Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Bma03g00258	ATGGCAACTACTTATCGAGATCGGACGACGGAGTTTCTATCTTTATCTGAGACGTTGAAGAAGATCGGACCAATCAAAATAGTTAGTCAAGCTGAAAACGAGACCTCTCTTTCTAAACCTTCCCGACCTGTCTCTTCCAAGTCAGAATTCAACAGGAAGGCTGCGCAAATTTCTTTTGGAATGCATGAGACCTCTCATAAGATTACTCGACTTGCGCAATTGGCAAAAAGATCATCAATGTTTGATGACCCAATTGTGGAAATACAGGAATTGACCGTTTTCATAAAGAACGATATAACAGCTTTGAATGTAGCTCTCTCTGATCTACAAACTATTCAAAACATGGAAATGGCCGATGGGAGCTATTCTGAGGATAAAGTTGTTCACTCAACAGCTGTTTGTGATGACTTGAAAAACAGACTCATGGGGGTCACTAAACATCTTAAAAATGTGTTAACAACAAGAACAGAGAACATAAAAGCAAATGAGAGTAGGAAGCAGATATTCTCCGCAACTGTAACTAAAGAAAATGCTTCTCAAAATCATGCAAAGACAGTGTCTCAGCCACCACCGTGGTTAATTTCATCAAATACATCTGAGAGTTCTCAACCACCAACATTGCCAGTAAATGGAGCCCAAGTTGGTAGTCAACTGAGGAGAAGGTTAGCTGTCGAAAACACTCCATCTCAGCATATGGAAATGTCAATGTTACAGCAGGTGGTTCCAAGACAGGAAATTTATTCAGAAAGTCGTGGGATTGCTCTTCATAATGTTGAGTCTACGATTTCAGAACTCAGTGGAATCTTTACGCATTTGGCGACAATGGTTGCTCATCAAGGGGAACTGGCTATCAGGATTGACGATAACATGGATGAATCGTTGGCTAATGTTGAAGGTGCTCGCAGCTCTCTATTAAGGCATCTCAACCGAATATCGTCTAATAGGTGGCTTATGATCAAAATATTTGGGATAGTATACCAAGCCAACCAGGGGAAATTCCATTCTGAGGCTGACAAGAACCGGTGGAAGGCAATTGCTGAGCTCCTTCCAAATGAAGTGCCCGCCATTGAAAAAAGGAGAGGGAAGAAAGATCAAGAAAAGAAGCCATCTATCAATGTCGTTCAAGGTCCAAAACCAGGGAAGCCAACTGACCTTTCAAGGATGCGACAAATTCTCCTGAAATTGAAGCACAACACACCCCCCCACTTGAAGCCTACGCCTCCTCCCGCACTCGCCGAGAAGGATCCTGCATCAGCTGATCCTCCATCGAATGCTACAGTTTCGTTAACTCCTCAAGCAGTAGTTGTCACTTAG	1314	42.69	MATTYRDRTTEFLSLSETLKKIGPIKIVSQAENETSLSKPSRPVSSKSEFNRKAAQISFGMHETSHKITRLAQLAKRSSMFDDPIVEIQELTVFIKNDITALNVALSDLQTIQNMEMADGSYSEDKVVHSTAVCDDLKNRLMGVTKHLKNVLTTRTENIKANESRKQIFSATVTKENASQNHAKTVSQPPPWLISSNTSESSQPPTLPVNGAQVGSQLRRRLAVENTPSQHMEMSMLQQVVPRQEIYSESRGIALHNVESTISELSGIFTHLATMVAHQGELAIRIDDNMDESLANVEGARSSLLRHLNRISSNRWLMIKIFGIVYQANQGKFHSEADKNRWKAIAELLPNEVPAIEKRRGKKDQEKKPSINVVQGPKPGKPTDLSRMRQILLKLKHNTPPHLKPTPPPALAEKDPASADPPSNATVSLTPQAVVVT	437

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
3	1980011	1985019	-	Bma016532.2	Bma03g00258	78931

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Bma03g00258	437	MobiDBLite	consensus disorder prediction	357	437	-	-
Bma03g00258	437	MobiDBLite	consensus disorder prediction	421	437	-	-
Bma03g00258	437	ProSitePatterns	Syntaxin / epimorphin family signature.	251	290	IPR006012	GO:0005484\|GO:0006886\|GO:0016020
Bma03g00258	437	MobiDBLite	consensus disorder prediction	175	211	-	-
Bma03g00258	437	Gene3D	-	45	300	-	-
Bma03g00258	437	ProSiteProfiles	t-SNARE coiled-coil homology domain profile.	245	307	IPR000727	-
Bma03g00258	437	PANTHER	SYNTAXIN	4	325	IPR045242	-
Bma03g00258	437	SMART	tSNARE_6	240	307	IPR000727	-
Bma03g00258	437	MobiDBLite	consensus disorder prediction	401	415	-	-
Bma03g00258	437	Pfam	Syntaxin-5 N-terminal, Sly1p-binding domain	3	21	IPR021538	-
Bma03g00258	437	CDD	SNARE_syntaxin5	248	325	-	-
Bma03g00258	437	PANTHER	SYNTAXIN-31	4	325	-	-
Bma03g00258	437	Pfam	SNARE domain	282	325	IPR000727	-
Bma03g00258	437	SUPERFAMILY	t-snare proteins	48	300	IPR010989	GO:0016020\|GO:0016192

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Bma03g00258	K08490	STX5; syntaxin 5	-	jre:108991917	480.33

Dupl-types

Select	Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
	Bma03g00258	Bma-Chr3:1980011	Bma07g00365	Bma-Chr7:4561929	3.03E-33	dispersed
	Bma03g00258	Bma-Chr3:1980011	Bma02g00044	Bma-Chr2:405104	3.50E-80	transposed

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi13g27	.	.	.	.	.	Bpe15g01150	Bma03g00258	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Blo04g00241	Bda14g00260	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Bma02g00044	.	444	806	SNARE and Associated Proteins	AT3G24350	60.5	7.5e-102	367.5
Bma05g00445	.	1	293	SNARE and Associated Proteins	AT2G18260	52.1	1.2e-79	293.5
Bma05g00439	.	1	293	SNARE and Associated Proteins	AT2G18260	51.8	5.8e-79	291.2
Bma12g00507	.	1	293	SNARE and Associated Proteins	AT2G18260	51.8	4.1e-77	285.0
Bma04g01535	.	1243	1499	SNARE and Associated Proteins	AT3G11820	81.7	4.4e-114	407.9
Bma10g00132	.	22	278	SNARE and Associated Proteins	AT3G11820	79.8	7.0e-112	400.6
Bma04g00526	.	19	279	SNARE and Associated Proteins	AT3G11820	75.1	1.0e-107	386.7
Bma07g00353	.	36	286	SNARE and Associated Proteins	AT3G11820	67.3	1.7e-94	342.8
Bma11g00374	.	36	286	SNARE and Associated Proteins	AT3G11820	65.7	2.5e-93	339.0
Bma10g00004	.	27	285	SNARE and Associated Proteins	AT3G11820	50.2	3.1e-67	252.3
Bma01g02014	.	22	222	SNARE and Associated Proteins	AT3G11820	54.8	2.4e-64	242.7
Bma04g01535	.	1250	1499	SNARE and Associated Proteins	AT3G52400	70.4	9.6e-91	330.5
Bma04g00526	.	1	279	SNARE and Associated Proteins	AT3G52400	61.9	1.5e-88	323.2
Bma10g00132	.	29	272	SNARE and Associated Proteins	AT3G52400	68.9	7.6e-88	320.9
Bma07g00353	.	6	286	SNARE and Associated Proteins	AT3G52400	57.0	6.2e-82	301.2
Bma11g00374	.	6	286	SNARE and Associated Proteins	AT3G52400	55.7	1.2e-80	297.0
Bma11g00374	.	6	304	SNARE and Associated Proteins	AT4G03330	66.6	5.0e-107	384.4
Bma07g00353	.	6	304	SNARE and Associated Proteins	AT4G03330	67.2	6.6e-107	384.0
Bma04g01535	.	1222	1499	SNARE and Associated Proteins	AT4G03330	56.0	9.5e-82	300.4
Bma10g00132	.	29	278	SNARE and Associated Proteins	AT4G03330	58.8	8.1e-81	297.4
Bma04g00526	.	1	279	SNARE and Associated Proteins	AT4G03330	55.4	4.9e-78	288.1
Bma10g00004	.	1	285	SNARE and Associated Proteins	AT4G03330	50.2	5.6e-66	248.1
Bma11g00374	.	6	304	SNARE and Associated Proteins	AT1G61290	78.3	6.9e-125	443.7
Bma07g00353	.	6	308	SNARE and Associated Proteins	AT1G61290	77.9	7.7e-124	440.3
Bma04g01535	.	1222	1493	SNARE and Associated Proteins	AT1G61290	62.9	2.7e-89	325.5
Bma10g00132	.	1	281	SNARE and Associated Proteins	AT1G61290	58.8	1.7e-86	316.2
Bma04g00526	.	1	279	SNARE and Associated Proteins	AT1G61290	59.4	5.4e-85	311.2
Bma07g00353	.	6	308	SNARE and Associated Proteins	AT1G11250	76.6	1.3e-120	429.5
Bma11g00374	.	6	304	SNARE and Associated Proteins	AT1G11250	75.9	3.0e-120	428.3
Bma04g01535	.	1222	1493	SNARE and Associated Proteins	AT1G11250	64.3	1.8e-93	339.3
Bma10g00132	.	1	281	SNARE and Associated Proteins	AT1G11250	60.1	6.4e-91	330.9
Bma04g00526	.	1	279	SNARE and Associated Proteins	AT1G11250	61.3	4.6e-89	324.7
Bma10g00004	.	1	306	SNARE and Associated Proteins	AT3G03800	76.5	1.2e-116	416.4
Bma10g00004	.	1	204	SNARE and Associated Proteins	AT5G08080	75.5	6.1e-78	287.3
Bma12g00235	BCT	1	263	SNARE and Associated Proteins	AT5G16830	62.8	6.5e-77	284.3
Bma05g00704	BCT	1	148	SNARE and Associated Proteins	AT5G16830	58.4	3.1e-39	159.1
Bma12g00235	BCT	1	263	SNARE and Associated Proteins	AT5G46860	70.7	2.0e-83	305.8
Bma05g00704	BCT	1	153	SNARE and Associated Proteins	AT5G46860	75.8	2.5e-57	219.2
Bma12g00235	BCT	1	257	SNARE and Associated Proteins	AT4G17730	64.2	9.7e-75	276.9
Bma05g00704	BCT	1	148	SNARE and Associated Proteins	AT4G17730	72.2	8.0e-53	204.1
Bma06g00441	.	1	182	SNARE and Associated Proteins	AT4G17730	54.1	1.2e-43	173.7
Bma12g00235	BCT	65	256	SNARE and Associated Proteins	AT1G32270	58.3	1.8e-49	193.4
Bma03g00258	.	1	325	SNARE and Associated Proteins	AT5G05760	65.4	3.5e-109	391.7
Bma02g00044	.	444	806	SNARE and Associated Proteins	AT3G24350	60.5	7.5e-102	367.5
Bma01g00625	.	1	341	SNARE and Associated Proteins	AT5G26980	75.4	2.5e-125	445.3
Bma05g00265	.	1	339	SNARE and Associated Proteins	AT5G26980	74.0	9.0e-123	436.8
Bma01g00625	.	1	339	SNARE and Associated Proteins	AT4G02195	63.9	2.6e-101	365.5
Bma05g00265	.	1	337	SNARE and Associated Proteins	AT4G02195	63.4	3.7e-100	361.7
Bma01g00625	.	1	339	SNARE and Associated Proteins	AT3G05710	75.2	4.7e-127	451.1
Bma05g00265	.	1	337	SNARE and Associated Proteins	AT3G05710	75.4	6.2e-127	450.7
Bma07g01281	BCT	1	232	SNARE and Associated Proteins	AT1G16240	65.4	7.0e-77	283.9
Bma10g00582	.	1	230	SNARE and Associated Proteins	AT1G16240	58.4	4.9e-70	261.2
Bma14g00320	BCT	1	232	SNARE and Associated Proteins	AT1G16240	57.6	2.3e-64	242.3
Bma07g01281	BCT	1	232	SNARE and Associated Proteins	AT1G79590	65.0	1.9e-78	289.3
Bma10g00582	.	1	230	SNARE and Associated Proteins	AT1G79590	59.4	6.1e-69	257.7
Bma14g00320	BCT	1	232	SNARE and Associated Proteins	AT1G79590	59.6	6.8e-68	254.2
Bma07g01292	.	86	281	SNARE and Associated Proteins	AT1G28490	68.4	1.3e-66	249.6
Bma07g01329	.	86	281	SNARE and Associated Proteins	AT1G28490	66.3	5.9e-64	240.7
Bma14g00333	.	55	235	SNARE and Associated Proteins	AT1G28490	65.2	5.7e-59	224.2
Bma11g00164	.	1	286	SNARE and Associated Proteins	AT3G09740	56.1	6.0e-80	294.3
Bma11g00164	.	1	286	SNARE and Associated Proteins	AT3G45280	55.7	2.1e-77	285.8
Bma11g00164	.	1	286	SNARE and Associated Proteins	AT3G61450	52.3	4.8e-74	274.6
Bma03g00162	.	33	278	SNARE and Associated Proteins	AT1G51740	71.2	7.7e-90	327.0

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0006940	1	1	1	1	1	1	2	1	1	1	1	1	2	1	1	2	1	1	2	1	1	1	1	1	1	1	1	3	1	1	36

Transcriptome

Select	Gene	Chr	Type	da1	da2	da3	da4	da5	da6	da7	da8	da9	da10
	Bma03g00258	Bma_Chr03	FPKM	6.986604	7.92966	7.66279	7.661599	8.869856	7.618959	8.132618	10.559177	10.402081	11.691012