Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cec03g0540 ATGAACGACTTATTCTCGAATTCGTTCAAAAAGTACACGGATCTGAAGCAACAGGCGTATCTGGACAGCATGGAGGCTGGAAATGAGAGTGTAAATTTGGACAGATTCTTTGAAGATGTAGAAAATGTTAAAGATGACATGAAACAGGTTGAGAATTTGTACAAGAAGTTGCAGCAGGCTAATGAGGAGTGCAAGATTGTGCATAATGCCAAGACAATGAAGGAGCTGAGGGGCCGAATGGAGGCTGATGTCGCCCAAGTTCTCAAGCGAGTCAAAATGATCAAAGGAAAGCTCGAAGCTCTCGAGCGTTCCAATGCCGCTCACCGCAGCCTCCCTGGCTGCGGCCCTGGCTCCTCCGCTGACCGGACTCGAACCTCCGTCGTTAGCGGCTTGGGAAAGAAGCTCAAAGATGTTATGGATGATTTTCAAGGCCTTAGAGCTCGAATGAACGCCGAGTACAAAGAGACCGTCGAGCGAAGGTACTTCACAGTAACAGGGCAGAAAGCAAATGAAGAGACAATAGAAAATTTGATATCAAGTGGGGAAAGTGAGAGTTTCCTGCAGAAGGCAATTCAAGAACAGGGGAGGGGTCAGATAATGGACACAATTTCAGAGATTCAAGAACGACATGACGCTGTGAAAGAAATAGAGAAGAATTTGTTAGAGCTGCATCAGATATTCTTGGACATGGCGGCTTTGGTTGAGGCTCAAGGCCACCAACTGAACGACATTGAAAGCCATGTGGCACATGCTAACTCCTTCGTTAGAAGAGGAACAGAGCAACTGCAAGAAGCTAGAGAGTATCAAAAGAGCTCAAGGAAATGGACTTGCTATGCCATAATTTTGGGGGCTGTTCTCATTGTCATTCTTCTCTTCCCAATCTTAACTTCAATTTTACCTCATTTGTTGTAG 912 45.5 MNDLFSNSFKKYTDLKQQAYLDSMEAGNESVNLDRFFEDVENVKDDMKQVENLYKKLQQANEECKIVHNAKTMKELRGRMEADVAQVLKRVKMIKGKLEALERSNAAHRSLPGCGPGSSADRTRTSVVSGLGKKLKDVMDDFQGLRARMNAEYKETVERRYFTVTGQKANEETIENLISSGESESFLQKAIQEQGRGQIMDTISEIQERHDAVKEIEKNLLELHQIFLDMAALVEAQGHQLNDIESHVAHANSFVRRGTEQLQEAREYQKSSRKWTCYAIILGAVLIVILLFPILTSILPHLL 303
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
3 5659439 5660588 + CePI673135_03g005400.1 Cec03g0540 198164

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cec03g0540 303 Gene3D - 193 298 - -
Cec03g0540 303 CDD SNARE_syntaxin1-like 202 264 - -
Cec03g0540 303 FunFam Qa-SNARE, Sso1/Syntaxin1-type, SYP12A-group 30 160 - -
Cec03g0540 303 FunFam Syntaxin 132 196 296 - -
Cec03g0540 303 Coils Coil 33 70 - -
Cec03g0540 303 SMART SynN_4 28 154 IPR006011 GO:0016020(InterPro)
Cec03g0540 303 CDD SynN 33 190 IPR006011 GO:0016020(InterPro)
Cec03g0540 303 Gene3D - 33 160 - -
Cec03g0540 303 Pfam Syntaxin 35 238 IPR006011 GO:0016020(InterPro)
Cec03g0540 303 SUPERFAMILY t-snare proteins 32 258 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Cec03g0540 303 ProSitePatterns Syntaxin / epimorphin family signature. 209 248 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Cec03g0540 303 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 203 265 IPR000727 -
Cec03g0540 303 Coils Coil 84 104 - -
Cec03g0540 303 SMART tSNARE_6 198 265 IPR000727 -
Cec03g0540 303 PANTHER SYNTAXIN 35 287 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0005886(PANTHER)|GO:0006886(PANTHER)|GO:0006887(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Cec03g0540 303 Pfam SNARE domain 240 291 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cec03g0540 K08486 - - csv:101217140 579.711
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cec03g0540 Cec-Chr3:5659439 Cec04g1193 Cec-Chr4:31507906 2.00E-85 dispersed
Cec03g0540 Cec-Chr3:5659439 Cec10g1837 Cec-Chr10:33175462 1.60E-90 transposed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cec08g1324 . 37 351 SNARE and Associated Proteins AT3G24350 61.0 1.7e-94 343.2
Cec04g0715 . 1 309 SNARE and Associated Proteins AT1G08560 69.3 6.0e-101 364.4
Cec04g1660 . 23 325 SNARE and Associated Proteins AT2G18260 54.2 7.7e-85 310.8
Cec10g1837 . 19 279 SNARE and Associated Proteins AT3G11820 80.5 1.3e-114 409.8
Cec04g1193 . 22 282 SNARE and Associated Proteins AT3G11820 71.6 5.0e-103 371.3
Cec03g0540 . 31 281 SNARE and Associated Proteins AT3G11820 66.5 1.0e-92 337.0
Cec10g1365 . 442 696 SNARE and Associated Proteins AT3G11820 52.5 8.0e-69 257.7
Cec10g1837 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 4.7e-91 331.6
Cec04g1193 . 33 282 SNARE and Associated Proteins AT3G52400 64.8 1.7e-85 313.2
Cec03g0540 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 3.4e-81 298.9
Cec10g1365 . 444 696 SNARE and Associated Proteins AT3G52400 51.0 6.0e-62 235.0
Cec03g0540 . 1 299 SNARE and Associated Proteins AT4G03330 69.2 2.9e-108 388.7
Cec10g1837 . 1 279 SNARE and Associated Proteins AT4G03330 58.2 4.2e-83 305.1
Cec04g1193 . 1 297 SNARE and Associated Proteins AT4G03330 52.3 6.3e-79 291.2
Cec10g1365 . 433 696 SNARE and Associated Proteins AT4G03330 53.8 3.9e-68 255.4
Cec03g0540 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 9.6e-128 453.4
Cec10g1837 . 1 279 SNARE and Associated Proteins AT1G61290 62.4 6.1e-90 327.8
Cec04g1193 . 1 297 SNARE and Associated Proteins AT1G61290 56.6 1.2e-85 313.5
Cec10g1365 . 448 696 SNARE and Associated Proteins AT1G61290 50.6 8.3e-63 237.7
Cec03g0540 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 1.7e-124 442.6
Cec10g1837 . 1 279 SNARE and Associated Proteins AT1G11250 62.0 4.9e-92 334.7
Cec04g1193 . 1 292 SNARE and Associated Proteins AT1G11250 57.2 6.2e-87 317.8
Cec10g1365 . 432 696 SNARE and Associated Proteins AT1G11250 50.6 2.1e-66 249.6
Cec10g1365 . 417 715 SNARE and Associated Proteins AT3G03800 74.2 6.7e-113 404.1
Cec02g0887 . 38 271 SNARE and Associated Proteins AT3G03800 59.8 6.4e-71 264.6
Cec10g1365 . 417 614 SNARE and Associated Proteins AT5G08080 78.4 1.0e-78 290.0
Cec02g0887 . 24 224 SNARE and Associated Proteins AT5G08080 58.7 1.3e-52 203.4
Cec10g0147 . 1 256 SNARE and Associated Proteins AT5G16830 59.2 6.6e-75 277.7
Cec10g0147 . 1 256 SNARE and Associated Proteins AT5G46860 66.0 3.0e-80 295.4
Cec10g0147 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 5.8e-73 271.2
Cec10g0147 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 3.3e-52 202.6
Cec07g0462 . 1 336 SNARE and Associated Proteins AT5G05760 65.9 1.8e-111 399.4
Cec08g1324 . 37 351 SNARE and Associated Proteins AT3G24350 61.0 1.7e-94 343.2
Cec02g1601 . 34 359 SNARE and Associated Proteins AT5G26980 76.7 7.8e-128 453.8
Cec09g0536 . 1 317 SNARE and Associated Proteins AT5G26980 66.2 6.9e-100 360.9
Cec02g1601 . 34 359 SNARE and Associated Proteins AT4G02195 64.0 3.5e-104 375.2
Cec09g0536 . 1 317 SNARE and Associated Proteins AT4G02195 66.1 1.9e-102 369.4
Cec02g1601 . 34 359 SNARE and Associated Proteins AT3G05710 76.1 1.1e-129 459.9
Cec09g0536 . 1 317 SNARE and Associated Proteins AT3G05710 63.7 3.6e-96 348.6
Cec09g1092 . 1 209 SNARE and Associated Proteins AT1G16240 72.7 5.7e-80 294.3
Cec10g0467 . 32 247 SNARE and Associated Proteins AT1G16240 68.5 1.2e-77 286.6
Cec10g0467 . 27 247 SNARE and Associated Proteins AT1G79590 67.0 5.5e-79 291.2
Cec09g1092 . 1 209 SNARE and Associated Proteins AT1G79590 71.3 5.1e-77 284.6
Cec06g0054 . 136 326 SNARE and Associated Proteins AT1G28490 71.7 8.1e-67 250.4
Cec10g2046 . 104 367 SNARE and Associated Proteins AT3G09740 79.3 1.0e-112 403.3
Cec02g2216 . 1 265 SNARE and Associated Proteins AT3G09740 67.8 1.9e-95 345.9
Cec02g2216 . 1 265 SNARE and Associated Proteins AT3G45280 65.9 7.5e-92 334.0
Cec10g2046 . 104 367 SNARE and Associated Proteins AT3G45280 64.0 3.2e-87 318.5
Cec10g2046 . 104 364 SNARE and Associated Proteins AT3G61450 68.2 5.4e-95 344.4
Cec02g2216 . 1 262 SNARE and Associated Proteins AT3G61450 61.4 3.0e-85 312.0
Cec11g0667 . 65 307 SNARE and Associated Proteins AT1G51740 73.1 1.4e-89 326.2
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0005716 1 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 2 1 1 37