-84 307.8
Blo14g00365 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 9.1e-82 300.8
Blo08g00183 . 924 1204 SNARE and Associated Proteins AT3G52400 56.4 1.2e-81 300.4
Blo14g00365 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 7.8e-109 390.6
Blo08g00183 . 924 1218 SNARE and Associated Proteins AT4G03330 67.1 2.8e-106 382.1
Blo09g00464 . 1 278 SNARE and Associated Proteins AT4G03330 58.0 5.1e-84 308.1
Blo12g00540 . 10 261 SNARE and Associated Proteins AT4G03330 56.7 1.7e-74 276.6
Blo15g00503 . 136 373 SNARE and Associated Proteins AT4G03330 50.8 1.0e-55 214.2
Blo14g00365 . 1 299 SNARE and Associated Proteins AT1G61290 78.3 1.2e-125 446.4
Blo08g00183 . 924 1226 SNARE and Associated Proteins AT1G61290 77.6 5.0e-124 441.0
Blo09g00464 . 1 272 SNARE and Associated Proteins AT1G61290 63.5 3.1e-89 325.5
Blo12g00540 . 13 261 SNARE and Associated Proteins AT1G61290 61.8 6.9e-81 297.7
Blo14g00365 . 1 299 SNARE and Associated Proteins AT1G11250 76.6 1.8e-121 432.6
Blo08g00183 . 924 1226 SNARE and Associated Proteins AT1G11250 75.9 8.7e-121 430.3
Blo09g00464 . 1 272 SNARE and Associated Proteins AT1G11250 64.3 1.2e-93 340.1
Blo12g00540 . 3 261 SNARE and Associated Proteins AT1G11250 61.0 2.2e-84 309.3
Blo15g00503 . 96 396 SNARE and Associated Proteins AT3G03800 59.8 7.7e-88 320.9
Blo12g00540 . 13 277 SNARE and Associated Proteins AT3G03800 51.5 4.0e-60 228.8
Blo15g00503 . 97 293 SNARE and Associated Proteins AT5G08080 60.4 8.4e-52 200.7
Blo02g00982 . 1 263 SNARE and Associated Proteins AT5G16830 61.3 1.4e-75 280.0
Blo03g00106 . 225 443 SNARE and Associated Proteins AT5G16830 57.3 4.7e-60 228.4
Blo02g00982 . 1 274 SNARE and Associated Proteins AT5G46860 69.7 5.9e-84 307.8
Blo03g00106 . 225 414 SNARE and Associated Proteins AT5G46860 76.3 7.5e-71 264.2
Blo02g00982 . 1 257 SNARE and Associated Proteins AT4G17730 65.8 8.9e-77 283.9
Blo03g00106 . 225 414 SNARE and Associated Proteins AT4G17730 76.2 3.5e-73 271.9
Blo18g00562 BCT 1 182 SNARE and Associated Proteins AT4G17730 51.5 1.1e-42 170.6
Blo02g00982 . 65 256 SNARE and Associated Proteins AT1G32270 59.4 9.2e-50 194.5
Blo03g00106 . 289 440 SNARE and Associated Proteins AT1G32270 64.5 1.2e-44 177.6
Blo04g00243 . 1 337 SNARE and Associated Proteins AT5G05760 65.8 2.4e-111 399.1
Blo18g00047 . 82 420 SNARE and Associated Proteins AT3G24350 60.1 5.5e-93 338.2
Blo17g00037 BCT 445 752 SNARE and Associated Proteins AT3G24350 62.3 1.9e-90 329.7
Blo18g00633 . 1 341 SNARE and Associated Proteins AT5G26980 74.8 9.1e-124 440.3
Blo17g00673 . 115 418 SNARE and Associated Proteins AT5G26980 71.4 1.6e-112 402.9
Blo18g00633 . 1 339 SNARE and Associated Proteins AT4G02195 62.8 2.1e-99 359.4
Blo17g00673 . 115 416 SNARE and Associated Proteins AT4G02195 60.9 7.1e-92 334.3
Blo18g00633 . 1 339 SNARE and Associated Proteins AT3G05710 74.9 4.5e-126 448.0
Blo17g00673 . 115 416 SNARE and Associated Proteins AT3G05710 71.7 2.6e-113 405.6
Blo03g00538 . 1 220 SNARE and Associated Proteins AT1G16240 72.7 2.3e-84 308.9
Blo07g00879 . 34 267 SNARE and Associated Proteins AT1G16240 58.5 7.1e-70 260.8
Blo03g00538 . 1 220 SNARE and Associated Proteins AT1G79590 71.8 2.0e-84 309.3
Blo07g00879 . 34 267 SNARE and Associated Proteins AT1G79590 59.8 1.6e-70 263.1
Blo03g00554 . 55 234 SNARE and Associated Proteins AT1G28490 66.1 5.8e-60 227.6
Blo03g01454 . 55 215 SNARE and Associated Proteins AT1G28490 60.9 1.6e-49 193.0
Blo07g01404 . 1 248 SNARE and Associated Proteins AT3G09740 72.4 4.0e-93 338.2
Blo14g00167 . 1 233 SNARE and Associated Proteins AT3G09740 61.0 4.8e-70 261.5
Blo07g01404 . 1 248 SNARE and Associated Proteins AT3G45280 60.4 5.5e-74 274.6
Blo14g00167 . 1 236 SNARE and Associated Proteins AT3G45280 57.7 1.4e-66 250.0
Blo07g01404 . 1 248 SNARE and Associated Proteins AT3G61450 60.6 5.2e-77 284.6
Blo14g00167 . 1 235 SNARE and Associated Proteins AT3G61450 53.8 3.6e-62 235.3
Blo04g00134 . 624 868 SNARE and Associated Proteins AT1G51740 72.4 2.7e-91 332.0
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003497 3 1 2 2 1 1 2 1 1 1 1 1 2 1 1 2 1 2 2 1 1 1 1 1 1 1 1 4 4 2 46
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Blo17g00673 Blo_Chr17 FPKM 19.953314 22.733635 22.632675 24.194475 35.396919 35.609734 32.690582 29.03731 27.751999 28.603374