Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Bma14g00320 ATGGCGTCCTCTTCGGATTCATGGGTAAAGGAATATAACGAAGCAGTTAAGCTTGCTGATGATATCAATGGCATGATCTCTGAGCGGAATTCGGTTTCATTATCCGGGCCAGAAGCTCAGCGCTATGCCTCCACTATTCGCAGAAAGATCACGATATTGGGGACTAGACTTGATAGCTTACTAGCACTCTTATCTAAACTTCCTGGAAAGCAGCCCATCTCTGATAAAGAGATGAATCGCCGAAGGGACATGGTTACAAATTTAAGAGCAAAGGTTACCCAAATGGCTTCACAACTGAACATGTCGAACTTTGCCAATCGTGACAGCTTGCTTGGTCCAGAAATTAAAGCAGCTGATCCCATGAACAGAACTGTGGGCCTGGACAACCAAGAGCAAGATGAAGATCTTCAGAAGCTGGAGGAGACTGTAATAAGTACAAAACATATTGCTCTGGCAGTCAACGAAGAACTTGACCTGCATTCGAGACTAATTGTATGTTATAATCCTTTTTCATGGGTGTTTGTTAAAGTCATTTGCTTTATCTTTTCTTTTTGTTGTGAAAAACAGCGAGTGCAGAAGAACTTGGCAATTTTGAACAAGCGTACAAAAGGAGGTTGCACTTGCTTGTGCATGATTTTATCGGTCGTCGGAATCGTAATTCTGGTTGTTGTCATATATCTTCTCGTCAGGTTTTTGTAA 699 41.92 MASSSDSWVKEYNEAVKLADDINGMISERNSVSLSGPEAQRYASTIRRKITILGTRLDSLLALLSKLPGKQPISDKEMNRRRDMVTNLRAKVTQMASQLNMSNFANRDSLLGPEIKAADPMNRTVGLDNQEQDEDLQKLEETVISTKHIALAVNEELDLHSRLIVCYNPFSWVFVKVICFIFSFCCEKQRVQKNLAILNKRTKGGCTCLCMILSVVGIVILVVVIYLLVRFL 232
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
14 3997555 3999385 - Bma010744.1 Bma14g00320 94301

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Bma14g00320 232 PANTHER SYNTAXIN-51-LIKE 1 228 - -
Bma14g00320 232 PANTHER SYNTAXIN 1 228 IPR045242 -
Bma14g00320 232 Gene3D - 130 167 - -
Bma14g00320 232 SUPERFAMILY t-snare proteins 20 100 IPR010989 GO:0016020|GO:0016192
Bma14g00320 232 SUPERFAMILY SNARE fusion complex 129 164 - -
Bma14g00320 232 CDD SNARE_Qc 130 164 - -
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bma14g00320 K08503 SYP5; syntaxin of plants SYP5 - cit:102608030 265.388
       

WGDs- Genes


Select Gene_1 Gene_2 Event_name
Bma07g01281 Bma14g00320 BCT
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Bma10g00582 Bma-Chr10:7155146 Bma14g00320 Bma-Chr14:3997555 9.17E-77 dispersed
Bma14g00320 Bma-Chr14:3997555 Bma07g01281 Bma-Chr7:48477958 1.77E-127 wgd
       

Deco-Alignment


Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi19g583 Blo03g00538 . Bda07g00381 Bda09g00411 . Bpe08g01109 . . Cmo16g00959 . Cma01g01111 Cma09g00975 Car01g00980 Car09g00889 Sed07g2705 Cpe06g00787 Cpe02g00792 Bhi09g01700 Tan01g3132 Cmetu01g0482 . Hepe01g1245 Mch11g1220 . . . . . . . . Cone6ag0041 Cone9ag0047 Cone14ag1185 Cone15ag1202 Lsi02g01877 . . . . . Bda05g00693 . . Bpe03g00767 Bma07g01281 Bma14g00320 . Cmo01g01156 Cmo09g00974 . Cma16g00924 . Car16g00895 Cpe14g00748 . . . . . . . . Cla09g01036 Cam09g1092 Cec09g1092 Cco09g1113 . . Cre09g1057 . . Chy01g01059 Cme01g00994
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bma02g00044 . 444 806 SNARE and Associated Proteins AT3G24350 60.5 7.5e-102 367.5
Bma05g00445 . 1 293 SNARE and Associated Proteins AT2G18260 52.1 1.2e-79 293.5
Bma05g00439 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 5.8e-79 291.2
Bma12g00507 . 1 293 SNARE and Associated Proteins AT2G18260 51.8 4.1e-77 285.0
Bma04g01535 . 1243 1499 SNARE and Associated Proteins AT3G11820 81.7 4.4e-114 407.9
Bma10g00132 . 22 278 SNARE and Associated Proteins AT3G11820 79.8 7.0e-112 400.6
Bma04g00526 . 19 279 SNARE and Associated Proteins AT3G11820 75.1 1.0e-107 386.7
Bma07g00353 . 36 286 SNARE and Associated Proteins AT3G11820 67.3 1.7e-94 342.8
Bma11g00374 . 36 286 SNARE and Associated Proteins AT3G11820 65.7 2.5e-93 339.0
Bma10g00004 . 27 285 SNARE and Associated Proteins AT3G11820 50.2 3.1e-67 252.3
Bma01g02014 . 22 222 SNARE and Associated Proteins AT3G11820 54.8 2.4e-64 242.7
Bma04g01535 . 1250 1499 SNARE and Associated Proteins AT3G52400 70.4 9.6e-91 330.5
Bma04g00526 . 1 279 SNARE and Associated Proteins AT3G52400 61.9 1.5e-88 323.2
Bma10g00132 . 29 272 SNARE and Associated Proteins AT3G52400 68.9 7.6e-88 320.9
Bma07g00353 . 6 286 SNARE and Associated Proteins AT3G52400 57.0 6.2e-82 301.2
Bma11g00374 . 6 286 SNARE and Associated Proteins AT3G52400 55.7 1.2e-80 297.0
Bma11g00374 . 6 304 SNARE and Associated Proteins AT4G03330 66.6 5.0e-107 384.4
Bma07g00353 . 6 304 SNARE and Associated Proteins AT4G03330 67.2 6.6e-107 384.0
Bma04g01535 . 1222 1499 SNARE and Associated Proteins AT4G03330 56.0 9.5e-82 300.4
Bma10g00132 . 29 278 SNARE and Associated Proteins AT4G03330 58.8 8.1e-81 297.4
Bma04g00526 . 1 279 SNARE and Associated Proteins AT4G03330 55.4 4.9e-78 288.1
Bma10g00004 . 1 285 SNARE and Associated Proteins AT4G03330 50.2 5.6e-66 248.1
Bma11g00374 . 6 304 SNARE and Associated Proteins AT1G61290 78.3 6.9e-125 443.7
Bma07g00353 . 6 308 SNARE and Associated Proteins AT1G61290 77.9 7.7e-124 440.3
Bma04g01535 . 1222 1493 SNARE and Associated Proteins AT1G61290 62.9 2.7e-89 325.5
Bma10g00132 . 1 281 SNARE and Associated Proteins AT1G61290 58.8 1.7e-86 316.2
Bma04g00526 . 1 279 SNARE and Associated Proteins AT1G61290 59.4 5.4e-85 311.2
Bma07g00353 . 6 308 SNARE and Associated Proteins AT1G11250 76.6 1.3e-120 429.5
Bma11g00374 . 6 304 SNARE and Associated Proteins AT1G11250 75.9 3.0e-120 428.3
Bma04g01535 . 1222 1493 SNARE and Associated Proteins AT1G11250 64.3 1.8e-93 339.3
Bma10g00132 . 1 281 SNARE and Associated Proteins AT1G11250 60.1 6.4e-91 330.9
Bma04g00526 . 1 279 SNARE and Associated Proteins AT1G11250 61.3 4.6e-89 324.7
Bma10g00004 . 1 306 SNARE and Associated Proteins AT3G03800 76.5 1.2e-116 416.4
Bma10g00004 . 1 204 SNARE and Associated Proteins AT5G08080 75.5 6.1e-78 287.3
Bma12g00235 BCT 1 263 SNARE and Associated Proteins AT5G16830 62.8 6.5e-77 284.3
Bma05g00704 BCT 1 148 SNARE and Associated Proteins AT5G16830 58.4 3.1e-39 159.1
Bma12g00235 BCT 1 263 SNARE and Associated Proteins AT5G46860 70.7 2.0e-83 305.8
Bma05g00704 BCT 1 153 SNARE and Associated Proteins AT5G46860 75.8 2.5e-57 219.2
Bma12g00235 BCT 1 257 SNARE and Associated Proteins AT4G17730 64.2 9.7e-75 276.9
Bma05g00704 BCT 1 148 SNARE and Associated Proteins AT4G17730 72.2 8.0e-53 204.1
Bma06g00441 . 1 182 SNARE and Associated Proteins AT4G17730 54.1 1.2e-43 173.7
Bma12g00235 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 1.8e-49 193.4
Bma03g00258 . 1 325 SNARE and Associated Proteins AT5G05760 65.4 3.5e-109 391.7
Bma02g00044 . 444 806 SNARE and Associated Proteins AT3G24350 60.5 7.5e-102 367.5
Bma01g00625 . 1 341 SNARE and Associated Proteins AT5G26980 75.4 2.5e-125 445.3
Bma05g00265 . 1 339 SNARE and Associated Proteins AT5G26980 74.0 9.0e-123 436.8
Bma01g00625 . 1 339 SNARE and Associated Proteins AT4G02195 63.9 2.6e-101 365.5
Bma05g00265 . 1 337 SNARE and Associated Proteins AT4G02195 63.4 3.7e-100 361.7
Bma01g00625 . 1 339 SNARE and Associated Proteins AT3G05710 75.2 4.7e-127 451.1
Bma05g00265 . 1 337 SNARE and Associated Proteins AT3G05710 75.4 6.2e-127 450.7
Bma07g01281 BCT 1 232 SNARE and Associated Proteins AT1G16240 65.4 7.0e-77 283.9
Bma10g00582 . 1 230 SNARE and Associated Proteins AT1G16240 58.4 4.9e-70 261.2
Bma14g00320 BCT 1 232 SNARE and Associated Proteins AT1G16240 57.6 2.3e-64 242.3
Bma07g01281 BCT 1 232 SNARE and Associated Proteins AT1G79590 65.0 1.9e-78 289.3
Bma10g00582 . 1 230 SNARE and Associated Proteins AT1G79590 59.4 6.1e-69 257.7
Bma14g00320 BCT 1 232 SNARE and Associated Proteins AT1G79590 59.6 6.8e-68 254.2
Bma07g01292 . 86 281 SNARE and Associated Proteins AT1G28490 68.4 1.3e-66 249.6
Bma07g01329 . 86 281 SNARE and Associated Proteins AT1G28490 66.3 5.9e-64 240.7
Bma14g00333 . 55 235 SNARE and Associated Proteins AT1G28490 65.2 5.7e-59 224.2
Bma11g00164 . 1 286 SNARE and Associated Proteins AT3G09740 56.1 6.0e-80 294.3
Bma11g00164 . 1 286 SNARE and Associated Proteins AT3G45280 55.7 2.1e-77 285.8
Bma11g00164 . 1 286 SNARE and Associated Proteins AT3G61450 52.3 4.8e-74 274.6
Bma03g00162 . 33 278 SNARE and Associated Proteins AT1G51740 71.2 7.7e-90 327.0
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002063 3 5 2 3 2 1 3 1 2 1 1 1 3 2 2 3 1 4 3 1 2 2 1 2 2 2 1 5 3 1 65
       

Transcriptome


Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Bma14g00320 Bma_Chr14 FPKM 14.632812 16.790554 11.288854 11.10011 21.424894 23.387592 22.047377 0.564862 0.504501 0.517275