Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Bpe07g00233 ATGAGTTTTCAAGATATCGAGGCGGGTCGGCCCTTTGCTTATTCGAGGCGGGACGGAATCAATGCCAAGCAGGACCCGACACAGGCCGTCGCTTCTGGTATATTTCAGATCAACACCGCTGTCGCCACCTTTCAGAGGCTCGTCAATACTCTGGGAACTCCGAAGGACACCCCCGAGCTCCGAGAGAAGCTGCATAAGACGAGGCTTCATATTGGACAGTTGGTGAAAGATACTTCTGCAAGACTAAAACAAGCTAGTGAAATAGATCATCAAACTGAAGTTAAAGCCAGCAAGAAAATTGCAGATGCAAAGCTCGCTAAAGACTTTCAAGCTGTGCTGAAAGAATTTCAAAAGGGTCAACGACTTGCAGCCGAGAGAGAAACTGCGTATACTCCTTTTGTTCCACAAGCAGTTCTCCCTTCTAGCTACACGGCCAGCGAGATTGATGTACGATCAGATAAGAATCCCGAACAGCGTGCACTCCTTGTTGAATCTAGGAGACAAGAAGTACTGCTTTTGGACAACGAAATTTCGTTTAACGAGGCGATAATCGAGGAAAGAGAGCAAGGGATCGAAGAAATACAACAGCAAATAGGGGAAGTGAATGAGATTTTCAAAGATTTAGCAGTTCTGGTGCATGAGCAAGGAGCCATGATTGACGATATTGGATCCAACATTGAGAGTTCCCACGCCGCAACTTCGCAAGCGACTTCCCAACTCGTGAAAGCTGCAAAGACCCAAAGATCAAATTCGTCACTGTCCTGCTTGCTGTTGGTGATATTTGGGATCTTGCTTCTCATTGTTATCATACTCATCGCTGCTTGA 825 46.3 MSFQDIEAGRPFAYSRRDGINAKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSARLKQASEIDHQTEVKASKKIADAKLAKDFQAVLKEFQKGQRLAAERETAYTPFVPQAVLPSSYTASEIDVRSDKNPEQRALLVESRRQEVLLLDNEISFNEAIIEEREQGIEEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIESSHAATSQATSQLVKAAKTQRSNSSLSCLLLVIFGILLLIVIILIAA 274
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
7 1658418 1662089 - Bpe021044.1 Bpe07g00233 106002

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Bpe07g00233 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484|GO:0006886|GO:0016020
Bpe07g00233 274 Gene3D - 174 274 - -
Bpe07g00233 274 Pfam Syntaxin-like protein 31 130 IPR006011 GO:0016020
Bpe07g00233 274 Gene3D - 18 134 - -
Bpe07g00233 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Bpe07g00233 274 SMART SynN_4 15 128 IPR006011 GO:0016020
Bpe07g00233 274 SMART tSNARE_6 176 243 IPR000727 -
Bpe07g00233 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020|GO:0016192
Bpe07g00233 274 PANTHER SYNTAXIN 7 273 IPR045242 -
Bpe07g00233 274 CDD SNARE_Qa 184 242 - -
Bpe07g00233 274 Pfam SNARE domain 218 269 IPR000727 -
Bpe07g00233 274 PANTHER SYNTAXIN OF PLANTS PROTEIN 7 273 - -
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bpe07g00233 - - K08488 bhj:120089793 416.772
       

WGDs- Genes


Select Gene_1 Gene_2 Event_name
Bpe05g00520 Bpe07g00233 BCT
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Bpe07g00233 Bpe-Chr7:1658418 Bpe01g00396 Bpe-Chr1:2457994 2.10E-10 dispersed
Bpe14g01345 Bpe-Chr14:10726119 Bpe07g00233 Bpe-Chr7:1658418 3.49E-85 transposed
Bpe05g00520 Bpe-Chr5:19384275 Bpe07g00233 Bpe-Chr7:1658418 5.70E-175 wgd
       

Deco-Alignment


Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bpe02g01227 . 1 339 SNARE and Associated Proteins AT3G24350 65.7 2.7e-104 375.6
Bpe14g00562 . 444 797 SNARE and Associated Proteins AT3G24350 60.2 4.0e-100 361.7
Bpe15g00424 . 1 290 SNARE and Associated Proteins AT2G18260 55.0 1.3e-80 296.6
Bpe07g00425 . 1 293 SNARE and Associated Proteins AT2G18260 51.2 2.6e-76 282.3
Bpe04g01486 . 1269 1525 SNARE and Associated Proteins AT3G11820 80.9 1.2e-113 406.4
Bpe03g01190 . 22 278 SNARE and Associated Proteins AT3G11820 79.0 1.1e-111 399.8
Bpe04g00619 . 19 279 SNARE and Associated Proteins AT3G11820 74.7 5.0e-107 384.4
Bpe02g00700 . 19 279 SNARE and Associated Proteins AT3G11820 70.1 1.9e-98 355.9
Bpe08g00351 . 36 286 SNARE and Associated Proteins AT3G11820 66.1 8.3e-94 340.5
Bpe01g00396 . 36 286 SNARE and Associated Proteins AT3G11820 65.7 7.0e-93 337.4
Bpe04g01486 . 1276 1525 SNARE and Associated Proteins AT3G52400 69.6 3.5e-90 328.6
Bpe04g00619 . 1 279 SNARE and Associated Proteins AT3G52400 61.9 7.3e-88 320.9
Bpe03g01190 . 29 278 SNARE and Associated Proteins AT3G52400 66.4 1.6e-87 319.7
Bpe02g00700 . 1 279 SNARE and Associated Proteins AT3G52400 60.8 6.9e-86 314.3
Bpe08g00351 . 6 286 SNARE and Associated Proteins AT3G52400 56.4 3.0e-81 298.9
Bpe01g00396 . 6 286 SNARE and Associated Proteins AT3G52400 55.7 4.3e-80 295.0
Bpe01g00396 . 6 304 SNARE and Associated Proteins AT4G03330 66.9 3.7e-107 384.8
Bpe08g00351 . 6 304 SNARE and Associated Proteins AT4G03330 66.6 1.4e-106 382.9
Bpe04g01486 . 1248 1525 SNARE and Associated Proteins AT4G03330 58.4 2.0e-84 309.3
Bpe03g01190 . 29 278 SNARE and Associated Proteins AT4G03330 58.0 6.6e-80 294.3
Bpe04g00619 . 1 279 SNARE and Associated Proteins AT4G03330 55.4 6.2e-78 287.7
Bpe02g00700 . 1 284 SNARE and Associated Proteins AT4G03330 51.7 1.9e-74 276.2
Bpe01g00396 . 6 304 SNARE and Associated Proteins AT1G61290 78.6 2.3e-125 445.3
Bpe08g00351 . 6 308 SNARE and Associated Proteins AT1G61290 77.2 1.6e-123 439.1
Bpe04g01486 . 1248 1519 SNARE and Associated Proteins AT1G61290 62.9 9.1e-90 327.0
Bpe03g01190 . 1 277 SNARE and Associated Proteins AT1G61290 58.9 1.0e-85 313.5
Bpe04g00619 . 1 279 SNARE and Associated Proteins AT1G61290 59.8 1.5e-84 309.7
Bpe02g00700 . 1 294 SNARE and Associated Proteins AT1G61290 53.4 2.1e-78 289.3
Bpe01g00396 . 6 304 SNARE and Associated Proteins AT1G11250 76.3 1.7e-120 429.1
Bpe08g00351 . 6 308 SNARE and Associated Proteins AT1G11250 75.9 2.9e-120 428.3
Bpe04g01486 . 1248 1519 SNARE and Associated Proteins AT1G11250 64.0 1.0e-93 340.1
Bpe03g01190 . 1 278 SNARE and Associated Proteins AT1G11250 59.7 5.2e-90 327.8
Bpe04g00619 . 1 279 SNARE and Associated Proteins AT1G11250 61.3 1.7e-88 322.8
Bpe02g00700 . 1 284 SNARE and Associated Proteins AT1G11250 56.7 9.0e-82 300.4
Bpe07g00604 . 1 232 SNARE and Associated Proteins AT3G03800 59.9 2.3e-64 242.7
Bpe07g00233 BCT 1 263 SNARE and Associated Proteins AT5G16830 63.6 9.6e-78 287.0
Bpe05g00520 BCT 1 263 SNARE and Associated Proteins AT5G16830 62.1 1.5e-75 279.6
Bpe05g00520 BCT 1 274 SNARE and Associated Proteins AT5G46860 69.7 3.3e-83 305.1
Bpe07g00233 BCT 1 274 SNARE and Associated Proteins AT5G46860 70.4 7.3e-83 303.9
Bpe05g00520 BCT 1 257 SNARE and Associated Proteins AT4G17730 65.8 6.5e-76 280.8
Bpe07g00233 BCT 1 257 SNARE and Associated Proteins AT4G17730 64.6 3.2e-75 278.5
Bpe14g01345 . 1 182 SNARE and Associated Proteins AT4G17730 52.6 4.2e-43 171.8
Bpe07g00233 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 2.3e-49 193.0
Bpe05g00520 BCT 65 256 SNARE and Associated Proteins AT1G32270 57.3 2.0e-48 189.9
Bpe15g01148 . 5 341 SNARE and Associated Proteins AT5G05760 64.9 3.6e-111 398.3
Bpe02g01227 . 1 339 SNARE and Associated Proteins AT3G24350 65.7 2.7e-104 375.6
Bpe14g00562 . 444 797 SNARE and Associated Proteins AT3G24350 60.2 4.0e-100 361.7
Bpe02g01831 . 1 340 SNARE and Associated Proteins AT5G26980 76.2 1.1e-128 456.4
Bpe02g01831 . 1 338 SNARE and Associated Proteins AT4G02195 63.2 1.2e-103 373.2
Bpe02g01831 . 1 338 SNARE and Associated Proteins AT3G05710 76.0 1.7e-129 459.1
Bpe08g01109 CCT 1 225 SNARE and Associated Proteins AT1G16240 70.4 3.5e-81 298.1
Bpe03g00767 CCT 1 231 SNARE and Associated Proteins AT1G16240 57.7 2.0e-68 255.8
Bpe08g01109 CCT 1 225 SNARE and Associated Proteins AT1G79590 70.4 6.5e-84 307.4
Bpe03g00767 CCT 1 231 SNARE and Associated Proteins AT1G79590 59.8 1.2e-69 260.0
Bpe08g01119 . 58 251 SNARE and Associated Proteins AT1G28490 70.1 1.9e-67 252.3
Bpe11g00552 . 86 276 SNARE and Associated Proteins AT1G28490 66.5 5.1e-65 244.2
Bpe01g00179 . 1 286 SNARE and Associated Proteins AT3G09740 56.1 2.0e-80 295.8
Bpe04g01584 . 547 680 SNARE and Associated Proteins AT3G09740 64.6 2.0e-40 162.9
Bpe01g00179 . 1 286 SNARE and Associated Proteins AT3G45280 55.7 5.4e-78 287.7
Bpe01g00179 . 1 286 SNARE and Associated Proteins AT3G61450 52.6 9.3e-75 276.9
Bpe15g01257 . 65 262 SNARE and Associated Proteins AT1G51740 66.0 2.8e-65 245.4
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45
       

Transcriptome


Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Bpe07g00233 Bpe_Chr07 FPKM 13.963326 16.139284 26.210449 27.664064 20.033497 18.127344 23.127388 20.483625 19.01527 19.796881