Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Cco02g2370 TTATCCTTAGCCCTTCTTGCTGGATCGCCTCTCTTCGGTCTTCCATTATATATCTATCCTCAGTTTAGCCGTCGAAAAACCCTAGCCTCGCGTCTTCTCCCAAGGAAAGACGAAGCTCCGAAAATGAGCAAACTTCAGAGCGATGCTTTGAGAGAAGCCATTTCATCTATCTTCGCTGATAGCAGTGAAAAGAAGCGCAACTTTACTGAGACCATTGAACTTCAGATTGGACTGAAGAACTATGATCCACAAAAGGACAAGCGTTTCAGTGGATCAGTGAAGTTGCCCCATATCCCTCGCCCTAAGATGAAGATTTGCATGCTTGGAGATGCCTCTCACGTTGAAGAGGCAGAGAAAATCGGTTTGGATTATATGGACGTTGAAGGTTTGAAGAAGCTAAACAAAAACAAGAAGTTGGTGAAGAAACTTGCCAAGAAGTATCATGCCTTTTTAGCATCTGAAGCTATTATTAAGCAAATTCCCCGTCTTCTGGGCCCTGGGCTCAACAAGGCAGGGAAGTTCCCTACCCTGGTCACTCACCAAGAATCTCTTGAATCTAAAGTAAATGAGACTAAGGCAATGGTTAAGTTCCAATTGAAGAAGGTTCTTTGTATGGGTGTGGCCGTAGGCAATGTGGCCATGGAAGAGAAACAAGTTTTCCAGAACGTTCAAATGAGTGTCAATTTCCTTGTTTCCTTGTTGAAAAAGAATTGGCAAAATGTGAGGTGCTTGTACCTGAAGAGTACAATGGGGAAGGCATATCGAGTCCATCACTTTACTGGGTTTGTTCCATTTCTAGGGTTTTCGTTGATTTTTACTTCAGGGTTTAGGACCAGGCCTCTTCTGAAACAGCCTGAGGGTGGGAGGTTGTTGCTGGGTTTGGACTTAGAGATGATTGCAGAGAAACCCAGTTGGGTTAGGCATGAGGGCATGCAAATTTTCTCGATTGATGTCCAACCTGGTGGACTGAGATTTGCTACTGGAGGAGGTGACCACAAGGTTCGGATATGGAATGTGAAATCTGTTGGTAGGAGCTTAGAAGACGATGATTCAAATCAGAGGCTTCTTGCAACTCTTCGCGATCACTTTGGGTCAGTTAATTGTGTTAGATGGGCTAAGCATGGCCGTTATGTGGCATCTGGATCTGATGATCAAACAATTCTTGTTCATGAAAAGAAACCTGGTTCAGGGACCACTGAATTTGGAAGTGGGGAGCCCCCAGACGTCGAGAATTGGAAGGTTGCTATGACTTTGAGGGGGCACACAGCTGATGTGGTGGATCTTAACTGGTCTCCAGATGACTCGACATTAGCAAGTGGGAGTTTAGATAACACAGTTCACATATGGAATATGAGCAATGGTATTTGTACAGCTGTTTTGAGGGGCCACTCTAGCCTTGTCAAAGGAGTTGCCTGGGATCCCATAGGCTCTTTCATAGCCAGTCAATCAGATGACAAGACAGTTATTATATGGCGAACAAGTGACTGGAGCCTTGCTCACCGAACTGATGGCCACTGGACAAAATCTCTTGGTTCCACATTTTTCCGGCGTCTAGGCTGGTCACCTTGTGGACATTTCATCACCACCACTCATGGTTTTCAGAAGCCCAGGCATTCTGCACCTGTCCTGGAGAGAGGGGAGTGGTCTGCCACATTTGATTTCTTAGGACACAATGCACCTGTTATTGTTGTGAAATTCAATCATTCTATGTTTCGGAGGAATTTAACTAACGCTAATGAGATGAAGGCTGTTCCTGTTGGGTGGACAAATGGAGCTTCGAAGATTGGAGGCAAAGAATCCCCATCATATAATGTGATTGCAATTGGGAGCCAGGATCGCACTATAACTGTTTGGACGACAGCAAGTCCTCGCCCTCTTTTTGTTGCCAAACATTTCTTTACTCAAAGTGTTGTTGATTTATCTTGGAGTCCTGATGGATATTCACTCTTTGCATGTTCCTTGGATGGGTCGGTGGCAACTTTTCATTTTGAGGTTAAAGAAATTGGACAGAGGTTACCTGATGCAGAGCTTGATGAGATTAAGAGAAGTCGTTATGGTGATGTTAGAGGTCGGCAAGTGAATTTAGCTGAAACTCCTGCTCAACTGATGCTTGAAGCAGCTTCATTAAGGCAGGTCTCGAGCAAGAAAGTGGTTTCAGAAACTCAACAAAACCAGACACAGGCAAAACCTTCAATAGATGTGAGGGATGCCACCAAGGCTTTGGAGGCCCAAGTTGATGATTTAAAGAAGAGTGGGGGAGCTGGTGGGGATGGTTTAAATAAGGTTTCGTCTGCTCCTCCAAAGATATCTAGTCCTGTGAAGCAAAGAGAATATAGAAGACCCGATGGAAGAAAGAGAATTATTCCAGAAGCAGTTGGAGTGCCTGTTCAGCAGGACAATAAGTCTGGTGGGATTCAGAGTAGCAATGCAATTGATTTCCCTTCTATGTCATCTGACCAAAAAAAGGATAATAATGGTGATGCTGCCCCTGAATGTGTGAGGGAAAGTTCCGTGAGGGGAGTACAAAGCAAACATACTGACTCTAAGGAGCGTACAGGGGTCACTGCTCGAGCAACAATCAGTGATAGTTTAGTCATTGAGAAGGTTCCACTCTCTGCAGGTAAAGATGCAAATATCCTAATGGATCATTCTGGGAATTTGAAGATGTCAAGTTCATTGGCTACTTGTAGTTCTGTACTGTCAATTAGGGTGTTTGATAAGAAAGCAGGGGAATATAATGAGCCAATTTGCTTGGAAGCTCGACCAAAGGAGCATGCAGCTAATGATATTATTGGGGCTGGAAACACATCAATGTTGAAAGAAACAGTTATTTCTTGTACTAAGGGATCTAGACATCTGTGGTCTGATAGAGTCTCAGGGAAAGTCACTGTTTTGGCTGGAAATGCAAATTTCTGGGCAGTAGGGTGTGAAGATGGATGCCTACAGGTTTATACCAAGTGTGGTAGACGTTCTATGCCAACTATGATGATGGGCTCTGCTGCTACATTTATTGATTGTGATGATTGCTGGAAATTGTTGCTGGTGACAAGGAAAGGTTCCTTGTATGTATGGGATCTGTTTAACCGCAGTTGTCTCCTTCATGACTCGCTGGCATCACTAATTCCTTTGAACCCTAACTCATCCACGAAAGATTCTGGCACAATTAAAGTTATATCTGCCAAGCTGTCAAAATCTGGTTCTCCTCTAGTTGTTTTGGCCACTCGCCATGCTTTTCTCTTTGATATGAGCCTTATGTGTTGGCTGAGAGTGGCAGACGACTGTTTTCCTGCATCAAACTTTTCCAGCTCTTGGAACTTGGGGTCTATTCAGAGCGGAGAGCTTGCTGCACTGCAGGTTGATATCAGGAAATATTTGGCCAGAAAGCCGGGTTGGAGCAGGGTCACCGATGATGGGATGCAGACACGTGCTCACCTAGAGACTCAGATGGCATCCTCACTAGCATTGAAATCACCTAACGAGTATCGCCAATGGCTTCTATCATACATACGCTTCTTGGCAAGAGAAGCAGATGAATCTCGGCTACGTGAGGTTTGTGAGAGTTTACTAGGACCGCCAACTGGGATGGCTGGAGATGCATTGGCGGATTCAAAGAATCAAGCCTGGGATCCTTGTGTGCTCGGAATGAGAAAGCACAAACTTCTAAGAGAAGATATACTTCCTGCCATGGCATCAAATAGAAAAGTCCAGCGACTGCTTAACGAATTCATGGATCTCCTCTCCGAGTATGAAAATGCAGAAAATAATGTTGAGCCAAAAGCTCCCCTCCCTGCAGCATCAAGCCTTCTGGAACCAGATCCTGAACAGTCTATTCCACAGCAAGCAGATAAAATGGAAACTGACCCTACAGTTACTCATCTAAAGGATTCCTCCAAGTTGGTTATGAATCAAACAAGTTTTGCCCCACCTGTAGATCAAGTTGATCCGGGCCAGCCAGTGAATGATCTAGTTAACCTAGCTTCAGAAGTGAAAAACTGA 3996 44.49 LSLALLAGSPLFGLPLYIYPQFSRRKTLASRLLPRKDEAPKMSKLQSDALREAISSIFADSSEKKRNFTETIELQIGLKNYDPQKDKRFSGSVKLPHIPRPKMKICMLGDASHVEEAEKIGLDYMDVEGLKKLNKNKKLVKKLAKKYHAFLASEAIIKQIPRLLGPGLNKAGKFPTLVTHQESLESKVNETKAMVKFQLKKVLCMGVAVGNVAMEEKQVFQNVQMSVNFLVSLLKKNWQNVRCLYLKSTMGKAYRVHHFTGFVPFLGFSLIFTSGFRTRPLLKQPEGGRLLLGLDLEMIAEKPSWVRHEGMQIFSIDVQPGGLRFATGGGDHKVRIWNVKSVGRSLEDDDSNQRLLATLRDHFGSVNCVRWAKHGRYVASGSDDQTILVHEKKPGSGTTEFGSGEPPDVENWKVAMTLRGHTADVVDLNWSPDDSTLASGSLDNTVHIWNMSNGICTAVLRGHSSLVKGVAWDPIGSFIASQSDDKTVIIWRTSDWSLAHRTDGHWTKSLGSTFFRRLGWSPCGHFITTTHGFQKPRHSAPVLERGEWSATFDFLGHNAPVIVVKFNHSMFRRNLTNANEMKAVPVGWTNGASKIGGKESPSYNVIAIGSQDRTITVWTTASPRPLFVAKHFFTQSVVDLSWSPDGYSLFACSLDGSVATFHFEVKEIGQRLPDAELDEIKRSRYGDVRGRQVNLAETPAQLMLEAASLRQVSSKKVVSETQQNQTQAKPSIDVRDATKALEAQVDDLKKSGGAGGDGLNKVSSAPPKISSPVKQREYRRPDGRKRIIPEAVGVPVQQDNKSGGIQSSNAIDFPSMSSDQKKDNNGDAAPECVRESSVRGVQSKHTDSKERTGVTARATISDSLVIEKVPLSAGKDANILMDHSGNLKMSSSLATCSSVLSIRVFDKKAGEYNEPICLEARPKEHAANDIIGAGNTSMLKETVISCTKGSRHLWSDRVSGKVTVLAGNANFWAVGCEDGCLQVYTKCGRRSMPTMMMGSAATFIDCDDCWKLLLVTRKGSLYVWDLFNRSCLLHDSLASLIPLNPNSSTKDSGTIKVISAKLSKSGSPLVVLATRHAFLFDMSLMCWLRVADDCFPASNFSSSWNLGSIQSGELAALQVDIRKYLARKPGWSRVTDDGMQTRAHLETQMASSLALKSPNEYRQWLLSYIRFLAREADESRLREVCESLLGPPTGMAGDALADSKNQAWDPCVLGMRKHKLLREDILPAMASNRKVQRLLNEFMDLLSEYENAENNVEPKAPLPAASSLLEPDPEQSIPQQADKMETDPTVTHLKDSSKLVMNQTSFAPPVDQVDPGQPVNDLVNLASEVKN 1331
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
2 36085991 36097650 - CcPI632755_02g023700.1 Cco02g2370 173127

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Cco02g2370 1331 MobiDBLite consensus disorder prediction 799 823 - -
Cco02g2370 1331 ProSiteProfiles Trp-Asp (WD) repeats profile. 306 341 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 MobiDBLite consensus disorder prediction 838 852 - -
Cco02g2370 1331 FunFam Protein HIRA 414 685 - -
Cco02g2370 1331 MobiDBLite consensus disorder prediction 773 787 - -
Cco02g2370 1331 ProSiteProfiles Trp-Asp (WD) repeats profile. 460 501 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 FunFam Ribosomal protein 178 255 - -
Cco02g2370 1331 SMART WD40_4 547 619 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 SMART WD40_4 947 985 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 SMART WD40_4 411 450 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 SMART WD40_4 622 662 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 SMART WD40_4 352 391 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 SMART WD40_4 453 492 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 SMART WD40_4 298 338 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 Pfam Ribosomal protein L1p/L10e family 63 251 IPR028364 -
Cco02g2370 1331 MobiDBLite consensus disorder prediction 748 853 - -
Cco02g2370 1331 FunFam Protein HIRA 301 405 - -
Cco02g2370 1331 SUPERFAMILY WD40 repeat-like 312 659 IPR036322 GO:0005515(InterPro)
Cco02g2370 1331 Gene3D - 296 404 IPR015943 GO:0005515(InterPro)
Cco02g2370 1331 MobiDBLite consensus disorder prediction 1254 1290 - -
Cco02g2370 1331 PANTHER MEMBER OF THE HIR1 FAMILY OF WD-REPEAT PROTEINS 298 1250 IPR031120 GO:0000417(PANTHER)|GO:0000790(PANTHER)|GO:0005634(InterPro)|GO:0006325(InterPro)|GO:0006336(PANTHER)|GO:0006338(PANTHER)|GO:0006351(InterPro)|GO:0031491(PANTHER)
Cco02g2370 1331 FunFam Ribosomal protein 106 195 - -
Cco02g2370 1331 ProSitePatterns Trp-Asp (WD) repeats signature. 437 451 IPR019775 -
Cco02g2370 1331 Gene3D - 61 252 - -
Cco02g2370 1331 FunFam Ribosomal protein L10a 42 160 - -
Cco02g2370 1331 ProSiteProfiles Trp-Asp (WD) repeats circular profile. 418 454 - -
Cco02g2370 1331 Pfam WD domain, G-beta repeat 354 389 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 Pfam WD domain, G-beta repeat 308 338 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 Pfam WD domain, G-beta repeat 413 450 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 Pfam WD domain, G-beta repeat 631 658 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 Pfam WD domain, G-beta repeat 455 491 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 CDD Ribosomal_L1 50 256 IPR028364 -
Cco02g2370 1331 ProSiteProfiles Trp-Asp (WD) repeats profile. 359 389 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 Gene3D - 106 195 IPR016095 -
Cco02g2370 1331 Pfam TUP1-like enhancer of split 988 1188 IPR011494 GO:0006338(InterPro)|GO:0006355(InterPro)
Cco02g2370 1331 ProSitePatterns Ribosomal protein L1 signature. 157 176 IPR023673 -
Cco02g2370 1331 ProSiteProfiles Trp-Asp (WD) repeats circular profile. 460 491 - -
Cco02g2370 1331 SUPERFAMILY Ribosomal protein L1 63 256 IPR023674 -
Cco02g2370 1331 Coils Coil 1232 1255 - -
Cco02g2370 1331 Gene3D - 414 679 IPR015943 GO:0005515(InterPro)
Cco02g2370 1331 CDD WD40 308 658 - -
Cco02g2370 1331 ProSiteProfiles Trp-Asp (WD) repeats profile. 418 459 IPR001680 GO:0005515(InterPro)
Cco02g2370 1331 SUPERFAMILY WD40 repeat-like 893 1038 IPR036322 GO:0005515(InterPro)
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cco02g2370 K11293 - - csv:101217458 1962.19
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cco01g1345 Cco-Chr1:22185813 Cco02g2370 Cco-Chr2:36085991 3.90E-112 dispersed
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cco10g1097 . 1 209 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 84.2 3.3e-90 328.2
Cco09g0549 . 1 186 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 91.4 1.6e-89 325.9
Cco06g1618 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 69.9 1.3e-59 226.5
Cco10g1097 . 1 209 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 86.6 4.2e-90 327.8
Cco09g0549 . 1 199 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 87.4 1.0e-88 323.2
Cco06g1618 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 72.9 1.2e-60 229.9
Cco10g1097 . 1 197 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 90.4 1.5e-90 329.3
Cco09g0549 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 89.7 2.6e-90 328.6
Cco06g1618 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 72.9 2.1e-60 229.2
Cco08g0350 . 1 296 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 74.8 2.3e-118 422.2
Cco07g1519 . 9 307 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 71.0 9.1e-115 410.2
Cco07g0975 . 79 193 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 89.6 3.7e-55 212.2
Cco08g0350 . 9 277 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 76.4 5.6e-114 407.5
Cco07g1519 . 4 251 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 81.1 9.6e-114 406.8
Cco07g0975 . 79 193 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 87.8 5.0e-54 208.4
Cco10g1646 . 34 266 Cytoplasmic Ribosomal Protein Gene Family AT1G58380 85.1 6.8e-115 410.6
Cco04g0456 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G58380 88.0 8.8e-115 410.2
Cco10g1646 . 34 266 Cytoplasmic Ribosomal Protein Gene Family AT1G59359 85.1 6.8e-115 410.6
Cco04g0456 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G59359 88.0 8.8e-115 410.2
Cco10g1646 . 1 267 Cytoplasmic Ribosomal Protein Gene Family AT2G41840 82.3 5.2e-115 411.0
Cco04g0456 . 36 259 Cytoplasmic Ribosomal Protein Gene Family AT2G41840 88.4 1.5e-114 409.5
Cco04g0456 . 37 260 Cytoplasmic Ribosomal Protein Gene Family AT3G57490 89.8 1.6e-116 416.0
Cco10g1646 . 34 257 Cytoplasmic Ribosomal Protein Gene Family AT3G57490 89.8 1.6e-116 416.0
Cco10g1646 . 34 266 Cytoplasmic Ribosomal Protein Gene Family AT1G58684 85.1 6.8e-115 410.6
Cco04g0456 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G58684 88.0 8.8e-115 410.2
Cco10g1646 . 34 266 Cytoplasmic Ribosomal Protein Gene Family AT1G58983 85.1 6.8e-115 410.6
Cco04g0456 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G58983 88.0 8.8e-115 410.2
Cco09g0089 . 1 232 Cytoplasmic Ribosomal Protein Gene Family AT2G31610 87.1 3.1e-111 398.3
Cco11g0174 . 615 830 Cytoplasmic Ribosomal Protein Gene Family AT2G31610 91.7 1.5e-110 396.0
Cco09g0089 . 1 225 Cytoplasmic Ribosomal Protein Gene Family AT3G53870 90.2 1.0e-111 399.8
Cco11g0174 . 615 833 Cytoplasmic Ribosomal Protein Gene Family AT3G53870 92.2 1.0e-111 399.8
Cco09g0089 . 1 226 Cytoplasmic Ribosomal Protein Gene Family AT5G35530 89.8 2.5e-113 405.2
Cco11g0174 . 615 850 Cytoplasmic Ribosomal Protein Gene Family AT5G35530 87.3 2.7e-112 401.7
Cco05g0577 . 1 261 Cytoplasmic Ribosomal Protein Gene Family AT3G04840 86.3 3.8e-128 454.5
Cco06g0647 . 150 409 Cytoplasmic Ribosomal Protein Gene Family AT3G04840 85.1 1.5e-124 442.6
Cco05g0577 . 1 261 Cytoplasmic Ribosomal Protein Gene Family AT4G34670 86.6 4.9e-128 454.1
Cco06g0647 . 150 409 Cytoplasmic Ribosomal Protein Gene Family AT4G34670 85.5 1.9e-124 442.2
Cco09g1051 . 1 181 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 91.2 2.0e-96 348.6
Cco07g0475 . 48 228 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 91.7 2.7e-96 348.2
Cco09g1052 . 1 181 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 90.6 4.6e-96 347.4
Cco07g0482 . 57 203 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 93.2 8.6e-79 290.0
Cco09g1051 . 19 261 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 92.6 2.4e-132 468.4
Cco07g0475 . 66 308 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 93.0 3.1e-132 468.0
Cco09g1052 . 19 261 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 92.2 5.2e-132 467.2
Cco07g0482 . 75 284 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 81.5 7.4e-110 393.7
Cco09g1051 . 1 261 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 93.1 1.4e-143 505.8
Cco07g0475 . 48 308 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 93.5 1.9e-143 505.4
Cco09g1052 . 1 261 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 92.7 3.2e-143 504.6
Cco07g0482 . 57 284 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 82.8 7.6e-121 430.3
Cco11g0128 . 116 321 Cytoplasmic Ribosomal Protein Gene Family AT2G37270 88.4 5.0e-99 357.5
Cco09g1647 . 7 212 Cytoplasmic Ribosomal Protein Gene Family AT2G37270 87.9 6.5e-99 357.1
Cco09g1648 . 2 207 Cytoplasmic Ribosomal Protein Gene Family AT2G37270 87.9 6.5e-99 357.1
Cco11g0128 . 116 321 Cytoplasmic Ribosomal Protein Gene Family AT3G11940 88.4 4.2e-98 354.4
Cco09g1647 . 7 212 Cytoplasmic Ribosomal Protein Gene Family AT3G11940 87.9 5.5e-98 354.0
Cco09g1648 . 2 207 Cytoplasmic Ribosomal Protein Gene Family AT3G11940 87.9 5.5e-98 354.0
Cco05g0058 . 63 249 Cytoplasmic Ribosomal Protein Gene Family AT4G31700 88.8 3.7e-85 311.2
Cco08g1275 . 307 493 Cytoplasmic Ribosomal Protein Gene Family AT4G31700 88.8 1.4e-84 309.3
Cco05g0058 . 1 249 Cytoplasmic Ribosomal Protein Gene Family AT5G10360 71.9 3.4e-89 324.7
Cco08g1275 . 245 493 Cytoplasmic Ribosomal Protein Gene Family AT5G10360 71.1 3.7e-88 321.2
Cco04g1622 . 93 251 Cytoplasmic Ribosomal Protein Gene Family AT5G10360 57.5 1.0e-37 153.7
Cco06g1669 . 1 191 Cytoplasmic Ribosomal Protein Gene Family AT1G48830 81.2 6.4e-85 310.5
Cco01g1700 . 1 191 Cytoplasmic Ribosomal Protein Gene Family AT1G48830 78.5 7.8e-83 303.5
Cco06g1669 . 1 191 Cytoplasmic Ribosomal Protein Gene Family AT3G02560 79.1 1.6e-83 305.8
Cco01g1700 . 1 191 Cytoplasmic Ribosomal Protein Gene Family AT3G02560 78.5 1.9e-81 298.9
Cco06g1669 . 1 188 Cytoplasmic Ribosomal Protein Gene Family AT5G16130 78.7 1.9e-81 298.9
Cco01g1700 . 1 188 Cytoplasmic Ribosomal Protein Gene Family AT5G16130 79.8 1.6e-80 295.8
Cco07g1646 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 77.8 1.2e-95 346.3
Cco11g1246 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 82.4 1.6e-95 345.9
Cco08g0721 . 1 217 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 85.1 7.9e-95 343.6
Cco07g1646 . 1 219 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 84.5 1.0e-99 359.8
Cco11g1246 . 1 219 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 83.1 1.5e-98 355.9
Cco08g0721 . 1 220 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 82.7 3.6e-97 351.3
Cco08g0163 . 1 137 Cytoplasmic Ribosomal Protein Gene Family AT5G15200 91.2 8.4e-67 250.0
Cco05g2709 . 267 393 Cytoplasmic Ribosomal Protein Gene Family AT5G15200 92.9 1.4e-61 232.6
Cco08g0163 . 1 197 Cytoplasmic Ribosomal Protein Gene Family AT5G39850 90.9 4.3e-100 360.9
Cco05g2709 . 267 453 Cytoplasmic Ribosomal Protein Gene Family AT5G39850 92.0 2.4e-95 345.1
Cco01g0246 . 1 176 Cytoplasmic Ribosomal Protein Gene Family AT4G25740 63.6 9.2e-55 209.9
Cco07g0850 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT4G25740 65.9 3.5e-54 208.0
Cco01g0246 . 46 158 Cytoplasmic Ribosomal Protein Gene Family AT5G41520 73.5 1.3e-39 159.5
Cco01g0246 . 1 128 Cytoplasmic Ribosomal Protein Gene Family AT5G52650 83.7 4.8e-58 221.1
Cco07g0850 . 1 127 Cytoplasmic Ribosomal Protein Gene Family AT5G52650 75.8 4.5e-48 188.0
Cco08g1520 . 71 229 Cytoplasmic Ribosomal Protein Gene Family AT3G48930 90.0 1.2e-81 299.3
Cco02g0354 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT3G48930 90.0 1.6e-81 298.9
Cco02g0354 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT4G30800 89.9 1.0e-80 296.2
Cco08g1520 . 71 229 Cytoplasmic Ribosomal Protein Gene Family AT4G30800 89.9 1.4e-80 295.8
Cco08g1520 . 71 229 Cytoplasmic Ribosomal Protein Gene Family AT5G23740 90.6 1.2e-81 299.3
Cco02g0354 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT5G23740 89.9 2.1e-81 298.5
Cco11g0389 . 1 137 Cytoplasmic Ribosomal Protein Gene Family AT1G15930 72.9 2.7e-51 198.4
Cco09g0314 . 42 178 Cytoplasmic Ribosomal Protein Gene Family AT1G15930 70.9 6.6e-50 193.7
Cco11g0389 . 1 137 Cytoplasmic Ribosomal Protein Gene Family AT2G32060 71.4 2.7e-51 198.4
Cco09g0314 . 53 178 Cytoplasmic Ribosomal Protein Gene Family AT2G32060 75.4 3.5e-51 198.0
Cco06g0046 . 1 151 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 94.0 2.5e-76 281.6
Cco10g0311 . 1 151 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 92.7 4.3e-76 280.8
Cco01g0376 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 90.9 1.2e-70 262.7
Cco06g0046 . 1 151 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 94.7 1.1e-76 282.7
Cco10g0311 . 1 151 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 92.7 4.3e-76 280.8
Cco01g0376 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 91.6 5.5e-71 263.8
Cco03g0742 . 550 698 Cytoplasmic Ribosomal Protein Gene Family AT2G36160 92.6 8.1e-75 276.6
Cco10g1868 . 299 447 Cytoplasmic Ribosomal Protein Gene Family AT2G36160 91.9 1.8e-74 275.4
Cco03g0742 . 550 698 Cytoplasmic Ribosomal Protein Gene Family AT3G11510 94.0 1.2e-75 279.3
Cco10g1868 . 299 447 Cytoplasmic Ribosomal Protein Gene Family AT3G11510 93.3 2.8e-75 278.1
Cco10g1868 . 299 447 Cytoplasmic Ribosomal Protein Gene Family AT3G52580 92.6 6.2e-75 276.9
Cco03g0742 . 550 698 Cytoplasmic Ribosomal Protein Gene Family AT3G52580 91.9 1.4e-74 275.8
Cco05g0541 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT1G04270 90.8 3.4e-73 271.2
Cco06g0691 . 59 211 Cytoplasmic Ribosomal Protein Gene Family AT1G04270 89.5 6.4e-72 266.9
Cco05g0541 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT5G09490 82.4 2.8e-67 251.5
Cco06g0691 . 59 211 Cytoplasmic Ribosomal Protein Gene Family AT5G09490 81.7 3.1e-66 248.1
Cco05g0541 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT5G09500 88.2 1.3e-69 259.2
Cco06g0691 . 59 211 Cytoplasmic Ribosomal Protein Gene Family AT5G09500 85.6 3.6e-67 251.1
Cco05g0541 . 36 153 Cytoplasmic Ribosomal Protein Gene Family AT5G09510 94.1 3.7e-59 224.2
Cco06g0691 . 94 211 Cytoplasmic Ribosomal Protein Gene Family AT5G09510 94.1 3.7e-59 224.2
Cco05g0541 . 6 153 Cytoplasmic Ribosomal Protein Gene Family AT5G43640 87.2 1.2e-67 252.7
Cco06g0691 . 62 211 Cytoplasmic Ribosomal Protein Gene Family AT5G43640 85.3 5.2e-66 247.3
Cco05g0541 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT5G63070 62.5 7.6e-47 183.7
Cco06g0691 . 74 211 Cytoplasmic Ribosomal Protein Gene Family AT5G63070 65.3 4.2e-45 177.9
Cco03g0202 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT1G07770 96.9 4.0e-70 260.8
Cco09g2204 . 38 159 Cytoplasmic Ribosomal Protein Gene Family AT1G07770 96.7 6.6e-65 243.4
Cco08g0580 . 98 226 Cytoplasmic Ribosomal Protein Gene Family AT2G19720 79.8 1.2e-58 222.6
Cco03g0202 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT2G39590 90.0 3.3e-64 241.1
Cco09g2204 . 38 159 Cytoplasmic Ribosomal Protein Gene Family AT2G39590 89.3 5.4e-59 223.8
Cco03g0202 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT3G46040 96.9 4.0e-70 260.8
Cco09g2204 . 38 159 Cytoplasmic Ribosomal Protein Gene Family AT3G46040 96.7 6.6e-65 243.4
Cco08g0580 . 98 226 Cytoplasmic Ribosomal Protein Gene Family AT4G29430 82.2 1.4e-59 225.7
Cco03g0202 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT5G59850 96.9 4.0e-70 260.8
Cco09g2204 . 38 159 Cytoplasmic Ribosomal Protein Gene Family AT5G59850 96.7 6.6e-65 243.4
Cco02g0657 . 4 145 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 88.0 2.6e-70 261.5
Cco05g1150 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 89.2 9.9e-70 259.6
Cco05g1179 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 89.2 9.9e-70 259.6
Cco02g0657 . 4 145 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 83.8 5.1e-66 247.3
Cco05g1150 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 84.9 1.1e-65 246.1
Cco05g1179 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 84.9 1.1e-65 246.1
Cco02g0657 . 4 114 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 84.7 4.0e-52 201.1
Cco05g1150 . 6 113 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 86.1 1.5e-51 199.1
Cco05g1179 . 6 113 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 86.1 1.5e-51 199.1
Cco10g1849 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT2G04390 81.6 2.3e-55 211.8
Cco08g0977 . 1 118 Cytoplasmic Ribosomal Protein Gene Family AT2G04390 84.9 3.0e-47 184.9
Cco10g1849 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT2G05220 81.4 3.9e-55 211.1
Cco08g0977 . 1 118 Cytoplasmic Ribosomal Protein Gene Family AT2G05220 85.7 5.1e-47 184.1
Cco10g1849 . 1 121 Cytoplasmic Ribosomal Protein Gene Family AT3G10610 88.4 1.6e-53 205.7
Cco08g0977 . 1 117 Cytoplasmic Ribosomal Protein Gene Family AT3G10610 82.9 7.9e-48 186.8
Cco10g1849 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT5G04800 81.6 3.5e-56 214.5
Cco08g0977 . 1 118 Cytoplasmic Ribosomal Protein Gene Family AT5G04800 86.6 1.2e-48 189.5
Cco08g0874 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G22780 96.1 4.5e-81 297.4
Cco09g1016 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G22780 96.1 4.5e-81 297.4
Cco08g0874 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G34030 96.1 4.5e-81 297.4
Cco09g1016 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G34030 96.1 4.5e-81 297.4
Cco08g0874 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT4G09800 96.1 4.5e-81 297.4
Cco09g1016 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT4G09800 96.1 4.5e-81 297.4
Cco11g0482 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT3G02080 84.6 2.2e-69 258.5
Cco09g0667 . 550 692 Cytoplasmic Ribosomal Protein Gene Family AT3G02080 83.2 1.4e-68 255.8
Cco11g0482 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT5G15520 86.3 7.0e-68 253.4
Cco09g0667 . 550 688 Cytoplasmic Ribosomal Protein Gene Family AT5G15520 84.9 4.5e-67 250.8
Cco11g0482 . 1 142 Cytoplasmic Ribosomal Protein Gene Family AT5G61170 85.9 4.8e-69 257.3
Cco09g0667 . 550 691 Cytoplasmic Ribosomal Protein Gene Family AT5G61170 84.5 3.1e-68 254.6
Cco05g0895 . 30 151 Cytoplasmic Ribosomal Protein Gene Family AT3G45030 89.3 3.5e-55 211.1
Cco01g0544 . 1 116 Cytoplasmic Ribosomal Protein Gene Family AT3G45030 92.2 5.0e-54 207.2
Cco05g0895 . 31 151 Cytoplasmic Ribosomal Protein Gene Family AT3G47370 91.7 4.0e-56 214.2
Cco01g0544 . 1 116 Cytoplasmic Ribosomal Protein Gene Family AT3G47370 93.1 1.7e-54 208.8
Cco05g0895 . 30 151 Cytoplasmic Ribosomal Protein Gene Family AT5G62300 89.3 3.5e-55 211.1
Cco01g0544 . 1 116 Cytoplasmic Ribosomal Protein Gene Family AT5G62300 92.2 5.0e-54 207.2
Cco05g0718 . 1 82 Cytoplasmic Ribosomal Protein Gene Family AT3G53890 84.1 7.4e-38 152.9
Cco05g0718 . 1 81 Cytoplasmic Ribosomal Protein Gene Family AT5G27700 88.9 3.9e-39 157.1
Cco06g0521 . 1 81 Cytoplasmic Ribosomal Protein Gene Family AT5G27700 85.2 7.4e-38 152.9
Cco09g2238 . 1 142 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.4 8.8e-71 263.1
Cco10g2046 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.3 1.3e-69 259.2
Cco02g2234 . 24 148 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 92.0 1.1e-60 229.6
Cco09g2238 . 1 142 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.5 2.5e-73 271.6
Cco10g2046 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.4 3.6e-72 267.7
Cco02g2234 . 24 148 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 94.4 3.0e-63 238.0
Cco02g1764 . 1 103 Cytoplasmic Ribosomal Protein Gene Family AT3G04920 85.6 4.5e-46 180.6
Cco06g1031 . 36 138 Cytoplasmic Ribosomal Protein Gene Family AT3G04920 84.6 3.8e-45 177.6
Cco02g1764 . 1 108 Cytoplasmic Ribosomal Protein Gene Family AT5G28060 88.0 2.5e-51 198.4
Cco06g1031 . 36 143 Cytoplasmic Ribosomal Protein Gene Family AT5G28060 87.0 2.1e-50 195.3
Cco04g0142 . 27 108 Cytoplasmic Ribosomal Protein Gene Family AT2G21580 92.7 1.6e-37 152.1
Cco04g0142 . 1 107 Cytoplasmic Ribosomal Protein Gene Family AT4G34555 91.6 3.0e-39 157.9
Cco08g0968 . 1 107 Cytoplasmic Ribosomal Protein Gene Family AT4G34555 88.8 1.1e-38 156.0
Cco07g0532 . 1 124 Cytoplasmic Ribosomal Protein Gene Family AT2G40510 83.9 4.8e-55 210.7
Cco11g0585 . 1 119 Cytoplasmic Ribosomal Protein Gene Family AT2G40510 85.7 8.2e-55 209.9
Cco07g0532 . 1 124 Cytoplasmic Ribosomal Protein Gene Family AT2G40590 83.9 2.8e-55 211.5
Cco11g0585 . 1 125 Cytoplasmic Ribosomal Protein Gene Family AT2G40590 83.2 4.8e-55 210.7
Cco11g0585 . 1 126 Cytoplasmic Ribosomal Protein Gene Family AT3G56340 84.9 2.8e-55 211.5
Cco07g0532 . 1 122 Cytoplasmic Ribosomal Protein Gene Family AT3G56340 84.4 1.4e-54 209.1
Cco06g0163 . 1 84 Cytoplasmic Ribosomal Protein Gene Family AT2G45710 94.0 1.2e-43 172.2
Cco01g0830 . 1 84 Cytoplasmic Ribosomal Protein Gene Family AT2G45710 92.9 2.7e-43 171.0
Cco06g0163 . 1 86 Cytoplasmic Ribosomal Protein Gene Family AT3G61110 97.7 1.6e-46 181.8
Cco01g0830 . 1 86 Cytoplasmic Ribosomal Protein Gene Family AT3G61110 96.5 3.5e-46 180.6
Cco01g0830 . 1 84 Cytoplasmic Ribosomal Protein Gene Family AT5G47930 94.0 7.8e-43 169.5
Cco06g0163 . 1 84 Cytoplasmic Ribosomal Protein Gene Family AT5G47930 92.9 1.7e-42 168.3
Cco05g2814 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT1G23410 83.0 9.3e-66 246.5
Cco08g1963 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G23410 82.9 2.1e-65 245.4
Cco05g2814 . 1 154 Cytoplasmic Ribosomal Protein Gene Family AT3G62250 96.1 4.3e-71 264.2
Cco08g1963 . 1 154 Cytoplasmic Ribosomal Protein Gene Family AT3G62250 95.5 5.7e-71 263.8
Cco07g0417 . 1 291 Cytoplasmic Ribosomal Protein Gene Family AT2G40010 86.3 6.8e-140 493.8
Cco03g0085 . 1 279 Cytoplasmic Ribosomal Protein Gene Family AT2G40010 80.6 5.6e-126 447.6
Cco07g0417 . 3 291 Cytoplasmic Ribosomal Protein Gene Family AT3G09200 76.1 1.9e-117 419.1
Cco03g0085 . 2 279 Cytoplasmic Ribosomal Protein Gene Family AT3G09200 70.5 2.9e-105 378.6
Cco07g0417 . 3 281 Cytoplasmic Ribosomal Protein Gene Family AT3G11250 88.2 8.4e-138 486.9
Cco03g0085 . 2 278 Cytoplasmic Ribosomal Protein Gene Family AT3G11250 80.5 1.5e-126 449.5
Cco08g0283 . 13 399 Cytoplasmic Ribosomal Protein Gene Family AT1G43170 85.8 2.3e-198 688.3
Cco11g1378 . 1 387 Cytoplasmic Ribosomal Protein Gene Family AT1G43170 82.4 2.2e-193 671.8
Cco11g1378 . 1 386 Cytoplasmic Ribosomal Protein Gene Family AT1G61580 87.3 2.5e-200 694.9
Cco08g0283 . 13 401 Cytoplasmic Ribosomal Protein Gene Family AT1G61580 86.7 7.9e-199 689.9
Cco04g1078 . 2 405 Cytoplasmic Ribosomal Protein Gene Family AT3G09630 83.9 8.0e-194 673.3
Cco10g2055 . 1 406 Cytoplasmic Ribosomal Protein Gene Family AT3G09630 82.5 4.4e-192 667.5
Cco10g2055 . 1 406 Cytoplasmic Ribosomal Protein Gene Family AT5G02870 83.0 2.1e-194 675.2
Cco04g1078 . 2 405 Cytoplasmic Ribosomal Protein Gene Family AT5G02870 83.4 3.0e-193 671.4
Cco11g1397 . 1 290 Cytoplasmic Ribosomal Protein Gene Family AT3G25520 82.1 1.3e-135 479.6
Cco08g1170 . 1 301 Cytoplasmic Ribosomal Protein Gene Family AT3G25520 76.4 1.2e-130 463.0
Cco11g1397 . 1 290 Cytoplasmic Ribosomal Protein Gene Family AT5G39740 81.0 1.5e-133 472.6
Cco08g1170 . 1 301 Cytoplasmic Ribosomal Protein Gene Family AT5G39740 76.7 1.2e-130 463.0
Cco10g1245 . 2 230 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 79.0 6.2e-98 354.0
Cco04g0054 . 2 220 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 80.4 5.8e-96 347.4
Cco09g0372 . 2 180 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 84.4 9.0e-81 297.0
Cco10g1245 . 4 230 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 80.6 3.3e-99 358.2
Cco04g0054 . 4 220 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 81.6 1.2e-96 349.7
Cco09g0372 . 7 180 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 85.1 6.4e-79 290.8
Cco10g1245 . 4 230 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 80.6 7.3e-99 357.1
Cco04g0054 . 4 220 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 81.6 2.6e-96 348.6
Cco09g0372 . 6 180 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 85.7 3.4e-80 295.0
Cco09g1341 . 3 251 Cytoplasmic Ribosomal Protein Gene Family AT1G80750 58.2 3.5e-75 278.5
Cco06g1567 . 10 180 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 85.4 5.8e-75 277.3
Cco07g1536 . 4 178 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 81.7 2.4e-73 271.9
Cco09g0157 . 41 212 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 81.4 1.9e-70 262.3
Cco06g1567 . 10 245 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 87.3 1.3e-114 409.5
Cco09g0157 . 36 277 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 84.0 4.2e-113 404.4
Cco07g1536 . 4 243 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 82.9 9.4e-113 403.3
Cco06g1567 . 10 245 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 89.4 1.9e-118 422.2
Cco07g1536 . 4 243 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 85.0 2.6e-115 411.8
Cco09g0157 . 43 277 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 87.7 2.6e-115 411.8
Cco01g0552 . 1 257 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 83.7 3.7e-120 427.9
Cco01g0553 . 1 257 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 83.7 4.8e-120 427.6
Cco05g1619 . 1 257 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 83.3 2.4e-119 425.2
Cco01g0552 . 1 257 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 84.8 1.1e-121 433.0
Cco01g0553 . 1 257 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 84.8 1.1e-121 433.0
Cco05g1619 . 1 257 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 83.7 4.8e-120 427.6
Cco04g1784 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT2G18020 93.4 7.7e-142 500.0
Cco05g1707 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT2G18020 91.9 9.4e-140 493.0
Cco04g1784 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT3G51190 84.9 8.3e-128 453.4
Cco05g1707 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT3G51190 83.0 3.9e-125 444.5
Cco04g1784 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT4G36130 93.8 2.8e-144 508.1
Cco05g1707 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT4G36130 91.9 1.3e-141 499.2
Cco01g0089 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33120 84.5 1.4e-90 329.3
Cco01g0090 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33120 85.1 3.0e-90 328.2
Cco01g0089 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33140 84.5 1.4e-90 329.3
Cco01g0090 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33140 85.1 3.0e-90 328.2
Cco01g0090 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G10450 83.7 1.1e-75 279.6
Cco01g0089 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G10450 83.7 3.2e-75 278.1
Cco02g0031 . 38 217 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 58.3 1.2e-52 202.6
Cco11g0565 . 38 217 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 57.8 1.1e-51 199.5
Cco07g1118 . 88 266 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 57.5 1.2e-50 196.1
Cco02g0031 . 38 216 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 87.7 1.2e-91 332.8
Cco11g0565 . 38 216 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 87.2 9.9e-91 329.7
Cco07g1118 . 88 271 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 85.3 1.7e-90 328.9
Cco07g1118 . 51 270 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 86.8 1.2e-111 399.4
Cco02g0031 . 1 220 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 86.4 1.6e-111 399.1
Cco11g0565 . 1 220 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 86.4 4.6e-111 397.5
Cco02g2370 . 42 256 Cytoplasmic Ribosomal Protein Gene Family AT1G08360 87.9 4.1e-104 374.4
Cco01g1345 . 1 210 Cytoplasmic Ribosomal Protein Gene Family AT1G08360 88.1 8.5e-102 366.7
Cco02g2370 . 42 256 Cytoplasmic Ribosomal Protein Gene Family AT2G27530 87.0 2.9e-102 368.2
Cco01g1345 . 1 210 Cytoplasmic Ribosomal Protein Gene Family AT2G27530 87.1 6.1e-100 360.5
Cco02g2370 . 42 256 Cytoplasmic Ribosomal Protein Gene Family AT5G22440 88.4 9.2e-104 373.2
Cco01g1345 . 1 210 Cytoplasmic Ribosomal Protein Gene Family AT5G22440 88.6 2.9e-102 368.2
Cco03g0692 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 96.7 3.7e-98 354.4
Cco07g0261 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 95.6 2.4e-97 351.7
Cco04g2165 . 267 447 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 95.0 2.6e-96 348.2
Cco03g0692 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 96.7 3.7e-98 354.4
Cco07g0261 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 95.6 2.4e-97 351.7
Cco04g2165 . 267 447 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 95.0 2.6e-96 348.2
Cco03g0692 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 96.7 3.7e-98 354.4
Cco07g0261 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 95.6 2.4e-97 351.7
Cco04g2165 . 267 447 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 95.0 2.6e-96 348.2
Cco03g0692 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 96.7 3.7e-98 354.4
Cco07g0261 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 95.6 2.4e-97 351.7
Cco04g2165 . 267 447 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 95.0 2.6e-96 348.2
Cco04g1102 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT2G37190 90.4 2.6e-82 301.6
Cco02g2264 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT2G37190 89.8 9.9e-82 299.7
Cco10g2015 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT2G37190 88.6 6.4e-81 297.0
Cco04g1102 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G53430 89.8 2.6e-82 301.6
Cco02g2264 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G53430 89.2 9.9e-82 299.7
Cco10g2015 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G53430 88.0 6.4e-81 297.0
Cco02g2264 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT5G60670 91.0 8.9e-83 303.1
Cco04g1102 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT5G60670 89.8 4.4e-82 300.8
Cco10g2015 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT5G60670 88.0 1.1e-80 296.2
Cco01g0511 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G49010 82.0 3.1e-93 338.2
Cco07g1794 . 22 203 Cytoplasmic Ribosomal Protein Gene Family AT3G49010 78.0 3.8e-75 278.1
Cco01g0511 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G48960 72.8 9.4e-82 300.1
Cco07g1794 . 20 203 Cytoplasmic Ribosomal Protein Gene Family AT3G48960 68.5 1.1e-66 250.0
Cco01g0511 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT5G23900 81.1 9.0e-93 336.7
Cco07g1794 . 22 203 Cytoplasmic Ribosomal Protein Gene Family AT5G23900 75.8 9.4e-74 273.5
Cco06g0808 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G07110 88.4 1.1e-103 372.9
Cco05g0385 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G07110 86.5 4.8e-102 367.5
Cco06g0808 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G24830 90.8 4.6e-105 377.5
Cco05g0385 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G24830 89.3 5.1e-104 374.0
Cco06g0808 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT4G13170 88.3 1.3e-104 375.9
Cco05g0385 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT4G13170 86.4 1.3e-102 369.4
Cco06g0808 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT5G48760 89.8 1.4e-106 382.5
Cco05g0385 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT5G48760 88.3 1.3e-104 375.9
Cco05g0484 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT2G20450 83.8 1.1e-54 209.5
Cco05g0483 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT2G20450 83.8 1.8e-54 208.8
Cco06g0743 . 24 151 Cytoplasmic Ribosomal Protein Gene Family AT2G20450 82.8 5.4e-54 207.2
Cco05g0484 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT4G27090 84.6 2.9e-55 211.5
Cco06g0743 . 24 151 Cytoplasmic Ribosomal Protein Gene Family AT4G27090 83.6 1.4e-54 209.1
Cco05g0483 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT4G27090 83.1 3.2e-54 208.0
Cco07g1759 . 47 250 Cytoplasmic Ribosomal Protein Gene Family AT4G16720 91.2 1.4e-106 382.5
Cco01g0440 . 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G16720 91.2 5.4e-106 380.6
Cco01g0441 . 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G16720 91.2 5.4e-106 380.6
Cco07g1759 . 47 250 Cytoplasmic Ribosomal Protein Gene Family AT4G17390 91.7 1.7e-107 385.6
Cco01g0440 . 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G17390 91.7 6.4e-107 383.6
Cco01g0441 . 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G17390 91.7 6.4e-107 383.6
Cco11g1425 . 1 183 Cytoplasmic Ribosomal Protein Gene Family AT1G27400 86.9 7.0e-86 313.5
Cco08g1163 . 909 1082 Cytoplasmic Ribosomal Protein Gene Family AT1G27400 89.7 1.2e-85 312.8
Cco11g1425 . 1 176 Cytoplasmic Ribosomal Protein Gene Family AT1G67430 67.6 2.1e-55 211.8
Cco08g1163 . 909 1084 Cytoplasmic Ribosomal Protein Gene Family AT1G67430 67.0 1.8e-54 208.8
Cco02g1651 . 3 187 Cytoplasmic Ribosomal Protein Gene Family AT2G47570 80.6 3.0e-79 291.6
Cco03g1795 . 988 1171 Cytoplasmic Ribosomal Protein Gene Family AT2G47570 77.3 2.4e-76 282.0
Cco07g1057 . 3 115 Cytoplasmic Ribosomal Protein Gene Family AT2G47570 68.1 4.9e-37 151.4
Cco02g1651 . 54 187 Cytoplasmic Ribosomal Protein Gene Family AT3G05590 86.6 3.4e-64 241.1
Cco03g1795 . 1039 1171 Cytoplasmic Ribosomal Protein Gene Family AT3G05590 87.2 6.3e-63 236.9
Cco02g1651 . 54 187 Cytoplasmic Ribosomal Protein Gene Family AT5G27850 85.8 2.8e-63 238.0
Cco03g1795 . 1039 1171 Cytoplasmic Ribosomal Protein Gene Family AT5G27850 85.0 3.5e-61 231.1
Cco11g1697 . 1 178 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 91.0 1.0e-91 333.2
Cco03g0745 . 1 178 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 90.4 2.3e-91 332.0
Cco04g2233 . 11 209 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 81.9 8.9e-91 330.1
Cco11g1697 . 4 178 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 91.4 3.3e-91 331.3
Cco03g0745 . 4 178 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 90.9 4.3e-91 330.9
Cco04g2233 . 35 209 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 90.3 1.1e-89 326.2
Cco10g1097 . 1 197 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 90.4 1.5e-90 329.3
Cco09g0549 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 89.7 2.6e-90 328.6
Cco06g1618 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 72.9 2.1e-60 229.2
Cco10g1097 . 1 209 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 84.2 3.3e-90 328.2
Cco09g0549 . 1 186 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 91.4 1.6e-89 325.9
Cco06g1618 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 69.9 1.3e-59 226.5
Cco10g1097 . 1 209 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 86.6 4.2e-90 327.8
Cco09g0549 . 1 199 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 87.4 1.0e-88 323.2
Cco06g1618 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 72.9 1.2e-60 229.9
Cco10g1757 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G09590 84.8 7.5e-82 300.1
Cco10g1757 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G09690 84.8 7.5e-82 300.1
Cco10g1757 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G57660 83.5 2.2e-81 298.5
Cco10g1757 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G57860 83.5 2.2e-81 298.5
Cco09g0558 . 1 117 Cytoplasmic Ribosomal Protein Gene Family AT1G02830 73.5 1.5e-42 169.1
Cco03g1781 . 1 115 Cytoplasmic Ribosomal Protein Gene Family AT1G02830 71.8 4.2e-40 161.0
Cco03g1781 . 1 124 Cytoplasmic Ribosomal Protein Gene Family AT3G05560 88.7 1.7e-57 218.8
Cco09g0558 . 1 126 Cytoplasmic Ribosomal Protein Gene Family AT3G05560 84.1 1.7e-54 208.8
Cco03g1781 . 1 124 Cytoplasmic Ribosomal Protein Gene Family AT5G27770 87.9 2.4e-56 214.9
Cco09g0558 . 1 126 Cytoplasmic Ribosomal Protein Gene Family AT5G27770 82.5 5.5e-53 203.8
Cco06g0145 . 769 908 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.6 1.8e-76 282.0
Cco06g0763 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.6 1.8e-76 282.0
Cco07g0131 . 1 163 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 84.0 6.0e-72 266.9
Cco06g0145 . 784 908 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 9.4e-69 256.1
Cco06g0763 . 16 140 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 9.4e-69 256.1
Cco07g0131 . 16 163 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 83.8 3.1e-64 241.1
Cco06g0145 . 784 908 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 9.4e-69 256.1
Cco06g0763 . 16 140 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 9.4e-69 256.1
Cco07g0131 . 16 163 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 83.8 3.1e-64 241.1
Cco09g2218 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 79.9 4.4e-60 227.6
Cco11g0106 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 79.2 2.2e-59 225.3
Cco07g0309 . 47 199 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 77.9 1.9e-58 222.2
Cco09g2218 . 4 153 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 86.7 8.3e-64 240.0
Cco11g0106 . 4 153 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 86.0 4.1e-63 237.7
Cco07g0309 . 50 199 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 84.7 3.5e-62 234.6
Cco10g1942 . 493 652 Cytoplasmic Ribosomal Protein Gene Family AT2G36620 82.5 1.2e-66 249.6
Cco04g1176 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT2G36620 79.9 2.8e-65 245.0
Cco10g1942 . 493 652 Cytoplasmic Ribosomal Protein Gene Family AT3G53020 83.9 9.7e-66 246.5
Cco04g1176 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT3G53020 81.2 1.8e-64 242.3
Cco05g2153 . 77 244 Cytoplasmic Ribosomal Protein Gene Family AT2G44860 69.6 2.7e-60 228.4
Cco10g1920 . 94 242 Cytoplasmic Ribosomal Protein Gene Family AT2G44860 63.8 6.0e-44 174.1
Cco04g1516 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT3G49910 89.0 3.2e-68 254.6
Cco02g1361 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT3G49910 84.9 1.3e-66 249.2
Cco02g1361 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT5G67510 83.6 5.6e-65 243.8
Cco04g1516 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT5G67510 84.2 1.3e-64 242.7
Cco07g1163 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT2G32220 77.0 1.2e-56 216.1
Cco07g1162 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT2G32220 76.3 1.5e-56 215.7
Cco11g1727 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT2G32220 74.1 2.7e-53 204.9
Cco07g1163 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT3G22230 83.7 1.3e-60 229.2
Cco07g1162 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT3G22230 84.4 1.7e-60 228.8
Cco11g1727 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT3G22230 79.3 6.8e-57 216.9
Cco07g1163 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT4G15000 82.1 7.6e-53 203.4
Cco07g1162 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT4G15000 82.9 9.9e-53 203.0
Cco11g1727 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT4G15000 78.9 1.2e-50 196.1
Cco05g2839 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT1G23290 80.8 2.5e-60 228.4
Cco01g1490 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT1G23290 82.9 4.2e-60 227.6
Cco05g2839 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT1G70600 82.2 5.8e-62 233.8
Cco01g1490 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT1G70600 84.2 1.0e-61 233.0
Cco07g1434 . 1566 1708 Cytoplasmic Ribosomal Protein Gene Family AT2G19730 74.8 1.5e-54 209.1
Cco11g0209 . 46 188 Cytoplasmic Ribosomal Protein Gene Family AT2G19730 73.4 2.0e-54 208.8
Cco07g1434 . 1566 1708 Cytoplasmic Ribosomal Protein Gene Family AT4G29410 75.5 3.6e-56 214.5
Cco11g0209 . 46 188 Cytoplasmic Ribosomal Protein Gene Family AT4G29410 72.7 1.2e-54 209.5
Cco03g0904 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G36240 83.9 1.1e-52 202.6
Cco03g1465 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G36240 83.0 1.2e-51 199.1
Cco03g0904 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G77940 82.1 4.2e-52 200.7
Cco03g1465 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G77940 83.9 4.2e-52 200.7
Cco03g0904 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT3G18740 81.3 3.6e-51 197.6
Cco03g1465 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT3G18740 80.4 3.9e-50 194.1
Cco03g1640 . 2 120 Cytoplasmic Ribosomal Protein Gene Family AT2G19740 85.7 1.7e-51 198.7
Cco10g1236 . 33 148 Cytoplasmic Ribosomal Protein Gene Family AT2G19740 78.4 8.7e-48 186.4
Cco03g1640 . 6 120 Cytoplasmic Ribosomal Protein Gene Family AT4G26230 87.8 1.3e-51 199.1
Cco10g1236 . 34 148 Cytoplasmic Ribosomal Protein Gene Family AT4G26230 79.1 3.0e-48 188.0
Cco03g0731 . 1 133 Cytoplasmic Ribosomal Protein Gene Family AT4G18100 88.0 4.8e-63 237.3
Cco04g2209 . 1 101 Cytoplasmic Ribosomal Protein Gene Family AT4G18100 85.1 1.6e-45 179.1
Cco03g0731 . 1 133 Cytoplasmic Ribosomal Protein Gene Family AT5G46430 85.7 2.4e-62 235.0
Cco04g2209 . 1 101 Cytoplasmic Ribosomal Protein Gene Family AT5G46430 83.2 2.7e-45 178.3
Cco09g1969 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 92.4 2.8e-44 174.5
Cco09g2031 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 90.2 8.1e-44 172.9
Cco06g1828 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 88.0 3.4e-42 167.5
Cco09g1969 . 1 119 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 92.4 3.9e-56 214.2
Cco09g2031 . 1 119 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 91.6 1.1e-55 212.6
Cco06g1828 . 1 119 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 89.1 4.8e-54 207.2
Cco09g1969 . 1 120 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 90.8 2.0e-55 211.8
Cco09g2031 . 1 120 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 90.0 5.7e-55 210.3
Cco06g1828 . 1 120 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 88.3 1.1e-53 206.1
Cco02g1461 . 60 181 Cytoplasmic Ribosomal Protein Gene Family AT3G09500 91.0 1.0e-51 199.5
Cco09g2222 . 935 1057 Cytoplasmic Ribosomal Protein Gene Family AT3G09500 90.2 1.0e-51 199.5
Cco09g2222 . 935 1057 Cytoplasmic Ribosomal Protein Gene Family AT2G39390 91.1 2.1e-52 201.8
Cco02g1461 . 60 181 Cytoplasmic Ribosomal Protein Gene Family AT2G39390 91.0 6.0e-52 200.3
Cco02g1461 . 60 181 Cytoplasmic Ribosomal Protein Gene Family AT3G55170 90.2 3.9e-51 197.6
Cco09g2222 . 935 1057 Cytoplasmic Ribosomal Protein Gene Family AT3G55170 88.6 8.7e-51 196.4
Cco09g2222 . 935 1057 Cytoplasmic Ribosomal Protein Gene Family AT5G02610 76.0 3.7e-48 188.0
Cco02g1461 . 60 181 Cytoplasmic Ribosomal Protein Gene Family AT5G02610 76.6 4.8e-48 187.6
Cco01g0471 . 27 124 Cytoplasmic Ribosomal Protein Gene Family AT2G37600 86.7 9.8e-41 162.9
Cco05g0980 . 32 124 Cytoplasmic Ribosomal Protein Gene Family AT2G37600 87.1 1.2e-38 156.0
Cco01g0471 . 20 129 Cytoplasmic Ribosomal Protein Gene Family AT3G53740 82.1 8.0e-43 169.9
Cco05g0980 . 25 124 Cytoplasmic Ribosomal Protein Gene Family AT3G53740 83.0 5.3e-39 157.1
Cco01g0471 . 27 129 Cytoplasmic Ribosomal Protein Gene Family AT5G02450 82.5 1.4e-41 165.6
Cco05g0980 . 32 124 Cytoplasmic Ribosomal Protein Gene Family AT5G02450 86.0 2.0e-38 155.2
Cco09g0438 . 1 105 Cytoplasmic Ribosomal Protein Gene Family AT3G23390 93.3 9.4e-54 206.1
Cco10g1189 . 1 105 Cytoplasmic Ribosomal Protein Gene Family AT3G23390 93.3 9.4e-54 206.1
Cco09g0438 . 1 93 Cytoplasmic Ribosomal Protein Gene Family AT4G14320 92.5 8.1e-46 180.3
Cco10g1189 . 1 93 Cytoplasmic Ribosomal Protein Gene Family AT4G14320 92.5 8.1e-46 180.3
Cco09g0201 . 1 94 Cytoplasmic Ribosomal Protein Gene Family AT1G15250 88.3 6.1e-44 173.3
Cco07g1384 . 1 94 Cytoplasmic Ribosomal Protein Gene Family AT1G15250 88.3 1.0e-43 172.6
Cco09g0201 . 1 95 Cytoplasmic Ribosomal Protein Gene Family AT1G52300 89.5 1.1e-45 179.1
Cco07g1384 . 1 95 Cytoplasmic Ribosomal Protein Gene Family AT1G52300 89.5 1.9e-45 178.3
Cco06g0876 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G10950 94.6 2.4e-45 177.9
Cco05g0350 . 1 85 Cytoplasmic Ribosomal Protein Gene Family AT3G10950 94.1 1.2e-41 165.6
Cco06g0876 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G60245 92.4 7.0e-45 176.4
Cco05g0350 . 1 85 Cytoplasmic Ribosomal Protein Gene Family AT3G60245 94.1 4.3e-42 167.2
Cco01g0019 . 1 128 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 99.2 6.3e-68 253.4
Cco07g1062 . 1 128 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 99.2 6.3e-68 253.4
Cco10g0537 . 315 391 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 4.4e-37 151.0
Cco03g0488 . 46 122 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 5.7e-37 150.6
Cco04g2000 . 1 77 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 5.7e-37 150.6
Cco05g1676 . 94 170 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 5.7e-37 150.6
Cco02g1995 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 100.0 7.5e-37 150.2
Cco05g2814 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 100.0 7.5e-37 150.2
Cco08g1963 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 100.0 7.5e-37 150.2
Cco01g0019 . 1 128 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 99.2 6.3e-68 253.4
Cco07g1062 . 1 128 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 99.2 6.3e-68 253.4
Cco10g0537 . 315 391 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 4.4e-37 151.0
Cco03g0488 . 46 122 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 5.7e-37 150.6
Cco04g2000 . 1 77 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 5.7e-37 150.6
Cco05g1676 . 94 170 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 5.7e-37 150.6
Cco02g1995 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 100.0 7.5e-37 150.2
Cco05g2814 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 100.0 7.5e-37 150.2
Cco08g1963 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 100.0 7.5e-37 150.2
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0006540 1 3 1 1 1 1 2 1 1 1 1 1 2 1 1 2 1 2 2 1 1 1 1 1 1 1 1 2 1 1 38