Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Car06g00569 ATGAGCTTTCAAGATATCGAGGCTGGTCGTCCGTTTGCTTCTTCGAGGAGAGACCTCGTCAATGGCAAACAAGATCCCACGCAAGCCGTTGCCTCGGGTATTTTTCAGATTAATACTGCCGTCGCTACGTTTCAGAGGCTTGTTAACACCTTGGGAACGCCGAAGGATACTCCCGAGCTACGCGAGAAGCTGCACAAGACCAGGTTACATATTGGACAGTTGGTTAAAGACACCTCTGCTAAACTTAAACAAGCCAGTGAAATAGATCATCACGCTGGAGTTAACGCCAGCAAGAAAATTGCAGATGCTAAGCTTGCAAAAGATTTTCAAGCAGTGTTGAAAGAATTTCAGAAGGCTCAACGACTTGCAGCTGAGAGGGAAACAGCATATACACCGTTTGTTCCCCAGGCAGTTCTACCTTCTAGCTACACAGCCGGTGAGTCAGATGCAAGCTCAGAAAATAATCTTGAACAGCGTGCCCTCCTTGTGGAATCCAGGAGACAAGAGGTCTTGCTGCTGGACAATGAAATTGCCTTCAATGAGGCAATAATTGAGGAAAGAGAACAAGGTATTCATGAAATCCAGCAGCAAATTGGAGAGGTCAATGAAATTTTCAAAGATCTCGCTGTTCTAGTACATGAACAGGGAGCCATGATTGATGATATTGGATCCAACATTGAGAGTTCCCACGCTGCAACATCACAGGGAACAACTCAGCTTGTCAAAGCTTCAAAGACACAAAGATCAAATTCATCTCTGGCTTGCTTGCTTTTGGTGATATTTGGTATAATCCTTCTCATTGTGATCATAATAGTTGTTGCTTAA 825 44.24 MSFQDIEAGRPFASSRRDLVNGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSAKLKQASEIDHHAGVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYTPFVPQAVLPSSYTAGESDASSENNLEQRALLVESRRQEVLLLDNEIAFNEAIIEEREQGIHEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIESSHAATSQGTTQLVKASKTQRSNSSLACLLLVIFGIILLIVIIIVVA 274
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
6 3253771 3259020 + Carg23394-RA Car06g00569 150305

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Car06g00569 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020|GO:0016192
Car06g00569 274 Gene3D - 21 134 - -
Car06g00569 274 PANTHER SYNTAXIN 5 272 IPR045242 -
Car06g00569 274 PANTHER SYNTAXIN OF PLANTS PROTEIN 5 272 - -
Car06g00569 274 CDD SynN 24 158 IPR006011 GO:0016020
Car06g00569 274 Pfam SNARE domain 218 269 IPR000727 -
Car06g00569 274 SMART tSNARE_6 176 243 IPR000727 -
Car06g00569 274 CDD SNARE_Qa 184 242 - -
Car06g00569 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Car06g00569 274 Pfam Syntaxin-like protein 31 130 IPR006011 GO:0016020
Car06g00569 274 SMART SynN_4 16 128 IPR006011 GO:0016020
Car06g00569 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484|GO:0006886|GO:0016020
Car06g00569 274 Gene3D - 174 274 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Car06g00569 - - K08488 bhj:120089793 449.514
       

WGDs- Genes

Select Gene_1 Gene_2 Event_name
Car06g00569 Car16g01109 CST
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Car05g00958 Car-Chr5:9180189 Car06g00569 Car-Chr6:3253771 7.49E-11 dispersed
Car06g00569 Car-Chr6:3253771 Car12g01004 Car-Chr12:10021081 2.20E-13 dispersed
Car16g01109 Car-Chr16:9558909 Car06g00569 Car-Chr6:3253771 0 wgd
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Car05g00589 . 8 338 SNARE and Associated Proteins AT3G24350 64.8 3.1e-103 372.5
Car12g00284 . 8 342 SNARE and Associated Proteins AT3G24350 64.8 4.9e-101 365.2
Car07g01140 . 1 308 SNARE and Associated Proteins AT1G08560 69.0 1.3e-102 370.2
Car03g00212 . 1 312 SNARE and Associated Proteins AT1G08560 68.0 6.3e-97 351.3
Car03g00676 . 36 336 SNARE and Associated Proteins AT2G18260 53.4 3.0e-83 305.8
Car06g00468 . 19 279 SNARE and Associated Proteins AT3G11820 77.4 7.8e-111 397.5
Car14g00335 . 19 256 SNARE and Associated Proteins AT3G11820 81.5 8.4e-105 377.5
Car07g00809 . 21 278 SNARE and Associated Proteins AT3G11820 69.8 6.9e-99 357.8
Car18g00320 . 31 281 SNARE and Associated Proteins AT3G11820 67.3 2.3e-94 342.8
Car13g00552 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 1.8e-91 333.2
Car14g00978 . 27 285 SNARE and Associated Proteins AT3G11820 52.1 5.7e-69 258.5
Car06g00468 . 1 279 SNARE and Associated Proteins AT3G52400 61.5 5.9e-88 321.6
Car14g00335 . 1 256 SNARE and Associated Proteins AT3G52400 64.9 8.0e-85 311.2
Car07g00809 . 1 277 SNARE and Associated Proteins AT3G52400 59.0 2.3e-84 309.7
Car13g00552 . 1 281 SNARE and Associated Proteins AT3G52400 56.5 1.8e-81 300.1
Car18g00320 . 1 281 SNARE and Associated Proteins AT3G52400 55.3 1.3e-79 293.9
Car18g00320 . 1 295 SNARE and Associated Proteins AT4G03330 69.8 8.7e-107 384.0
Car13g00552 . 1 299 SNARE and Associated Proteins AT4G03330 67.5 1.1e-106 383.6
Car06g00468 . 1 284 SNARE and Associated Proteins AT4G03330 56.6 9.6e-82 300.8
Car14g00335 . 1 281 SNARE and Associated Proteins AT4G03330 55.1 7.2e-77 284.6
Car07g00809 . 1 278 SNARE and Associated Proteins AT4G03330 52.5 6.7e-75 278.1
Car14g00978 . 1 285 SNARE and Associated Proteins AT4G03330 52.3 1.4e-69 260.4
Car18g00320 . 1 303 SNARE and Associated Proteins AT1G61290 78.5 5.2e-128 454.5
Car13g00552 . 1 303 SNARE and Associated Proteins AT1G61290 77.2 6.3e-126 447.6
Car06g00468 . 1 294 SNARE and Associated Proteins AT1G61290 59.8 2.3e-91 332.8
Car14g00335 . 1 256 SNARE and Associated Proteins AT1G61290 62.8 8.7e-83 304.3
Car07g00809 . 1 296 SNARE and Associated Proteins AT1G61290 54.5 4.8e-81 298.5
Car18g00320 . 1 303 SNARE and Associated Proteins AT1G11250 78.2 2.8e-126 448.7
Car13g00552 . 1 303 SNARE and Associated Proteins AT1G11250 76.6 3.8e-123 438.3
Car06g00468 . 1 294 SNARE and Associated Proteins AT1G11250 60.2 6.3e-94 341.3
Car14g00335 . 1 256 SNARE and Associated Proteins AT1G11250 63.3 8.2e-86 314.3
Car07g00809 . 1 291 SNARE and Associated Proteins AT1G11250 54.3 3.2e-82 302.4
Car14g00978 . 1 285 SNARE and Associated Proteins AT1G11250 50.5 3.7e-70 262.3
Car14g00978 . 1 308 SNARE and Associated Proteins AT3G03800 73.7 2.4e-117 419.1
Car14g00978 . 1 203 SNARE and Associated Proteins AT5G08080 76.8 1.0e-80 297.0
Car06g00569 CST 1 256 SNARE and Associated Proteins AT5G16830 59.9 9.5e-76 280.8
Car16g01109 CST 1 253 SNARE and Associated Proteins AT5G16830 59.8 2.3e-74 276.2
Car06g00569 CST 1 256 SNARE and Associated Proteins AT5G46860 66.8 2.5e-81 299.3
Car16g01109 CST 1 253 SNARE and Associated Proteins AT5G46860 66.8 3.0e-79 292.4
Car06g00569 CST 1 256 SNARE and Associated Proteins AT4G17730 61.3 2.9e-74 275.8
Car16g01109 CST 1 242 SNARE and Associated Proteins AT4G17730 64.0 1.1e-73 273.9
Car16g01109 CST 65 254 SNARE and Associated Proteins AT1G32270 60.5 8.9e-52 201.4
Car06g00569 CST 65 256 SNARE and Associated Proteins AT1G32270 60.4 1.2e-51 201.1
Car04g01051 . 1 334 SNARE and Associated Proteins AT5G05760 64.8 3.2e-110 395.6
Car04g00154 . 1 342 SNARE and Associated Proteins AT5G05760 56.5 1.4e-94 343.6
Car05g00589 . 8 338 SNARE and Associated Proteins AT3G24350 64.8 3.1e-103 372.5
Car12g00284 . 8 342 SNARE and Associated Proteins AT3G24350 64.8 4.9e-101 365.2
Car12g01004 CST 1 327 SNARE and Associated Proteins AT5G26980 75.2 8.8e-126 447.2
Car05g00958 CST 1 328 SNARE and Associated Proteins AT5G26980 75.9 1.5e-125 446.4
Car17g01008 . 1 320 SNARE and Associated Proteins AT5G26980 66.2 2.3e-102 369.4
Car05g00958 CST 1 330 SNARE and Associated Proteins AT4G02195 64.0 2.0e-106 382.9
Car17g01008 . 1 320 SNARE and Associated Proteins AT4G02195 65.3 8.0e-103 370.9
Car12g01004 CST 1 329 SNARE and Associated Proteins AT4G02195 62.8 3.1e-102 369.0
Car05g00958 CST 1 329 SNARE and Associated Proteins AT3G05710 75.1 5.7e-128 454.5
Car12g01004 CST 1 328 SNARE and Associated Proteins AT3G05710 73.9 1.4e-126 449.9
Car17g01008 . 1 320 SNARE and Associated Proteins AT3G05710 64.0 1.5e-99 360.1
Car01g00980 CCT,CST 1 233 SNARE and Associated Proteins AT1G16240 73.4 3.0e-91 332.0
Car16g00895 CCT 21 180 SNARE and Associated Proteins AT1G16240 70.0 1.5e-58 223.4
Car09g00889 CCT,CST 1 137 SNARE and Associated Proteins AT1G16240 67.4 7.2e-45 177.9
Car01g00980 CCT,CST 1 233 SNARE and Associated Proteins AT1G79590 73.0 1.7e-90 329.7
Car16g00895 CCT 21 180 SNARE and Associated Proteins AT1G79590 69.4 6.0e-56 214.9
Car09g00889 CCT,CST 1 137 SNARE and Associated Proteins AT1G79590 67.4 1.6e-45 180.3
Car05g00763 . 105 281 SNARE and Associated Proteins AT1G28490 67.8 1.2e-59 226.9
Car17g00040 . 107 261 SNARE and Associated Proteins AT1G28490 67.7 5.8e-51 198.0
Car01g00929 . 1 261 SNARE and Associated Proteins AT3G09740 77.6 2.1e-109 392.5
Car14g00181 . 1 278 SNARE and Associated Proteins AT3G09740 73.6 1.8e-108 389.4
Car17g00563 . 35 298 SNARE and Associated Proteins AT3G09740 67.5 4.3e-94 341.7
Car20g00420 . 33 269 SNARE and Associated Proteins AT3G09740 53.7 3.4e-59 225.7
Car17g00563 . 35 298 SNARE and Associated Proteins AT3G45280 63.8 3.3e-86 315.5
Car01g00929 . 1 261 SNARE and Associated Proteins AT3G45280 63.6 4.3e-86 315.1
Car14g00181 . 1 278 SNARE and Associated Proteins AT3G45280 59.8 2.0e-83 306.2
Car20g00420 . 33 269 SNARE and Associated Proteins AT3G45280 51.4 2.3e-55 213.0
Car01g00929 . 1 261 SNARE and Associated Proteins AT3G61450 68.9 6.5e-95 344.4
Car14g00181 . 1 275 SNARE and Associated Proteins AT3G61450 65.5 8.0e-93 337.4
Car17g00563 . 35 295 SNARE and Associated Proteins AT3G61450 60.5 2.0e-83 306.2
Car04g02811 CST 65 309 SNARE and Associated Proteins AT1G51740 74.4 5.2e-94 341.3
Car15g00129 CST 65 306 SNARE and Associated Proteins AT1G51740 72.8 1.2e-90 330.1
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Car06g00569 Car_Chr06 FPKM 1.666085 1.830304 0.0 0.0 7.130025 6.121847 6.044409 0.435795 0.737422 0.0