Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Bma07g01329 AAGTTCAATATGCCTTCAGCTCAAGATCCATTCTACGTTGTGAAGGATGAAATCCAAGAATCTATTGATAAGTTGCAACAAACTTTTCACCGATGGGAGCTCATTTCTGATTTAGGAGAGCGATCAAAACTTACAAATGAGCTGCTTGCTAGCTGTGATAGTATTGAGTGGCAGATCTTCCACTCTATCAAGTACTTTTTGATGGTTATGAGTAAGTCTATGATTCTTAGCATGAGAGCAATTAAAAAAATAGATGAAAAAACAGTAGATGAATTAGACAAGGCTATAGCTGTTGCTGTCAGAGATCCGGCTTGGTATGGAATTGATGAAGTGGAGCTTGAAAAACGGAGGAGATGGACTAGTACAGCTCGCGCTCAGGTTGGCTCTGTGAAAAAGGTAGTGAAAACTGGGAAGGAGCTGAATGGTATTGGCAATACGACCACAAATATGAATGGAATACGTCGAGAACTGTTGAGACTGCCTAATCCTAATGAAAGAGACGGGGCCAACCAGTACGATGTTCAAGACAATGATGATTTCATAGCTTCGGAATCAGATCGGCAGTTGCTTCTCATAAAGCGACAAGATGAAGAATTGGATGAGCTCAGTGCCAGCGTGGAGAGAATTGGAGGAGTTGGGCTAACAATACATGATGAACTCCTTTCCCAGGAGAAAATTATCGATGAATTAGGAGCGGAACTGGATAGTACATCAAATCGTCTTGACTTTGTTCAGAAAAAAGTAGCCGTGGTCATGAAGAAGGCTGGTATTAAGGGGCAGATAATGATGATTGCGTTTTTAGTGGTTTTGTTCATAATTCTCTTTGTGCTGGTGTTTTTAACTTAG 846 40.78 KFNMPSAQDPFYVVKDEIQESIDKLQQTFHRWELISDLGERSKLTNELLASCDSIEWQIFHSIKYFLMVMSKSMILSMRAIKKIDEKTVDELDKAIAVAVRDPAWYGIDEVELEKRRRWTSTARAQVGSVKKVVKTGKELNGIGNTTTNMNGIRRELLRLPNPNERDGANQYDVQDNDDFIASESDRQLLLIKRQDEELDELSASVERIGGVGLTIHDELLSQEKIIDELGAELDSTSNRLDFVQKKVAVVMKKAGIKGQIMMIAFLVVLFIILFVLVFLT 281
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
7 48806264 48808773 + Bma026605.1 Bma07g01329 86466

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Bma07g01329 281 Pfam SNARE domain 226 277 IPR000727 -
Bma07g01329 281 SMART tSNARE_6 184 251 IPR000727 -
Bma07g01329 281 CDD SNARE_Qc 192 249 - -
Bma07g01329 281 SUPERFAMILY t-snare proteins 86 132 IPR010989 GO:0016020|GO:0016192
Bma07g01329 281 Gene3D - 77 137 - -
Bma07g01329 281 Gene3D - 5 62 - -
Bma07g01329 281 Coils Coil 227 247 - -
Bma07g01329 281 Gene3D - 196 258 - -
Bma07g01329 281 PANTHER SYNTAXIN PROTEIN 84 280 - -
Bma07g01329 281 PANTHER SYNTAXIN PROTEIN 4 59 - -
Bma07g01329 281 SUPERFAMILY SNARE fusion complex 188 251 - -
Bma07g01329 281 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 189 251 IPR000727 -
Bma07g01329 281 Pfam Syntaxin 6, N-terminal 9 59 IPR015260 GO:0016020|GO:0048193
Bma07g01329 281 Pfam Syntaxin 6, N-terminal 86 131 IPR015260 GO:0016020|GO:0048193
Bma07g01329 281 PANTHER SYNTAXIN 84 280 IPR045242 -
Bma07g01329 281 PANTHER SYNTAXIN 4 59 IPR045242 -
Bma07g01329 281 SUPERFAMILY t-snare proteins 8 59 IPR010989 GO:0016020|GO:0016192
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bma07g01329 K08500 SYP6; syntaxin of plants SYP6 - qsu:112025744 330.102
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Bma07g01329 Bma-Chr7:48806264 Bma14g00333 Bma-Chr14:4169954 6.45E-149 dispersed
Bma07g01329 Bma-Chr7:48806264 Bma07g01292 Bma-Chr7:48531868 0 transposed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bma02g00044 . 444 806 SNARE and Associated Proteins AT3G24350 60.5 7.5e-102 367.5
Bma05g00445 . 1 293 SNARE and Associated Proteins AT2G18260 52.1 1.2e-79 293.5
Bma05g00439 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 5.8e-79 291.2
Bma12g00507 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 4.1e-77 285.0
Bma04g01535 . 1243 1499 SNARE and Associated Proteins AT3G11820 81.7 4.4e-114 407.9
Bma10g00132 . 22 278 SNARE and Associated Proteins AT3G11820 79.8 7.0e-112 400.6
Bma04g00526 . 19 279 SNARE and Associated Proteins AT3G11820 75.1 1.0e-107 386.7
Bma07g00353 . 36 286 SNARE and Associated Proteins AT3G11820 67.3 1.7e-94 342.8
Bma11g00374 . 36 286 SNARE and Associated Proteins AT3G11820 65.7 2.5e-93 339.0
Bma10g00004 . 27 285 SNARE and Associated Proteins AT3G11820 50.2 3.1e-67 252.3
Bma01g02014 . 22 222 SNARE and Associated Proteins AT3G11820 54.8 2.4e-64 242.7
Bma04g01535 . 1250 1499 SNARE and Associated Proteins AT3G52400 70.4 9.6e-91 330.5
Bma04g00526 . 1 279 SNARE and Associated Proteins AT3G52400 61.9 1.5e-88 323.2
Bma10g00132 . 29 272 SNARE and Associated Proteins AT3G52400 68.9 7.6e-88 320.9
Bma07g00353 . 6 286 SNARE and Associated Proteins AT3G52400 57.0 6.2e-82 301.2
Bma11g00374 . 6 286 SNARE and Associated Proteins AT3G52400 55.7 1.2e-80 297.0
Bma11g00374 . 6 304 SNARE and Associated Proteins AT4G03330 66.6 5.0e-107 384.4
Bma07g00353 . 6 304 SNARE and Associated Proteins AT4G03330 67.2 6.6e-107 384.0
Bma04g01535 . 1222 1499 SNARE and Associated Proteins AT4G03330 56.0 9.5e-82 300.4
Bma10g00132 . 29 278 SNARE and Associated Proteins AT4G03330 58.8 8.1e-81 297.4
Bma04g00526 . 1 279 SNARE and Associated Proteins AT4G03330 55.4 4.9e-78 288.1
Bma10g00004 . 1 285 SNARE and Associated Proteins AT4G03330 50.2 5.6e-66 248.1
Bma11g00374 . 6 304 SNARE and Associated Proteins AT1G61290 78.3 6.9e-125 443.7
Bma07g00353 . 6 308 SNARE and Associated Proteins AT1G61290 77.9 7.7e-124 440.3
Bma04g01535 . 1222 1493 SNARE and Associated Proteins AT1G61290 62.9 2.7e-89 325.5
Bma10g00132 . 1 281 SNARE and Associated Proteins AT1G61290 58.8 1.7e-86 316.2
Bma04g00526 . 1 279 SNARE and Associated Proteins AT1G61290 59.4 5.4e-85 311.2
Bma07g00353 . 6 308 SNARE and Associated Proteins AT1G11250 76.6 1.3e-120 429.5
Bma11g00374 . 6 304 SNARE and Associated Proteins AT1G11250 75.9 3.0e-120 428.3
Bma04g01535 . 1222 1493 SNARE and Associated Proteins AT1G11250 64.3 1.8e-93 339.3
Bma10g00132 . 1 281 SNARE and Associated Proteins AT1G11250 60.1 6.4e-91 330.9
Bma04g00526 . 1 279 SNARE and Associated Proteins AT1G11250 61.3 4.6e-89 324.7
Bma10g00004 . 1 306 SNARE and Associated Proteins AT3G03800 76.5 1.2e-116 416.4
Bma10g00004 . 1 204 SNARE and Associated Proteins AT5G08080 75.5 6.1e-78 287.3
Bma12g00235 BCT 1 263 SNARE and Associated Proteins AT5G16830 62.8 6.5e-77 284.3
Bma05g00704 BCT 1 148 SNARE and Associated Proteins AT5G16830 58.4 3.1e-39 159.1
Bma12g00235 BCT 1 263 SNARE and Associated Proteins AT5G46860 70.7 2.0e-83 305.8
Bma05g00704 BCT 1 153 SNARE and Associated Proteins AT5G46860 75.8 2.5e-57 219.2
Bma12g00235 BCT 1 257 SNARE and Associated Proteins AT4G17730 64.2 9.7e-75 276.9
Bma05g00704 BCT 1 148 SNARE and Associated Proteins AT4G17730 72.2 8.0e-53 204.1
Bma06g00441 . 1 182 SNARE and Associated Proteins AT4G17730 54.1 1.2e-43 173.7
Bma12g00235 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 1.8e-49 193.4
Bma03g00258 . 1 325 SNARE and Associated Proteins AT5G05760 65.4 3.5e-109 391.7
Bma02g00044 . 444 806 SNARE and Associated Proteins AT3G24350 60.5 7.5e-102 367.5
Bma01g00625 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.5e-125 445.3
Bma05g00265 . 1 339 SNARE and Associated Proteins AT5G26980 74.0 9.0e-123 436.8
Bma01g00625 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bma05g00265 . 1 337 SNARE and Associated Proteins AT4G02195 63.4 3.7e-100 361.7
Bma01g00625 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.7e-127 451.1
Bma05g00265 . 1 337 SNARE and Associated Proteins AT3G05710 75.4 6.2e-127 450.7
Bma07g01281 BCT 1 232 SNARE and Associated Proteins AT1G16240 65.4 7.0e-77 283.9
Bma10g00582 . 1 230 SNARE and Associated Proteins AT1G16240 58.4 4.9e-70 261.2
Bma14g00320 BCT 1 232 SNARE and Associated Proteins AT1G16240 57.6 2.3e-64 242.3
Bma07g01281 BCT 1 232 SNARE and Associated Proteins AT1G79590 65.0 1.9e-78 289.3
Bma10g00582 . 1 230 SNARE and Associated Proteins AT1G79590 59.4 6.1e-69 257.7
Bma14g00320 BCT 1 232 SNARE and Associated Proteins AT1G79590 59.6 6.8e-68 254.2
Bma07g01292 . 86 281 SNARE and Associated Proteins AT1G28490 68.4 1.3e-66 249.6
Bma07g01329 . 86 281 SNARE and Associated Proteins AT1G28490 66.3 5.9e-64 240.7
Bma14g00333 . 55 235 SNARE and Associated Proteins AT1G28490 65.2 5.7e-59 224.2
Bma11g00164 . 1 286 SNARE and Associated Proteins AT3G09740 56.1 6.0e-80 294.3
Bma11g00164 . 1 286 SNARE and Associated Proteins AT3G45280 55.7 2.1e-77 285.8
Bma11g00164 . 1 286 SNARE and Associated Proteins AT3G61450 52.3 4.8e-74 274.6
Bma03g00162 . 33 278 SNARE and Associated Proteins AT1G51740 71.2 7.7e-90 327.0
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Bma07g01329 Bma_Chr07 FPKM 3.406633 2.888652 4.479159 4.487004 5.455065 5.851618 5.752716 11.734148 12.401407 12.251265