Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cco06g0051 ATGAAAGAGGTGTATGTGGGCCTATATCCTCAGGAGCTCAGATATGACTCTACTGTGTGTTGGATGTTGGGCACTTTGGTTAGACAAGACTTTGGTGAATTAGAACTTGCCCATCTCATAAATCGAATGTTGAATGGATCCTTGGTTTTATCCAAGAGTTGCAGCCGATCAAAGTTGCGCCAGGGGGTTCTGTTAGTTTTTGTGACTCGTGTGCCAAAAAAGGAAAGTGAGAGGTCGTTGCGCGCTCCCGCATCGGTCCCAACATCCATCGGTACGCCCCGTTGCCCTCTCCCTTCACTCCCAACCAGCATTCACCTCTTTCTTCCTCAGATCTACACTCTACATCGCCCTCACTCTCAGGTTTTCTTCTCCTCTTTCTCCTACATCACTTACAGAATGATTTATTCTGTGTTCACGGACATTCGAAACGCCGATTGTCGTTTCGTATCTCGTTCTTGTCCGTCTTTGTTTTGCATTAATCGATTAGCTCCAATTCTAGATCTGGCTTTTCAAGCATTGCAGTTGAAGATGCCATCGGCTCAAGATCCGTTCTATGTTGTAAAAGACGAGATTCAAGAATCTATTGATAAACTGCAATCCAGCTTTCACCAATGGGAAAGGATATCTTCTGATTCAGGAGAGAGAATACAACAAACAAAAGAGTTGCTTGCTTCTTGTGAAAGCATTGAATGGCAGGTGGACGAGTTGGACAAAGCTATTGCTGTGGCAGCTAGAGATCCATCTTGGTATGGCATTGATGATGCAGAACTTGAAAAACGAAGGAGATGGACGAGTACTGCTAGAACACAGGTTGGAAATGTTAAGAAAGTAGTAGGAGCTGGGAAGGAGCAAACGGGAACTGCTAGTGCAAGTGGGATGCGTCGAGAATTGATGAGACTACCTAATGCACATGAAACAGACAGATCAAACTTATATACAGCCAACCAAGCAAATGATGACTTCATCACATCCGAATCAGATAGACAGCTGCTTCTAATAAAGCAGCAGGATGAGGAGTTGGATGAGTTGAGTGCAAGCGTGGAGAGAATTGGAGGTGTTGGGCTTACAATACACGAAGAGCTCCTTGCACAGGATAAAATTATCGACGACCTAGGAATGGAAATGGACAGTACATCAAATCGTCTTGATTTTGTTCAGAAAAAAGTAGCAGTGGTCATGAAGAAGGCCAGCGCCAAGGGGCAGATAATGATGATATTGTTCTTGGTGGCTTTGTTCATCATCCTTTTTGTGTTGGTGTTCCTCACCTAG 1269 44.29 MKEVYVGLYPQELRYDSTVCWMLGTLVRQDFGELELAHLINRMLNGSLVLSKSCSRSKLRQGVLLVFVTRVPKKESERSLRAPASVPTSIGTPRCPLPSLPTSIHLFLPQIYTLHRPHSQVFFSSFSYITYRMIYSVFTDIRNADCRFVSRSCPSLFCINRLAPILDLAFQALQLKMPSAQDPFYVVKDEIQESIDKLQSSFHQWERISSDSGERIQQTKELLASCESIEWQVDELDKAIAVAARDPSWYGIDDAELEKRRRWTSTARTQVGNVKKVVGAGKEQTGTASASGMRRELMRLPNAHETDRSNLYTANQANDDFITSESDRQLLLIKQQDEELDELSASVERIGGVGLTIHEELLAQDKIIDDLGMEMDSTSNRLDFVQKKVAVVMKKASAKGQIMMILFLVALFIILFVLVFLT 422
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
6 472773 477726 - CcPI632755_06g000510.1 Cco06g0051 180651

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cco06g0051 422 FunFam Syntaxin 10 179 281 - -
Cco06g0051 422 CDD SNARE_Qc 333 390 - -
Cco06g0051 422 SUPERFAMILY SNARE fusion complex 329 392 - -
Cco06g0051 422 Gene3D - 337 401 - -
Cco06g0051 422 PANTHER SYNTAXIN 184 409 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Cco06g0051 422 SMART tSNARE_6 325 392 IPR000727 -
Cco06g0051 422 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 330 392 IPR000727 -
Cco06g0051 422 SUPERFAMILY t-snare proteins 181 276 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Cco06g0051 422 FunFam syntaxin-61 isoform X1 333 394 - -
Cco06g0051 422 Gene3D - 178 280 - -
Cco06g0051 422 Pfam Syntaxin 6, N-terminal 182 275 IPR015260 GO:0016020(InterPro)|GO:0048193(InterPro)
Cco06g0051 422 ProSitePatterns Syntaxin / epimorphin family signature. 336 375 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Cco06g0051 422 CDD SNARE_NTD_AtSYP61-like 181 278 - -
Cco06g0051 422 Pfam SNARE domain 367 418 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cco06g0051 K08500 - - csv:101212527 420.624
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cco06g0051 Cco-Chr6:472773 Cco10g0456 Cco-Chr10:5415548 7.70E-06 dispersed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cco08g1446 . 8 365 SNARE and Associated Proteins AT3G24350 55.6 3.6e-89 325.5
Cco04g0763 . 1 309 SNARE and Associated Proteins AT1G08560 69.6 1.4e-100 363.2
Cco04g1722 . 1 242 SNARE and Associated Proteins AT2G18260 55.7 3.8e-71 265.4
Cco10g1812 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.4e-115 411.8
Cco04g1261 . 26 282 SNARE and Associated Proteins AT3G11820 73.2 1.3e-103 373.2
Cco03g0560 . 31 281 SNARE and Associated Proteins AT3G11820 66.5 1.1e-92 337.0
Cco10g1337 . 30 284 SNARE and Associated Proteins AT3G11820 52.9 3.6e-69 258.8
Cco10g1812 . 1 279 SNARE and Associated Proteins AT3G52400 63.9 5.7e-92 334.7
Cco04g1261 . 33 282 SNARE and Associated Proteins AT3G52400 64.8 2.3e-85 312.8
Cco03g0560 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 3.4e-81 298.9
Cco03g0560 . 1 299 SNARE and Associated Proteins AT4G03330 69.2 3.0e-108 388.7
Cco10g1812 . 1 284 SNARE and Associated Proteins AT4G03330 57.2 3.0e-84 308.9
Cco04g1261 . 1 297 SNARE and Associated Proteins AT4G03330 52.3 8.4e-79 290.8
Cco10g1337 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 1.2e-69 260.4
Cco03g0560 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 9.7e-128 453.4
Cco10g1812 . 1 284 SNARE and Associated Proteins AT1G61290 62.0 2.5e-91 332.4
Cco04g1261 . 1 297 SNARE and Associated Proteins AT1G61290 56.9 9.2e-86 313.9
Cco03g0560 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 1.7e-124 442.6
Cco10g1812 . 1 284 SNARE and Associated Proteins AT1G11250 62.0 1.5e-93 339.7
Cco04g1261 . 1 291 SNARE and Associated Proteins AT1G11250 57.4 6.3e-87 317.8
Cco10g1337 . 1 303 SNARE and Associated Proteins AT3G03800 74.3 9.5e-115 410.2
Cco10g1337 . 1 202 SNARE and Associated Proteins AT5G08080 79.3 2.9e-81 298.5
Cco02g0923 . 1 225 SNARE and Associated Proteins AT5G08080 52.4 2.8e-47 185.7
Cco10g0147 . 1 256 SNARE and Associated Proteins AT5G16830 59.5 7.9e-76 280.8
Cco10g0147 . 1 256 SNARE and Associated Proteins AT5G46860 66.0 3.9e-80 295.0
Cco10g0147 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 2.7e-73 272.3
Cco10g0147 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 4.4e-52 202.2
Cco07g0418 . 51 386 SNARE and Associated Proteins AT5G05760 65.9 3.1e-111 398.7
Cco08g1446 . 8 365 SNARE and Associated Proteins AT3G24350 55.6 3.6e-89 325.5
Cco02g1642 . 1 327 SNARE and Associated Proteins AT5G26980 76.1 3.0e-127 451.8
Cco09g0532 . 1 318 SNARE and Associated Proteins AT5G26980 66.2 1.3e-101 366.7
Cco09g0532 . 1 318 SNARE and Associated Proteins AT4G02195 67.1 1.1e-105 380.2
Cco02g1642 . 1 329 SNARE and Associated Proteins AT4G02195 64.0 7.2e-105 377.5
Cco02g1642 . 1 328 SNARE and Associated Proteins AT3G05710 75.7 2.5e-129 458.8
Cco09g0532 . 1 318 SNARE and Associated Proteins AT3G05710 63.7 5.1e-98 354.8
Cco09g1113 . 1 233 SNARE and Associated Proteins AT1G16240 72.1 2.3e-89 325.5
Cco10g0456 . 32 253 SNARE and Associated Proteins AT1G16240 68.5 2.0e-80 295.8
Cco09g1113 . 1 233 SNARE and Associated Proteins AT1G79590 71.2 1.1e-87 320.1
Cco10g0456 . 27 253 SNARE and Associated Proteins AT1G79590 67.0 9.2e-82 300.4
Cco06g0051 . 232 422 SNARE and Associated Proteins AT1G28490 71.7 8.3e-67 250.4
Cco10g2031 . 1 264 SNARE and Associated Proteins AT3G09740 78.9 3.8e-112 401.4
Cco02g2256 . 1 265 SNARE and Associated Proteins AT3G09740 67.4 4.3e-95 344.7
Cco02g2256 . 1 265 SNARE and Associated Proteins AT3G45280 65.2 1.4e-90 329.7
Cco10g2031 . 1 264 SNARE and Associated Proteins AT3G45280 63.7 1.3e-86 316.6
Cco10g2031 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.1e-94 340.9
Cco02g2256 . 1 262 SNARE and Associated Proteins AT3G61450 61.4 1.8e-85 312.8
Cco11g0653 . 65 309 SNARE and Associated Proteins AT1G51740 72.9 1.7e-90 329.3
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003549 2 1 2 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 5 4 0 44