Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Bma11g00374 AAAAACTCTGCCAAAATGAACGATCTCTTCTCCGGCTCGTTCAAAAAGTATGCAGACCTGAAGCAGCAGGCCTACCTAGACGGCATGGAGGCCGGCAAGGAGAGCATAAATCTTGACAAGTTCTTTGAAGACATCGACAATGTGAAGGAAGACATGAAACAAGTGGAAAAGCTCTACAAGAAACTGCAGGAAGCAAATGAGGAATGCAAAGTTGTCCACAATGCCAAAACCATGAAAGAACTGAGAGCAAGAATGGATCAAGATGCCAGCCAGGTTTTAAAAAGAGTCAAAATGATCAAAGCAAAGCTCGAAGGCCTCGATCGATCAAACGCAGCCCATCGAAGCCTTCCGGGGTGCGGCCCGGGCTCATCTGCCGACAGAACAAGAACCTCGGTCGTAAGTGGATTGGGGAAGAAACTAAAAGACATAATGGATGATTTTCAGAGTTTAAGAAGTAGAATGAATGCAGAATATAAGGAAACAGTTGAACGCAGGTATTTCACAATCACAGGAGAGAAGGCAAATGAAGAAACCATTGAAAATCTAATCTCGAGTGGAGAAAGCGAAAATTTTCTGCAGAAAGCAATTCAAGAACAAGGCAGAGGCCAAATAATGGACACCATATCAGAAATACAAGAAAGACACGATGCAGTGAAGGAGATCGAGAAGAACCTCATTGAGCTTCACCAGATATTTCTGGACATGGCTGCTCTGGTCGAGGCCCAGGGACATCAACTCAACGACATAGAGAGTCACGTTGCCCATGCAAATTCGTTCGTCAGGCGAGGGACAGAGCAGCTTCAAGAGGCCAGAGAAAGTCAGAAAAGCTCGAGGAAATGGACCTGCATTGCCATAGTTCTTGGTGCAGTTCTTGTTGCTGTTCTTCTCTTCCCACTTCTATCATCCATTTTGCCTCACCTGTTGTAG 927 45.2 KNSAKMNDLFSGSFKKYADLKQQAYLDGMEAGKESINLDKFFEDIDNVKEDMKQVEKLYKKLQEANEECKVVHNAKTMKELRARMDQDASQVLKRVKMIKAKLEGLDRSNAAHRSLPGCGPGSSADRTRTSVVSGLGKKLKDIMDDFQSLRSRMNAEYKETVERRYFTITGEKANEETIENLISSGESENFLQKAIQEQGRGQIMDTISEIQERHDAVKEIEKNLIELHQIFLDMAALVEAQGHQLNDIESHVAHANSFVRRGTEQLQEARESQKSSRKWTCIAIVLGAVLVAVLLFPLLSSILPHLL 308
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
11 4077034 4077960 + Bma005833.3 Bma11g00374 90776

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Bma11g00374 308 CDD SynN 38 195 IPR006011 GO:0016020
Bma11g00374 308 Pfam SNARE domain 245 296 IPR000727 -
Bma11g00374 308 ProSitePatterns Syntaxin / epimorphin family signature. 214 253 IPR006012 GO:0005484|GO:0006886|GO:0016020
Bma11g00374 308 SUPERFAMILY t-snare proteins 37 263 IPR010989 GO:0016020|GO:0016192
Bma11g00374 308 SMART tSNARE_6 203 270 IPR000727 -
Bma11g00374 308 Gene3D - 197 300 - -
Bma11g00374 308 MobiDBLite consensus disorder prediction 112 131 - -
Bma11g00374 308 SMART SynN_4 33 159 IPR006011 GO:0016020
Bma11g00374 308 CDD SNARE_syntaxin1-like 207 269 - -
Bma11g00374 308 Coils Coil 38 75 - -
Bma11g00374 308 PANTHER T-SNARE-RELATED 12 300 - -
Bma11g00374 308 PANTHER SYNTAXIN 12 300 IPR045242 -
Bma11g00374 308 Pfam Syntaxin 40 243 IPR006011 GO:0016020
Bma11g00374 308 Gene3D - 38 165 - -
Bma11g00374 308 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 208 270 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bma11g00374 K08486 STX1B_2_3; syntaxin 1B/2/3 - csv:101217140 527.709
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Bma10g00004 Bma-Chr10:154588 Bma11g00374 Bma-Chr11:4077034 2.96E-93 dispersed
Bma10g00132 Bma-Chr10:1190775 Bma11g00374 Bma-Chr11:4077034 3.14E-125 dispersed
Bma11g00374 Bma-Chr11:4077034 Bma12g00507 Bma-Chr12:16198148 7.91E-66 dispersed
Bma12g00235 Bma-Chr12:3044573 Bma11g00374 Bma-Chr11:4077034 2.49E-10 dispersed
Bma11g00374 Bma-Chr11:4077034 Bma07g00353 Bma-Chr7:4463222 0 wgd
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bma02g00044 . 444 806 SNARE and Associated Proteins AT3G24350 60.5 7.5e-102 367.5
Bma05g00445 . 1 293 SNARE and Associated Proteins AT2G18260 52.1 1.2e-79 293.5
Bma05g00439 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 5.8e-79 291.2
Bma12g00507 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 4.1e-77 285.0
Bma04g01535 . 1243 1499 SNARE and Associated Proteins AT3G11820 81.7 4.4e-114 407.9
Bma10g00132 . 22 278 SNARE and Associated Proteins AT3G11820 79.8 7.0e-112 400.6
Bma04g00526 . 19 279 SNARE and Associated Proteins AT3G11820 75.1 1.0e-107 386.7
Bma07g00353 . 36 286 SNARE and Associated Proteins AT3G11820 67.3 1.7e-94 342.8
Bma11g00374 . 36 286 SNARE and Associated Proteins AT3G11820 65.7 2.5e-93 339.0
Bma10g00004 . 27 285 SNARE and Associated Proteins AT3G11820 50.2 3.1e-67 252.3
Bma01g02014 . 22 222 SNARE and Associated Proteins AT3G11820 54.8 2.4e-64 242.7
Bma04g01535 . 1250 1499 SNARE and Associated Proteins AT3G52400 70.4 9.6e-91 330.5
Bma04g00526 . 1 279 SNARE and Associated Proteins AT3G52400 61.9 1.5e-88 323.2
Bma10g00132 . 29 272 SNARE and Associated Proteins AT3G52400 68.9 7.6e-88 320.9
Bma07g00353 . 6 286 SNARE and Associated Proteins AT3G52400 57.0 6.2e-82 301.2
Bma11g00374 . 6 286 SNARE and Associated Proteins AT3G52400 55.7 1.2e-80 297.0
Bma11g00374 . 6 304 SNARE and Associated Proteins AT4G03330 66.6 5.0e-107 384.4
Bma07g00353 . 6 304 SNARE and Associated Proteins AT4G03330 67.2 6.6e-107 384.0
Bma04g01535 . 1222 1499 SNARE and Associated Proteins AT4G03330 56.0 9.5e-82 300.4
Bma10g00132 . 29 278 SNARE and Associated Proteins AT4G03330 58.8 8.1e-81 297.4
Bma04g00526 . 1 279 SNARE and Associated Proteins AT4G03330 55.4 4.9e-78 288.1
Bma10g00004 . 1 285 SNARE and Associated Proteins AT4G03330 50.2 5.6e-66 248.1
Bma11g00374 . 6 304 SNARE and Associated Proteins AT1G61290 78.3 6.9e-125 443.7
Bma07g00353 . 6 308 SNARE and Associated Proteins AT1G61290 77.9 7.7e-124 440.3
Bma04g01535 . 1222 1493 SNARE and Associated Proteins AT1G61290 62.9 2.7e-89 325.5
Bma10g00132 . 1 281 SNARE and Associated Proteins AT1G61290 58.8 1.7e-86 316.2
Bma04g00526 . 1 279 SNARE and Associated Proteins AT1G61290 59.4 5.4e-85 311.2
Bma07g00353 . 6 308 SNARE and Associated Proteins AT1G11250 76.6 1.3e-120 429.5
Bma11g00374 . 6 304 SNARE and Associated Proteins AT1G11250 75.9 3.0e-120 428.3
Bma04g01535 . 1222 1493 SNARE and Associated Proteins AT1G11250 64.3 1.8e-93 339.3
Bma10g00132 . 1 281 SNARE and Associated Proteins AT1G11250 60.1 6.4e-91 330.9
Bma04g00526 . 1 279 SNARE and Associated Proteins AT1G11250 61.3 4.6e-89 324.7
Bma10g00004 . 1 306 SNARE and Associated Proteins AT3G03800 76.5 1.2e-116 416.4
Bma10g00004 . 1 204 SNARE and Associated Proteins AT5G08080 75.5 6.1e-78 287.3
Bma12g00235 BCT 1 263 SNARE and Associated Proteins AT5G16830 62.8 6.5e-77 284.3
Bma05g00704 BCT 1 148 SNARE and Associated Proteins AT5G16830 58.4 3.1e-39 159.1
Bma12g00235 BCT 1 263 SNARE and Associated Proteins AT5G46860 70.7 2.0e-83 305.8
Bma05g00704 BCT 1 153 SNARE and Associated Proteins AT5G46860 75.8 2.5e-57 219.2
Bma12g00235 BCT 1 257 SNARE and Associated Proteins AT4G17730 64.2 9.7e-75 276.9
Bma05g00704 BCT 1 148 SNARE and Associated Proteins AT4G17730 72.2 8.0e-53 204.1
Bma06g00441 . 1 182 SNARE and Associated Proteins AT4G17730 54.1 1.2e-43 173.7
Bma12g00235 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 1.8e-49 193.4
Bma03g00258 . 1 325 SNARE and Associated Proteins AT5G05760 65.4 3.5e-109 391.7
Bma02g00044 . 444 806 SNARE and Associated Proteins AT3G24350 60.5 7.5e-102 367.5
Bma01g00625 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.5e-125 445.3
Bma05g00265 . 1 339 SNARE and Associated Proteins AT5G26980 74.0 9.0e-123 436.8
Bma01g00625 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bma05g00265 . 1 337 SNARE and Associated Proteins AT4G02195 63.4 3.7e-100 361.7
Bma01g00625 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.7e-127 451.1
Bma05g00265 . 1 337 SNARE and Associated Proteins AT3G05710 75.4 6.2e-127 450.7
Bma07g01281 BCT 1 232 SNARE and Associated Proteins AT1G16240 65.4 7.0e-77 283.9
Bma10g00582 . 1 230 SNARE and Associated Proteins AT1G16240 58.4 4.9e-70 261.2
Bma14g00320 BCT 1 232 SNARE and Associated Proteins AT1G16240 57.6 2.3e-64 242.3
Bma07g01281 BCT 1 232 SNARE and Associated Proteins AT1G79590 65.0 1.9e-78 289.3
Bma10g00582 . 1 230 SNARE and Associated Proteins AT1G79590 59.4 6.1e-69 257.7
Bma14g00320 BCT 1 232 SNARE and Associated Proteins AT1G79590 59.6 6.8e-68 254.2
Bma07g01292 . 86 281 SNARE and Associated Proteins AT1G28490 68.4 1.3e-66 249.6
Bma07g01329 . 86 281 SNARE and Associated Proteins AT1G28490 66.3 5.9e-64 240.7
Bma14g00333 . 55 235 SNARE and Associated Proteins AT1G28490 65.2 5.7e-59 224.2
Bma11g00164 . 1 286 SNARE and Associated Proteins AT3G09740 56.1 6.0e-80 294.3
Bma11g00164 . 1 286 SNARE and Associated Proteins AT3G45280 55.7 2.1e-77 285.8
Bma11g00164 . 1 286 SNARE and Associated Proteins AT3G61450 52.3 4.8e-74 274.6
Bma03g00162 . 33 278 SNARE and Associated Proteins AT1G51740 71.2 7.7e-90 327.0
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0005716 1 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 2 1 1 37
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Bma11g00374 Bma_Chr11 FPKM 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0