Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Bpe07g00604 ATGGAGAAAGATATCGATGAAGTGGGAAAGATTGCACGAAGTGTGAAAACAAAGCTGGAAGCAATGAACAAGGAAAATTTAGCCAATAGAGAAAAGCCCGGATGTGGAAAGGGCACAGCAGTTGATCGGGCCAGACTGAATGTGACAAATGCTTTGACAAAGAAGTTCAAGGAGATAATGATTGAGTTTCAGGTATATCGACATTTAGTGATGTTTTTATATCAAAATGTATTTCATCCTATCCTCTTATCTGTATGCTTTCTTTATCAGACTCTCCGACAAAGAATTCAAGATGAATATCGTGAAACTATTGACCACCTCATCGAAACCGGAAATAGCGAACAAATCTTCCAAAAGGCGATTCAAGAATCAGGACGTGGACAGGTTATCAATACATTGGAAGAAATCCAGGAGAGGCATGATGCTGTAAGAGAAATCGAGGAAAAGCTTCTCGACTTACATCAGATTTATCTCGATATGGCAGTCTTAGTGGAGGCTCAAGGCGAAATTCTAGACAACATAGAAAACCAGGTTACGAATGCGGTTGATCACGTACAATCAGGGACAACTATGCTCCAAACTGCAAAGCAACTTCAGAGGAATTCTCGAAAGTGGATGTGCATTGCAATTCTTATTCTCTTGATAATAGTTGTCATAATAGTCGTCGGAGTCATCAAACCGTGGAAGAACAAGGGAGCGTAA 702 40.17 MEKDIDEVGKIARSVKTKLEAMNKENLANREKPGCGKGTAVDRARLNVTNALTKKFKEIMIEFQVYRHLVMFLYQNVFHPILLSVCFLYQTLRQRIQDEYRETIDHLIETGNSEQIFQKAIQESGRGQVINTLEEIQERHDAVREIEEKLLDLHQIYLDMAVLVEAQGEILDNIENQVTNAVDHVQSGTTMLQTAKQLQRNSRKWMCIAILILLIIVVIIVVGVIKPWKNKGA 233
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
7 12739294 12740621 - Bpe021456.1 Bpe07g00604 106373

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Bpe07g00604 233 CDD SNARE_syntaxin1-like 132 194 - -
Bpe07g00604 233 SMART tSNARE_6 128 195 IPR000727 -
Bpe07g00604 233 PANTHER SYNTAXIN OF PLANTS 122 PROTEIN 1 77 - -
Bpe07g00604 233 PANTHER SYNTAXIN OF PLANTS 122 PROTEIN 102 225 - -
Bpe07g00604 233 PANTHER SYNTAXIN 1 77 IPR045242 -
Bpe07g00604 233 Pfam SNARE domain 169 221 IPR000727 -
Bpe07g00604 233 PANTHER SYNTAXIN 102 225 IPR045242 -
Bpe07g00604 233 Pfam Syntaxin 1 168 IPR006011 GO:0016020
Bpe07g00604 233 Gene3D - 1 69 - -
Bpe07g00604 233 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 133 195 IPR000727 -
Bpe07g00604 233 SUPERFAMILY t-snare proteins 2 188 IPR010989 GO:0016020|GO:0016192
Bpe07g00604 233 Gene3D - 126 226 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bpe07g00604 K08486 STX1B_2_3; syntaxin 1B/2/3 - rcu:8264282 315.849
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Bpe07g00604 Bpe-Chr7:12739294 Bpe08g00351 Bpe-Chr8:2103594 3.40E-61 dispersed
Bpe07g00604 Bpe-Chr7:12739294 Bpe01g00396 Bpe-Chr1:2457994 1.76E-62 transposed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi12g523 . Blo15g00503 Bda06g00358 . . . . . . . . Cma20g00629 Car02g00135 Car20g00525 . . . . . . . . . . . . . . . . . Cone3ag1346 . . . . . . . . . . . . Bpe07g00604 . . . Cmo02g00163 Cmo20g00615 . . . . Cpe16g00449 Cpe05g01447 Bhi10g01451 . . . . . . Cla02g00831 Cam02g0975 Cec02g0887 Cco02g0923 Clacu02g0875 Cmu02g0866 Cre02g1184 . . . Cme11g00777
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bpe02g01227 . 1 339 SNARE and Associated Proteins AT3G24350 65.7 2.7e-104 375.6
Bpe14g00562 . 444 797 SNARE and Associated Proteins AT3G24350 60.2 4.0e-100 361.7
Bpe15g00424 . 1 290 SNARE and Associated Proteins AT2G18260 55.0 1.3e-80 296.6
Bpe07g00425 . 1 293 SNARE and Associated Proteins AT2G18260 51.2 2.6e-76 282.3
Bpe04g01486 . 1269 1525 SNARE and Associated Proteins AT3G11820 80.9 1.2e-113 406.4
Bpe03g01190 . 22 278 SNARE and Associated Proteins AT3G11820 79.0 1.1e-111 399.8
Bpe04g00619 . 19 279 SNARE and Associated Proteins AT3G11820 74.7 5.0e-107 384.4
Bpe02g00700 . 19 279 SNARE and Associated Proteins AT3G11820 70.1 1.9e-98 355.9
Bpe08g00351 . 36 286 SNARE and Associated Proteins AT3G11820 66.1 8.3e-94 340.5
Bpe01g00396 . 36 286 SNARE and Associated Proteins AT3G11820 65.7 7.0e-93 337.4
Bpe04g01486 . 1276 1525 SNARE and Associated Proteins AT3G52400 69.6 3.5e-90 328.6
Bpe04g00619 . 1 279 SNARE and Associated Proteins AT3G52400 61.9 7.3e-88 320.9
Bpe03g01190 . 29 278 SNARE and Associated Proteins AT3G52400 66.4 1.6e-87 319.7
Bpe02g00700 . 1 279 SNARE and Associated Proteins AT3G52400 60.8 6.9e-86 314.3
Bpe08g00351 . 6 286 SNARE and Associated Proteins AT3G52400 56.4 3.0e-81 298.9
Bpe01g00396 . 6 286 SNARE and Associated Proteins AT3G52400 55.7 4.3e-80 295.0
Bpe01g00396 . 6 304 SNARE and Associated Proteins AT4G03330 66.9 3.7e-107 384.8
Bpe08g00351 . 6 304 SNARE and Associated Proteins AT4G03330 66.6 1.4e-106 382.9
Bpe04g01486 . 1248 1525 SNARE and Associated Proteins AT4G03330 58.4 2.0e-84 309.3
Bpe03g01190 . 29 278 SNARE and Associated Proteins AT4G03330 58.0 6.6e-80 294.3
Bpe04g00619 . 1 279 SNARE and Associated Proteins AT4G03330 55.4 6.2e-78 287.7
Bpe02g00700 . 1 284 SNARE and Associated Proteins AT4G03330 51.7 1.9e-74 276.2
Bpe01g00396 . 6 304 SNARE and Associated Proteins AT1G61290 78.6 2.3e-125 445.3
Bpe08g00351 . 6 308 SNARE and Associated Proteins AT1G61290 77.2 1.6e-123 439.1
Bpe04g01486 . 1248 1519 SNARE and Associated Proteins AT1G61290 62.9 9.1e-90 327.0
Bpe03g01190 . 1 277 SNARE and Associated Proteins AT1G61290 58.9 1.0e-85 313.5
Bpe04g00619 . 1 279 SNARE and Associated Proteins AT1G61290 59.8 1.5e-84 309.7
Bpe02g00700 . 1 294 SNARE and Associated Proteins AT1G61290 53.4 2.1e-78 289.3
Bpe01g00396 . 6 304 SNARE and Associated Proteins AT1G11250 76.3 1.7e-120 429.1
Bpe08g00351 . 6 308 SNARE and Associated Proteins AT1G11250 75.9 2.9e-120 428.3
Bpe04g01486 . 1248 1519 SNARE and Associated Proteins AT1G11250 64.0 1.0e-93 340.1
Bpe03g01190 . 1 278 SNARE and Associated Proteins AT1G11250 59.7 5.2e-90 327.8
Bpe04g00619 . 1 279 SNARE and Associated Proteins AT1G11250 61.3 1.7e-88 322.8
Bpe02g00700 . 1 284 SNARE and Associated Proteins AT1G11250 56.7 9.0e-82 300.4
Bpe07g00604 . 1 232 SNARE and Associated Proteins AT3G03800 59.9 2.3e-64 242.7
Bpe07g00233 BCT 1 263 SNARE and Associated Proteins AT5G16830 63.6 9.6e-78 287.0
Bpe05g00520 BCT 1 263 SNARE and Associated Proteins AT5G16830 62.1 1.5e-75 279.6
Bpe05g00520 BCT 1 274 SNARE and Associated Proteins AT5G46860 69.7 3.3e-83 305.1
Bpe07g00233 BCT 1 274 SNARE and Associated Proteins AT5G46860 70.4 7.3e-83 303.9
Bpe05g00520 BCT 1 257 SNARE and Associated Proteins AT4G17730 65.8 6.5e-76 280.8
Bpe07g00233 BCT 1 257 SNARE and Associated Proteins AT4G17730 64.6 3.2e-75 278.5
Bpe14g01345 . 1 182 SNARE and Associated Proteins AT4G17730 52.6 4.2e-43 171.8
Bpe07g00233 BCT 65 256 SNARE and Associated Proteins AT1G32270 58.3 2.3e-49 193.0
Bpe05g00520 BCT 65 256 SNARE and Associated Proteins AT1G32270 57.3 2.0e-48 189.9
Bpe15g01148 . 5 341 SNARE and Associated Proteins AT5G05760 64.9 3.6e-111 398.3
Bpe02g01227 . 1 339 SNARE and Associated Proteins AT3G24350 65.7 2.7e-104 375.6
Bpe14g00562 . 444 797 SNARE and Associated Proteins AT3G24350 60.2 4.0e-100 361.7
Bpe02g01831 . 1 340 SNARE and Associated Proteins AT5G26980 76.2 1.1e-128 456.4
Bpe02g01831 . 1 338 SNARE and Associated Proteins AT4G02195 63.2 1.2e-103 373.2
Bpe02g01831 . 1 338 SNARE and Associated Proteins AT3G05710 76.0 1.7e-129 459.1
Bpe08g01109 CCT 1 225 SNARE and Associated Proteins AT1G16240 70.4 3.5e-81 298.1
Bpe03g00767 CCT 1 231 SNARE and Associated Proteins AT1G16240 57.7 2.0e-68 255.8
Bpe08g01109 CCT 1 225 SNARE and Associated Proteins AT1G79590 70.4 6.5e-84 307.4
Bpe03g00767 CCT 1 231 SNARE and Associated Proteins AT1G79590 59.8 1.2e-69 260.0
Bpe08g01119 . 58 251 SNARE and Associated Proteins AT1G28490 70.1 1.9e-67 252.3
Bpe11g00552 . 86 276 SNARE and Associated Proteins AT1G28490 66.5 5.1e-65 244.2
Bpe01g00179 . 1 286 SNARE and Associated Proteins AT3G09740 56.1 2.0e-80 295.8
Bpe04g01584 . 547 680 SNARE and Associated Proteins AT3G09740 64.6 2.0e-40 162.9
Bpe01g00179 . 1 286 SNARE and Associated Proteins AT3G45280 55.7 5.4e-78 287.7
Bpe01g00179 . 1 286 SNARE and Associated Proteins AT3G61450 52.6 9.3e-75 276.9
Bpe15g01257 . 65 262 SNARE and Associated Proteins AT1G51740 66.0 2.8e-65 245.4
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0001189 1 6 1 1 1 2 3 2 2 2 2 2 3 2 3 3 2 4 3 2 3 1 2 3 3 2 3 8 3 2 77
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Bpe07g00604 Bpe_Chr07 FPKM 3.930444 5.138108 4.921475 5.112684 9.452355 7.886724 9.905903 0.979049 1.164981 1.010258