Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Bpe02g01831 ATGGCTACGAGGAATAGAACCTTGCTGTTTAAGAAATATAGAGATGCTTTAAAGAGCGTTAGAGTTCCGGCGAGTTCTTCCCTTGCGTCTGGTTCCCCGTCGACTTCTGACGGTGGCGGAGGTGGTCCGGTTATCGAATTGGTCAGCACCTCGCTTTTGCATCCGAATCGATCTTATGCTCCGCTAAGTACCGAGGATCCGGGTTATTCAAGCAAGGGTGCTCTTACTGTTGGTCTACCTCCAGCTTGGGTGGATGTTTCTGAAGAAATATCAACAAATGTGCAGCGTGCACAAATAAAAATGGCCGAGTTAGCCAAGGCACATGCAAAGGCTTTAATGCCTTCATTTGGAGATGGTAAAGAAGATCAAAGATTAATTGAAGCTCTTACTCAAGAGCTTACAGGTCTGATTAAGAAATCAGAGAAGAAACTACAAAGACTTTCTGTAGCAGGACCTTCTGAAGATTCCAATGTCAGAAAAAATGTTCAGCGTTCTCTTGCCACAGACCTTCAAAATCTTTCAATGGAGCTTCGCAAAAAACAATCAACTTACCTCAAGCGGCTCAGGCAGCAAAAGGAGGGTCAAGATGGGATAGACTTAGAGATGAATCTAAATGGAAGTAGATCTACTGCTGAGGATGATGACTTGGATAACATGATATTTAATGAGCACCAGATGGCCAAGCTTAAAAAGAGCGAAGCATTCACAGCAGAAAGAGAGAGAGAAATCCAACAGGCAAGGGAATTAACTTTATTTACTGCTTTATTAGTTGTAGAATCTGTAAATGAGCTTGCTCAGATTATGAAGGATCTTTCAGTTCTTGTTATAGACCAGGGCACAATTGTTGATAGGATTGATTACAACATTCAGAATGTGGCAACAACAGTTGAGGAGGGCCTTAAACAGCTGCAGAAGGCTGAAAGAACACAGAAACAAGGAGGGATGGTTATGTGCGCATCTGTGCTTCTTATCATGTGCTTCATTATGTTGGTTCTCCTGGTTCTCAAGGAAATATTTTTGTGA 1023 42.33 MATRNRTLLFKKYRDALKSVRVPASSSLASGSPSTSDGGGGGPVIELVSTSLLHPNRSYAPLSTEDPGYSSKGALTVGLPPAWVDVSEEISTNVQRAQIKMAELAKAHAKALMPSFGDGKEDQRLIEALTQELTGLIKKSEKKLQRLSVAGPSEDSNVRKNVQRSLATDLQNLSMELRKKQSTYLKRLRQQKEGQDGIDLEMNLNGSRSTAEDDDLDNMIFNEHQMAKLKKSEAFTAEREREIQQARELTLFTALLVVESVNELAQIMKDLSVLVIDQGTIVDRIDYNIQNVATTVEEGLKQLQKAERTQKQGGMVMCASVLLIMCFIMLVLLVLKEIFL 340
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
2 20467880 20471448 + Bpe009662.1 Bpe02g01831 99980

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Bpe02g01831 340 SMART tSNARE_6 240 306 IPR000727 -
Bpe02g01831 340 SUPERFAMILY t-snare proteins 79 299 IPR010989 GO:0016020|GO:0016192
Bpe02g01831 340 MobiDBLite consensus disorder prediction 24 46 - -
Bpe02g01831 340 CDD SNARE_syntaxin16 237 305 - -
Bpe02g01831 340 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 257 306 IPR000727 -
Bpe02g01831 340 PANTHER SYNTAXIN 1 335 IPR045242 -
Bpe02g01831 340 Pfam SNARE domain 280 332 IPR000727 -
Bpe02g01831 340 SMART SynN_4 74 189 IPR006011 GO:0016020
Bpe02g01831 340 PANTHER SYNTAXIN-43-LIKE 1 335 - -
Bpe02g01831 340 Gene3D - 80 298 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bpe02g01831 K08489 STX16; syntaxin 16 - jre:109011309 543.502
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bpe02g01227 . 1 339 SNARE and Associated Proteins AT3G24350 65.7 2.7e-104 375.6
Bpe14g00562 . 444 797 SNARE and Associated Proteins AT3G24350 60.2 4.0e-100 361.7
Bpe15g00424 . 1 290 SNARE and Associated Proteins AT2G18260 55.0 1.3e-80 296.6
Bpe07g00425 . 1 293 SNARE and Associated Proteins AT2G18260 51.2 2.6e-76 282.3
Bpe04g01486 . 1269 1525 SNARE and Associated Proteins AT3G11820 80.9 1.2e-113 406.4
Bpe03g01190 . 22 278 SNARE and Associated Proteins AT3G11820 79.0 1.1e-111 399.8
Bpe04g00619 . 19 279 SNARE and Associated Proteins AT3G11820 74.7 5.0e-107 384.4
Bpe02g00700 . 19 279 SNARE and Associated Proteins AT3G11820 70.1 1.9e-98 355.9
Bpe08g00351 . 36 286 SNARE and Associated Proteins AT3G11820 66.1 8.3e-94 340.5
Bpe01g00396 . 36 286 SNARE and Associated Proteins AT3G11820 65.7 7.0e-93 337.4
Bpe04g01486 . 1276 1525 SNARE and Associated Proteins AT3G52400 69.6 3.5e-90 328.6
Bpe04g00619 . 1 279 SNARE and Associated Proteins AT3G52400 61.9 7.3e-88 320.9
Bpe03g01190 . 29 278 SNARE and Associated Proteins AT3G52400 66.4 1.6e-87 319.7
Bpe02g00700 . 1 279 SNARE and Associated Proteins AT3G52400 60.8 6.9e-86 314.3
Bpe08g00351 . 6 286 SNARE and Associated Proteins AT3G52400 56.4 3.0e-81 298.9
Bpe01g00396 . 6 286 SNARE and Associated Proteins AT3G52400 55.7 4.3e-80 295.0
Bpe01g00396 . 6 304 SNARE and Associated Proteins AT4G03330 66.9 3.7e-107 384.8
Bpe08g00351 . 6 304 SNARE and Associated Proteins AT4G03330 66.6 1.4e-106 382.9
Bpe04g01486 . 1248 1525 SNARE and Associated Proteins AT4G03330 58.4 2.0e-84 309.3
Bpe03g01190 . 29 278 SNARE and Associated Proteins AT4G03330 58.0 6.6e-80 294.3
Bpe04g00619 . 1 279 SNARE and Associated Proteins AT4G03330 55.4 6.2e-78 287.7
Bpe02g00700 . 1 284 SNARE and Associated Proteins AT4G03330 51.7 1.9e-74 276.2
Bpe01g00396 . 6 304 SNARE and Associated Proteins AT1G61290 78.6 2.3e-125 445.3
Bpe08g00351 . 6 308 SNARE and Associated Proteins AT1G61290 77.2 1.6e-123 439.1
Bpe04g01486 . 1248 1519 SNARE and Associated Proteins AT1G61290 62.9 9.1e-90 327.0
Bpe03g01190 . 1 277 SNARE and Associated Proteins AT1G61290 58.9 1.0e-85 313.5
Bpe04g00619 . 1 279 SNARE and Associated Proteins AT1G61290 59.8 1.5e-84 309.7
Bpe02g00700 . 1 294 SNARE and Associated Proteins AT1G61290 53.4 2.1e-78 289.3
Bpe01g00396 . 6 304 SNARE and Associated Proteins AT1G11250 76.3 1.7e-120 429.1
Bpe08g00351 . 6 308 SNARE and Associated Proteins AT1G11250 75.9 2.9e-120 428.3
Bpe04g01486 . 1248 1519 SNARE and Associated Proteins AT1G11250 64.0 1.0e-93 340.1
Bpe03g01190 . 1 278 SNARE and Associated Proteins AT1G11250 59.7 5.2e-90 327.8
Bpe04g00619 . 1 279 SNARE and Associated Proteins AT1G11250 61.3 1.7e-88 322.8
Bpe02g00700 . 1 284 SNARE and Associated Proteins AT1G11250 56.7 9.0e-82 300.4
Bpe07g00604 . 1 232 SNARE and Associated Proteins AT3G03800 59.9 2.3e-64 242.7
Bpe07g00233 BCT 1 263 SNARE and Associated Proteins AT5G16830 63.6 9.6e-78 287.0
Bpe05g00520 BCT 1 263 SNARE and Associated Proteins AT5G16830 62.1 1.5e-75 279.6
Bpe05g00520 BCT 1 274 SNARE and Associated Proteins AT5G46860 69.7 3.3e-83 305.1
Bpe07g00233 BCT 1 274 SNARE and Associated Proteins AT5G46860 70.4 7.3e-83 303.9
Bpe05g00520 BCT 1 257 SNARE and Associated Proteins AT4G17730 65.8 6.5e-76 280.8
Bpe07g00233 BCT 1 257 SNARE and Associated Proteins AT4G17730 64.6 3.2e-75 278.5
Bpe14g01345 . 1 182 SNARE and Associated Proteins AT4G17730 52.6 4.2e-43 171.8
Bpe07g00233 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 2.3e-49 193.0
Bpe05g00520 BCT 65 256 SNARE and Associated Proteins AT1G32270 57.3 2.0e-48 189.9
Bpe15g01148 . 5 341 SNARE and Associated Proteins AT5G05760 64.9 3.6e-111 398.3
Bpe02g01227 . 1 339 SNARE and Associated Proteins AT3G24350 65.7 2.7e-104 375.6
Bpe14g00562 . 444 797 SNARE and Associated Proteins AT3G24350 60.2 4.0e-100 361.7
Bpe02g01831 . 1 340 SNARE and Associated Proteins AT5G26980 76.2 1.1e-128 456.4
Bpe02g01831 . 1 338 SNARE and Associated Proteins AT4G02195 63.2 1.2e-103 373.2
Bpe02g01831 . 1 338 SNARE and Associated Proteins AT3G05710 76.0 1.7e-129 459.1
Bpe08g01109 CCT 1 225 SNARE and Associated Proteins AT1G16240 70.4 3.5e-81 298.1
Bpe03g00767 CCT 1 231 SNARE and Associated Proteins AT1G16240 57.7 2.0e-68 255.8
Bpe08g01109 CCT 1 225 SNARE and Associated Proteins AT1G79590 70.4 6.5e-84 307.4
Bpe03g00767 CCT 1 231 SNARE and Associated Proteins AT1G79590 59.8 1.2e-69 260.0
Bpe08g01119 . 58 251 SNARE and Associated Proteins AT1G28490 70.1 1.9e-67 252.3
Bpe11g00552 . 86 276 SNARE and Associated Proteins AT1G28490 66.5 5.1e-65 244.2
Bpe01g00179 . 1 286 SNARE and Associated Proteins AT3G09740 56.1 2.0e-80 295.8
Bpe04g01584 . 547 680 SNARE and Associated Proteins AT3G09740 64.6 2.0e-40 162.9
Bpe01g00179 . 1 286 SNARE and Associated Proteins AT3G45280 55.7 5.4e-78 287.7
Bpe01g00179 . 1 286 SNARE and Associated Proteins AT3G61450 52.6 9.3e-75 276.9
Bpe15g01257 . 65 262 SNARE and Associated Proteins AT1G51740 66.0 2.8e-65 245.4
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003497 3 1 2 2 1 1 2 1 1 1 1 1 2 1 1 2 1 2 2 1 1 1 1 1 1 1 1 4 4 2 46