Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cam10g0137 ATGTCGTTGTTCTTCTCGGTTTCCGACAAATCTCAGCCACCCACGTGTCCCCAACTCCAGGATCTCGGCGACATGAGCTTTCAAGATATCGAGGCTGGTCGCCCCTTTGCGTCTTCGAGGAGAGACCTCATCAATGGCAAACAAGATCCCACGCAAGCCGTTGCTTCGGGTATATTTCAGATTAATACTGCCGTCGCTACGTTTCAGAGGCTTGTTAATACCTTAGGAACGCCGAAGGATACGCCTGAGCTACGAGAGAAGCTGCACAAGACCAGGTTACATATTGGACAGTTGGTTAAAGATACATCCGCTAAACTTAAACAAGCCAGCGAAATAGATCATCACGCTGAAGTTAATGCCAGCAAGAAAATTGCAGATGCTAAACTTGCGAAAGATTTTCAAGCAGTGTTGAAGGAATTTCAGAAGGCTCAACGACTTGCAGCTGAGAGGGAAACAGCATATACACCTTTTGTTCCCCAAACTGTTCTACCTTCTAGCTACACAGCCGGCGAGGCAGATGCAAGCTCAGAAAAGAATCTTGAACAGCGTGCCCTCCTTGTGGAATCCAGGAGACAAGAGGTCTTGCTGTTAGACAATGAAATAGCCTTCAATGAGGCAATAATTGAGGAAAGAGAGCAAGGCATTCATGAAATCCAGCAGCAAATTGGAGAAGTGAATGAAATCTTTAAAGATCTTGCAGTTCTAGTCCATGAACAGGGAGCCATGATTGATGATATTGGATCCAACATAGAGGGTGCCCATGCTGCAACGTCACAGGGAACAACTCAGCTTGCAAAAGCTTCAAAGACACAAAGATCAAATTCATCTCTGGCTTGTTTACTTTTGGTGATATTTGGTATTATCCTCCTCATTGTGATCATAATAGTTGTTGCTTAA 897 44.7 MSLFFSVSDKSQPPTCPQLQDLGDMSFQDIEAGRPFASSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSAKLKQASEIDHHAEVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYTPFVPQTVLPSSYTAGEADASSEKNLEQRALLVESRRQEVLLLDNEIAFNEAIIEEREQGIHEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIEGAHAATSQGTTQLAKASKTQRSNSSLACLLLVIFGIILLIVIIIVVA 298
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
10 2991112 2995953 + CaPI482276_10g001370.1 Cam10g0137 136800

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cam10g0137 298 SUPERFAMILY t-snare proteins 48 260 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Cam10g0137 298 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 205 267 IPR000727 -
Cam10g0137 298 Pfam Syntaxin-like protein 54 154 IPR006011 GO:0016020(InterPro)
Cam10g0137 298 Gene3D - 198 298 - -
Cam10g0137 298 FunFam Syntaxin-22 like 45 158 - -
Cam10g0137 298 Gene3D - 45 158 - -
Cam10g0137 298 ProSitePatterns Syntaxin / epimorphin family signature. 211 250 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Cam10g0137 298 CDD SNARE_Qa 208 266 - -
Cam10g0137 298 SMART SynN_4 40 152 IPR006011 GO:0016020(InterPro)
Cam10g0137 298 CDD SynN 48 171 IPR006011 GO:0016020(InterPro)
Cam10g0137 298 SMART tSNARE_6 200 267 IPR000727 -
Cam10g0137 298 PANTHER SYNTAXIN 61 288 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Cam10g0137 298 FunFam Syntaxin-22 like 198 298 - -
Cam10g0137 298 Pfam SNARE domain 242 293 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cam10g0137 - - - - 0.0
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cam08g1742 . 8 363 SNARE and Associated Proteins AT3G24350 55.8 5.7e-87 318.2
Cam04g0520 . 1 309 SNARE and Associated Proteins AT1G08560 69.6 2.7e-101 365.5
Cam01g2004 . 484 786 SNARE and Associated Proteins AT2G18260 55.2 8.3e-87 317.4
Cam10g1787 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.3e-115 411.8
Cam01g1547 . 26 282 SNARE and Associated Proteins AT3G11820 73.2 2.2e-103 372.5
Cam03g0557 . 31 281 SNARE and Associated Proteins AT3G11820 66.5 1.4e-92 336.7
Cam10g1328 . 510 764 SNARE and Associated Proteins AT3G11820 52.9 1.6e-69 260.0
Cam10g1787 . 1 279 SNARE and Associated Proteins AT3G52400 63.9 5.6e-92 334.7
Cam01g1547 . 33 282 SNARE and Associated Proteins AT3G52400 65.2 6.0e-86 314.7
Cam03g0557 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 3.4e-81 298.9
Cam10g1328 . 512 764 SNARE and Associated Proteins AT3G52400 50.6 3.9e-61 232.3
Cam03g0557 . 1 299 SNARE and Associated Proteins AT4G03330 68.9 8.5e-108 387.1
Cam10g1787 . 1 284 SNARE and Associated Proteins AT4G03330 57.2 2.9e-84 308.9
Cam01g1547 . 1 297 SNARE and Associated Proteins AT4G03330 52.6 2.2e-79 292.7
Cam10g1328 . 501 764 SNARE and Associated Proteins AT4G03330 53.8 8.6e-68 254.2
Cam03g0557 . 1 299 SNARE and Associated Proteins AT1G61290 78.9 2.8e-127 451.8
Cam10g1787 . 1 284 SNARE and Associated Proteins AT1G61290 62.0 2.5e-91 332.4
Cam01g1547 . 1 297 SNARE and Associated Proteins AT1G61290 56.9 4.1e-86 315.1
Cam10g1328 . 516 764 SNARE and Associated Proteins AT1G61290 50.6 1.4e-62 236.9
Cam03g0557 . 1 299 SNARE and Associated Proteins AT1G11250 77.9 4.8e-124 441.0
Cam10g1787 . 1 284 SNARE and Associated Proteins AT1G11250 62.0 1.5e-93 339.7
Cam01g1547 . 1 292 SNARE and Associated Proteins AT1G11250 57.5 2.8e-87 318.9
Cam10g1328 . 500 764 SNARE and Associated Proteins AT1G11250 50.6 3.5e-66 248.8
Cam10g1328 . 488 783 SNARE and Associated Proteins AT3G03800 74.3 9.7e-112 400.2
Cam02g0975 . 58 291 SNARE and Associated Proteins AT3G03800 59.8 6.4e-71 264.6
Cam10g1328 . 488 682 SNARE and Associated Proteins AT5G08080 79.6 3.9e-78 288.1
Cam02g0975 . 54 244 SNARE and Associated Proteins AT5G08080 59.7 2.2e-52 202.6
Cam10g0137 . 25 280 SNARE and Associated Proteins AT5G16830 59.5 7.9e-76 280.8
Cam10g0137 . 25 280 SNARE and Associated Proteins AT5G46860 66.0 3.9e-80 295.0
Cam10g0137 . 25 280 SNARE and Associated Proteins AT4G17730 60.9 2.6e-73 272.3
Cam10g0137 . 89 280 SNARE and Associated Proteins AT1G32270 59.9 4.3e-52 202.2
Cam07g0410 . 83 418 SNARE and Associated Proteins AT5G05760 66.2 3.7e-112 401.7
Cam08g1742 . 8 363 SNARE and Associated Proteins AT3G24350 55.8 5.7e-87 318.2
Cam02g1577 . 35 350 SNARE and Associated Proteins AT5G26980 76.3 1.5e-123 439.5
Cam09g0545 . 1 318 SNARE and Associated Proteins AT5G26980 66.5 1.5e-102 369.8
Cam09g0545 . 1 318 SNARE and Associated Proteins AT4G02195 66.8 2.5e-105 379.0
Cam02g1577 . 35 348 SNARE and Associated Proteins AT4G02195 63.9 2.4e-100 362.5
Cam02g1577 . 35 350 SNARE and Associated Proteins AT3G05710 75.4 4.9e-125 444.5
Cam09g0545 . 1 318 SNARE and Associated Proteins AT3G05710 64.0 6.0e-99 357.8
Cam09g1092 . 77 309 SNARE and Associated Proteins AT1G16240 72.1 2.3e-89 325.5
Cam10g0445 . 32 247 SNARE and Associated Proteins AT1G16240 68.5 2.0e-77 285.8
Cam09g1092 . 76 309 SNARE and Associated Proteins AT1G79590 71.4 3.8e-88 321.6
Cam10g0445 . 27 247 SNARE and Associated Proteins AT1G79590 67.4 1.4e-79 293.1
Cam06g0176 . 125 315 SNARE and Associated Proteins AT1G28490 71.7 8.2e-67 250.4
Cam10g2004 . 77 340 SNARE and Associated Proteins AT3G09740 79.7 2.6e-113 405.2
Cam02g2177 . 1 264 SNARE and Associated Proteins AT3G09740 67.8 2.5e-95 345.5
Cam02g2177 . 1 264 SNARE and Associated Proteins AT3G45280 65.5 2.8e-91 332.0
Cam10g2004 . 77 340 SNARE and Associated Proteins AT3G45280 64.4 8.6e-88 320.5
Cam10g2004 . 77 337 SNARE and Associated Proteins AT3G61450 68.2 7.1e-95 344.0
Cam02g2177 . 1 261 SNARE and Associated Proteins AT3G61450 61.4 4.3e-84 308.1
Cam11g0668 . 65 309 SNARE and Associated Proteins AT1G51740 72.1 2.5e-89 325.5
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45