Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Bma10g00004 ATGAACGACCTTCTATCGGATTCATTTGAGATCCCCCAGGGTCAGCCTTCTAGAAGTGGAGACATTGAGCTAGGATTAAACCCTCCAATGAATTCAGGAGAGCTTGGCTTGGAGAATTTCTTTAAAAAGGTTCAGGAAATTGAGAAACAGAATGAGACACTGGATAAGCTGCTTAAAAAGCTCCAGATTGCCAATGAAGAGTCGAAAGCGGTAACTAAGGCTCCTGCTATGAAAGCGATCAAGCAGCGGATGGAAAAGGACGTCGATGAAGTTGGGAAAATTGCACGTACGATAAAGATAAAAATTGAAGAACTTGACAGAGAGAATTTGGCAAATAGGCAGAAACCAGGTTGCGGGAAAGGAACAGGAGTAGATAGATCAAGATCTGCAACAACTCTTGCCTTGAAAAAGAAGTTCAAAGACAAGCTGGCTGAATTTCAGATTTTGCGGGAAACCATTCATCAAGAATACAGGGAAGTCGTTGAGAGACGTGTTTTCACAGTGACGGGCACAAGAGCTGATGAAGAGACAATTGACAAATTAATTGAGACTGGAGATAGTGAACAAATTTTCCAAAAGGCGATTCAAGAACAAGGACGAGGGCAGATAAAAGATACCCTGGCAGAAATTCAGGAGCGTCATAGTGCAGTTAGAGACTTGGAAAGAAAGCTCCTCGAGTTACAACAGGTATTTCTGGATATGGCAGTATTAGTGGATGCACAAGGGGATATGCTTGACAATATCGAAACACATGTATCAAATGCAGTAGATCATGTACAGCAAGGAAATACGGCGCTCCAAAAGGCCAAGAAATTACAAAGGAATTCCAGGAAATGGATGTGCATTGCCATCATCATACTTCTTATAATTGTCATTGTCATTATTCTGGGTGTCCTCAAGCCCTGGGACAAGAAGAGTAAGTAA 924 41.88 MNDLLSDSFEIPQGQPSRSGDIELGLNPPMNSGELGLENFFKKVQEIEKQNETLDKLLKKLQIANEESKAVTKAPAMKAIKQRMEKDVDEVGKIARTIKIKIEELDRENLANRQKPGCGKGTGVDRSRSATTLALKKKFKDKLAEFQILRETIHQEYREVVERRVFTVTGTRADEETIDKLIETGDSEQIFQKAIQEQGRGQIKDTLAEIQERHSAVRDLERKLLELQQVFLDMAVLVDAQGDMLDNIETHVSNAVDHVQQGNTALQKAKKLQRNSRKWMCIAIIILLIIVIVIILGVLKPWDKKSK 307
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
10 154588 183070 + Bma003626.1 Bma10g00004 89067

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Bma10g00004 307 SUPERFAMILY t-snare proteins 36 262 IPR010989 GO:0016020|GO:0016192
Bma10g00004 307 Pfam SNARE domain 243 295 IPR000727 -
Bma10g00004 307 MobiDBLite consensus disorder prediction 1 15 - -
Bma10g00004 307 CDD SNARE_syntaxin1-like 206 268 - -
Bma10g00004 307 Pfam Syntaxin 39 242 IPR006011 GO:0016020
Bma10g00004 307 PANTHER - 3 299 - -
Bma10g00004 307 Gene3D - 35 161 - -
Bma10g00004 307 CDD SynN 37 194 IPR006011 GO:0016020
Bma10g00004 307 PANTHER SYNTAXIN 3 299 IPR045242 -
Bma10g00004 307 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 207 269 IPR000727 -
Bma10g00004 307 Gene3D - 197 299 - -
Bma10g00004 307 MobiDBLite consensus disorder prediction 1 24 - -
Bma10g00004 307 SMART SynN_4 32 158 IPR006011 GO:0016020
Bma10g00004 307 ProSitePatterns Syntaxin / epimorphin family signature. 213 252 IPR006012 GO:0005484|GO:0006886|GO:0016020
Bma10g00004 307 SMART tSNARE_6 202 269 IPR000727 -
Bma10g00004 307 Coils Coil 37 74 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bma10g00004 K08486 STX1B_2_3; syntaxin 1B/2/3 - cpap:110814967 490.73
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Bma10g00004 Bma-Chr10:154588 Bma11g00374 Bma-Chr11:4077034 2.96E-93 dispersed
Bma10g00004 Bma-Chr10:154588 Bma07g00353 Bma-Chr7:4463222 3.00E-95 transposed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bma02g00044 . 444 806 SNARE and Associated Proteins AT3G24350 60.5 7.5e-102 367.5
Bma05g00445 . 1 293 SNARE and Associated Proteins AT2G18260 52.1 1.2e-79 293.5
Bma05g00439 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 5.8e-79 291.2
Bma12g00507 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 4.1e-77 285.0
Bma04g01535 . 1243 1499 SNARE and Associated Proteins AT3G11820 81.7 4.4e-114 407.9
Bma10g00132 . 22 278 SNARE and Associated Proteins AT3G11820 79.8 7.0e-112 400.6
Bma04g00526 . 19 279 SNARE and Associated Proteins AT3G11820 75.1 1.0e-107 386.7
Bma07g00353 . 36 286 SNARE and Associated Proteins AT3G11820 67.3 1.7e-94 342.8
Bma11g00374 . 36 286 SNARE and Associated Proteins AT3G11820 65.7 2.5e-93 339.0
Bma10g00004 . 27 285 SNARE and Associated Proteins AT3G11820 50.2 3.1e-67 252.3
Bma01g02014 . 22 222 SNARE and Associated Proteins AT3G11820 54.8 2.4e-64 242.7
Bma04g01535 . 1250 1499 SNARE and Associated Proteins AT3G52400 70.4 9.6e-91 330.5
Bma04g00526 . 1 279 SNARE and Associated Proteins AT3G52400 61.9 1.5e-88 323.2
Bma10g00132 . 29 272 SNARE and Associated Proteins AT3G52400 68.9 7.6e-88 320.9
Bma07g00353 . 6 286 SNARE and Associated Proteins AT3G52400 57.0 6.2e-82 301.2
Bma11g00374 . 6 286 SNARE and Associated Proteins AT3G52400 55.7 1.2e-80 297.0
Bma11g00374 . 6 304 SNARE and Associated Proteins AT4G03330 66.6 5.0e-107 384.4
Bma07g00353 . 6 304 SNARE and Associated Proteins AT4G03330 67.2 6.6e-107 384.0
Bma04g01535 . 1222 1499 SNARE and Associated Proteins AT4G03330 56.0 9.5e-82 300.4
Bma10g00132 . 29 278 SNARE and Associated Proteins AT4G03330 58.8 8.1e-81 297.4
Bma04g00526 . 1 279 SNARE and Associated Proteins AT4G03330 55.4 4.9e-78 288.1
Bma10g00004 . 1 285 SNARE and Associated Proteins AT4G03330 50.2 5.6e-66 248.1
Bma11g00374 . 6 304 SNARE and Associated Proteins AT1G61290 78.3 6.9e-125 443.7
Bma07g00353 . 6 308 SNARE and Associated Proteins AT1G61290 77.9 7.7e-124 440.3
Bma04g01535 . 1222 1493 SNARE and Associated Proteins AT1G61290 62.9 2.7e-89 325.5
Bma10g00132 . 1 281 SNARE and Associated Proteins AT1G61290 58.8 1.7e-86 316.2
Bma04g00526 . 1 279 SNARE and Associated Proteins AT1G61290 59.4 5.4e-85 311.2
Bma07g00353 . 6 308 SNARE and Associated Proteins AT1G11250 76.6 1.3e-120 429.5
Bma11g00374 . 6 304 SNARE and Associated Proteins AT1G11250 75.9 3.0e-120 428.3
Bma04g01535 . 1222 1493 SNARE and Associated Proteins AT1G11250 64.3 1.8e-93 339.3
Bma10g00132 . 1 281 SNARE and Associated Proteins AT1G11250 60.1 6.4e-91 330.9
Bma04g00526 . 1 279 SNARE and Associated Proteins AT1G11250 61.3 4.6e-89 324.7
Bma10g00004 . 1 306 SNARE and Associated Proteins AT3G03800 76.5 1.2e-116 416.4
Bma10g00004 . 1 204 SNARE and Associated Proteins AT5G08080 75.5 6.1e-78 287.3
Bma12g00235 BCT 1 263 SNARE and Associated Proteins AT5G16830 62.8 6.5e-77 284.3
Bma05g00704 BCT 1 148 SNARE and Associated Proteins AT5G16830 58.4 3.1e-39 159.1
Bma12g00235 BCT 1 263 SNARE and Associated Proteins AT5G46860 70.7 2.0e-83 305.8
Bma05g00704 BCT 1 153 SNARE and Associated Proteins AT5G46860 75.8 2.5e-57 219.2
Bma12g00235 BCT 1 257 SNARE and Associated Proteins AT4G17730 64.2 9.7e-75 276.9
Bma05g00704 BCT 1 148 SNARE and Associated Proteins AT4G17730 72.2 8.0e-53 204.1
Bma06g00441 . 1 182 SNARE and Associated Proteins AT4G17730 54.1 1.2e-43 173.7
Bma12g00235 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 1.8e-49 193.4
Bma03g00258 . 1 325 SNARE and Associated Proteins AT5G05760 65.4 3.5e-109 391.7
Bma02g00044 . 444 806 SNARE and Associated Proteins AT3G24350 60.5 7.5e-102 367.5
Bma01g00625 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.5e-125 445.3
Bma05g00265 . 1 339 SNARE and Associated Proteins AT5G26980 74.0 9.0e-123 436.8
Bma01g00625 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bma05g00265 . 1 337 SNARE and Associated Proteins AT4G02195 63.4 3.7e-100 361.7
Bma01g00625 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.7e-127 451.1
Bma05g00265 . 1 337 SNARE and Associated Proteins AT3G05710 75.4 6.2e-127 450.7
Bma07g01281 BCT 1 232 SNARE and Associated Proteins AT1G16240 65.4 7.0e-77 283.9
Bma10g00582 . 1 230 SNARE and Associated Proteins AT1G16240 58.4 4.9e-70 261.2
Bma14g00320 BCT 1 232 SNARE and Associated Proteins AT1G16240 57.6 2.3e-64 242.3
Bma07g01281 BCT 1 232 SNARE and Associated Proteins AT1G79590 65.0 1.9e-78 289.3
Bma10g00582 . 1 230 SNARE and Associated Proteins AT1G79590 59.4 6.1e-69 257.7
Bma14g00320 BCT 1 232 SNARE and Associated Proteins AT1G79590 59.6 6.8e-68 254.2
Bma07g01292 . 86 281 SNARE and Associated Proteins AT1G28490 68.4 1.3e-66 249.6
Bma07g01329 . 86 281 SNARE and Associated Proteins AT1G28490 66.3 5.9e-64 240.7
Bma14g00333 . 55 235 SNARE and Associated Proteins AT1G28490 65.2 5.7e-59 224.2
Bma11g00164 . 1 286 SNARE and Associated Proteins AT3G09740 56.1 6.0e-80 294.3
Bma11g00164 . 1 286 SNARE and Associated Proteins AT3G45280 55.7 2.1e-77 285.8
Bma11g00164 . 1 286 SNARE and Associated Proteins AT3G61450 52.3 4.8e-74 274.6
Bma03g00162 . 33 278 SNARE and Associated Proteins AT1G51740 71.2 7.7e-90 327.0
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0001189 1 6 1 1 1 2 3 2 2 2 2 2 3 2 3 3 2 4 3 2 3 1 2 3 3 2 3 8 3 2 77
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Bma10g00004 Bma_Chr10 FPKM 186.293411 199.652603 181.197937 177.472961 131.899658 131.543945 129.146652 294.534668 281.167755 275.694305