Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cco02g0923 ATGAACGATTTGCTCACGGACTCATTCGTTAGCGATGCCAAAGGTGAGGCTTCTAGAGAAATTGATCTCGAGAAGGGAACTCGAGTTCCGCGAAGCAATTCTGACATGGGAATGGAGGCCTTCAATAAGCAGATACAAGACGTTGAGGTTCAAGTAGAGAACCTCTCTGGGCTTCTTATTAAACTGAAGGATGCTAATGAGGAATCGAAGGCTGTTACCAAAGCATTAGAGATGAAAGTCGTTTACTTCTTTAGCGTTTGTTTCAGTCTTAGTACCACATGTCTGTTTGCTCCAAGGGCTCTTGTCATTTCAGCTATCAAGAAGCGTATGGAAAAGGATATCGATGAAGTAGGGAAAATAGCACGCAATGTCAAGGGGAAGCTGGAGGCCAACTTGACCAATAGGCAGAAGCCCGGGTGTGAGAAGGGAACGGCTATTGACAGAGCAAGAATGAACGTGACAAATGCCTTGACAAAAAAGTTCAAGGATCTGATGATAGAATTTCAGACCCTTCGGCAAAGAATTCAAGATGAGTACCGCGAAGTCGTGGAAAGACGAGTGATTACAGTTACGGGAAGCAGACCAGATGAGACGACAATTGATCACCTTATAGAAACTGGAAACAGTGAGCAAATATTCCAGAATGCATTTGTACAAATGGGACGAGGACAGGTTATGAGTGCGGTGGAGGAAATTCAAGAGCGACACGATGCAGTTAAAGAGATTGAGAAAAGGCTCTCAGAATTGCATCAGATTTACCTTGACATGGCAGTTTTATTGGAAGCCCAGAGTGAAATTTTGGATAACATAGAAAATCAGGTAACGAATGCAGTGGACCACGTTCGAACGGGAACCGATGCACTCCAGACAGCGAAGAGCTTACAGAAGCGATCAAGAAAATGCATGATGATTGGCATCATATTGCTGCTGGTCATAGCAATCATAATCGTCCTCGCAGTGCATCCATGGAAGAAGTAA 978 44.07 MNDLLTDSFVSDAKGEASREIDLEKGTRVPRSNSDMGMEAFNKQIQDVEVQVENLSGLLIKLKDANEESKAVTKALEMKVVYFFSVCFSLSTTCLFAPRALVISAIKKRMEKDIDEVGKIARNVKGKLEANLTNRQKPGCEKGTAIDRARMNVTNALTKKFKDLMIEFQTLRQRIQDEYREVVERRVITVTGSRPDETTIDHLIETGNSEQIFQNAFVQMGRGQVMSAVEEIQERHDAVKEIEKRLSELHQIYLDMAVLLEAQSEILDNIENQVTNAVDHVRTGTDALQTAKSLQKRSRKCMMIGIILLLVIAIIIVLAVHPWKK 325
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
2 11123290 11126377 - CcPI632755_02g009230.1 Cco02g0923 171680

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cco02g0923 325 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 229 291 IPR000727 -
Cco02g0923 325 Pfam Syntaxin 102 263 IPR006011 GO:0016020(InterPro)
Cco02g0923 325 Gene3D - 38 187 - -
Cco02g0923 325 SUPERFAMILY t-snare proteins 104 284 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Cco02g0923 325 Gene3D - 219 321 - -
Cco02g0923 325 PANTHER SYNTAXIN 40 310 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0005886(PANTHER)|GO:0006886(PANTHER)|GO:0006887(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Cco02g0923 325 FunFam Syntaxin 132 222 322 - -
Cco02g0923 325 Coils Coil 38 65 - -
Cco02g0923 325 CDD SynN 38 216 IPR006011 GO:0016020(InterPro)
Cco02g0923 325 CDD SNARE_syntaxin1-like 228 290 - -
Cco02g0923 325 SMART SynN_4 33 180 IPR006011 GO:0016020(InterPro)
Cco02g0923 325 Pfam SNARE domain 265 317 IPR000727 -
Cco02g0923 325 SMART tSNARE_6 224 291 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cco02g0923 K08486 - - csv:101214355 483.796
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cco02g0923 Cco-Chr2:11123290 Cco10g1337 Cco-Chr10:26334438 1.30E-82 dispersed
Cco02g0919 Cco-Chr2:11073483 Cco02g0923 Cco-Chr2:11123290 9.90E-67 proximal
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi12g523 . Blo15g00503 Bda06g00358 . . . . . . . . Cma20g00629 Car02g00135 Car20g00525 . . . . . . . . . . . . . . . . . Cone3ag1346 . . . . . . . . . . . . Bpe07g00604 . . . Cmo02g00163 Cmo20g00615 . . . . Cpe16g00449 Cpe05g01447 Bhi10g01451 . . . . . . Cla02g00831 Cam02g0975 Cec02g0887 Cco02g0923 Clacu02g0875 Cmu02g0866 Cre02g1184 . . . Cme11g00777
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cco08g1446 . 8 365 SNARE and Associated Proteins AT3G24350 55.6 3.6e-89 325.5
Cco04g0763 . 1 309 SNARE and Associated Proteins AT1G08560 69.6 1.4e-100 363.2
Cco04g1722 . 1 242 SNARE and Associated Proteins AT2G18260 55.7 3.8e-71 265.4
Cco10g1812 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.4e-115 411.8
Cco04g1261 . 26 282 SNARE and Associated Proteins AT3G11820 73.2 1.3e-103 373.2
Cco03g0560 . 31 281 SNARE and Associated Proteins AT3G11820 66.5 1.1e-92 337.0
Cco10g1337 . 30 284 SNARE and Associated Proteins AT3G11820 52.9 3.6e-69 258.8
Cco10g1812 . 1 279 SNARE and Associated Proteins AT3G52400 63.9 5.7e-92 334.7
Cco04g1261 . 33 282 SNARE and Associated Proteins AT3G52400 64.8 2.3e-85 312.8
Cco03g0560 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 3.4e-81 298.9
Cco03g0560 . 1 299 SNARE and Associated Proteins AT4G03330 69.2 3.0e-108 388.7
Cco10g1812 . 1 284 SNARE and Associated Proteins AT4G03330 57.2 3.0e-84 308.9
Cco04g1261 . 1 297 SNARE and Associated Proteins AT4G03330 52.3 8.4e-79 290.8
Cco10g1337 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 1.2e-69 260.4
Cco03g0560 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 9.7e-128 453.4
Cco10g1812 . 1 284 SNARE and Associated Proteins AT1G61290 62.0 2.5e-91 332.4
Cco04g1261 . 1 297 SNARE and Associated Proteins AT1G61290 56.9 9.2e-86 313.9
Cco03g0560 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 1.7e-124 442.6
Cco10g1812 . 1 284 SNARE and Associated Proteins AT1G11250 62.0 1.5e-93 339.7
Cco04g1261 . 1 291 SNARE and Associated Proteins AT1G11250 57.4 6.3e-87 317.8
Cco10g1337 . 1 303 SNARE and Associated Proteins AT3G03800 74.3 9.5e-115 410.2
Cco10g1337 . 1 202 SNARE and Associated Proteins AT5G08080 79.3 2.9e-81 298.5
Cco02g0923 . 1 225 SNARE and Associated Proteins AT5G08080 52.4 2.8e-47 185.7
Cco10g0147 . 1 256 SNARE and Associated Proteins AT5G16830 59.5 7.9e-76 280.8
Cco10g0147 . 1 256 SNARE and Associated Proteins AT5G46860 66.0 3.9e-80 295.0
Cco10g0147 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 2.7e-73 272.3
Cco10g0147 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 4.4e-52 202.2
Cco07g0418 . 51 386 SNARE and Associated Proteins AT5G05760 65.9 3.1e-111 398.7
Cco08g1446 . 8 365 SNARE and Associated Proteins AT3G24350 55.6 3.6e-89 325.5
Cco02g1642 . 1 327 SNARE and Associated Proteins AT5G26980 76.1 3.0e-127 451.8
Cco09g0532 . 1 318 SNARE and Associated Proteins AT5G26980 66.2 1.3e-101 366.7
Cco09g0532 . 1 318 SNARE and Associated Proteins AT4G02195 67.1 1.1e-105 380.2
Cco02g1642 . 1 329 SNARE and Associated Proteins AT4G02195 64.0 7.2e-105 377.5
Cco02g1642 . 1 328 SNARE and Associated Proteins AT3G05710 75.7 2.5e-129 458.8
Cco09g0532 . 1 318 SNARE and Associated Proteins AT3G05710 63.7 5.1e-98 354.8
Cco09g1113 . 1 233 SNARE and Associated Proteins AT1G16240 72.1 2.3e-89 325.5
Cco10g0456 . 32 253 SNARE and Associated Proteins AT1G16240 68.5 2.0e-80 295.8
Cco09g1113 . 1 233 SNARE and Associated Proteins AT1G79590 71.2 1.1e-87 320.1
Cco10g0456 . 27 253 SNARE and Associated Proteins AT1G79590 67.0 9.2e-82 300.4
Cco06g0051 . 232 422 SNARE and Associated Proteins AT1G28490 71.7 8.3e-67 250.4
Cco10g2031 . 1 264 SNARE and Associated Proteins AT3G09740 78.9 3.8e-112 401.4
Cco02g2256 . 1 265 SNARE and Associated Proteins AT3G09740 67.4 4.3e-95 344.7
Cco02g2256 . 1 265 SNARE and Associated Proteins AT3G45280 65.2 1.4e-90 329.7
Cco10g2031 . 1 264 SNARE and Associated Proteins AT3G45280 63.7 1.3e-86 316.6
Cco10g2031 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.1e-94 340.9
Cco02g2256 . 1 262 SNARE and Associated Proteins AT3G61450 61.4 1.8e-85 312.8
Cco11g0653 . 65 309 SNARE and Associated Proteins AT1G51740 72.9 1.7e-90 329.3
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0001189 1 6 1 1 1 2 3 2 2 2 2 2 3 2 3 3 2 4 3 2 3 1 2 3 3 2 3 8 3 2 77