Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Cec05g2535	ATGGCTTCCGAGAGCGGTTCCAGATCCAGTTCAGCGGCCGATTCTTATATTGGAAGCTTGATAAGCTTAACTTCCAAGAGTGAGATTAGATACGAAGGTGTTCTTTACAACATCAACACCGAAGAGTCCAGTATCGGACTGAGAAATGTACGGTCATTTGGAACAGAAGGGAGAAAGAAGGATGGACCACAAGTCCCACCAAGCGACAAAGTTTTTGAATACATCTTGTTCCGTGGAAGTGATATCAAGGATCTACAAGTAAAATCTTCTCCTCCTGTTCAGACTACATCCTTGATAAATAATGATCCAGCTATTATTCAGTCTCACTATCCTTGTCCAGCATCGACTTCTTCAAGCTTGCCTCCTCCTGTTAGTGGGCCTTTGCCTGATATTAATTCTCAGGCCATGCCTATGGGAATTCCTGGATCTAATTTCCAGGGTGGGTTGCCTTTATATCAAGCTGGAGGAAATGTAGGGTCTTGGGGAGCTTCTCCTACGCCATCTCCCCCAAATCCAAGTGGTGGTGGGCTTGCTTTGCCAATGTACTGGCAAGGGTATTATGGCCCCCCTAATGGACTTCCTCATATGCAACAGCAGTCATTACTTCGTCCACCACCTGGCCTGTCATTGCCTTCTTCCTTGCAGCAGCCCCTGCAATATCCTAATCTTAATACTTCTTTACCCACTGGGGCACCAAATTTATTAGAAGTTCCATCTTCTTTATTCTCTGCTAATCCGAGCACTCCTAGTTTATCGTCCACAGCAATGCCACCAGTAACTGTATCTTCGTCACTCCCATCTGTGCTTTCGGCTCCACAGACCTCTGAGATATCATCAAGCTCAGTGGTCAACAAGACAGTAAATTCTGCTCTTCCTCAAGCTCCTCTAAGTACTAATTTGCCATCGCTCTCTCCTTTGACGGCAAGTTCAGATGTCAGTCCTGTTGTGCCTCCAACTATTAACAAAACTACTACAGTTTCTGGTCCAGCATTGTCTTACCAAACTGTCTCTCAATCTACATCCTCTGTTGTTGGAACATTGAACTCTGCTCTCACAGGTGCACCTGTACCTACCCTTGTGACTCCAGGACAGCTGTTGCAAACTACTGTAGCCTCTTCATCTTTGGAAACAGTTCAAAAGGACGTTGAGGTGGTTCAAACATCTTCCTCCTTAGCAGCCGAACAAACTGTTCCAGCAGCCGATACTCAGCCACCATTATTACCATTACCGGTGTCTTCACAAGCTATTCATAAGCCAAATGGTTCAACTTTGCAAACTCGGTACATCCACAGGGGACGTGGTAGAGGAAGACGATTTGGGAACTCGCATCAAACAGAAAGATTTACAGAAGATTTTGACTTCACGGCAATGAATGAGAAATTTAACAAGGATGAAGTCTGGGGTCATCTTGGCAAGAATACCAAATCTCATCCAAAGTACAATGATGGGGACGAAAAGTTCAGTGATGAAGATGATGTCTATGAGGAAGATGATGGTGAATCTTCAAAGTTGGAGATCAAGCCTGTGTACAATAAGGACGACTTTTTTGATACACTCTCGTGCAACAATCCTGACAATGAAGCTCAACATGGAAGGAGGACCAGATACTACGAACAAATCAAGTTGGACACTGAGACATTTGGTGAATTTGCAAGATTCCGAGGTGGTCGTGGTGGGTTTTCTTCTGGACGTGGTGGCCGTCGTGGTGGTTATTACGGGAGAGGATACGGCCATGTTGGAAGGGGTCGAGGGCGGGGAATGCATAACTATAATCTCCTACTTACCACTGTACTCTTGGCCGAGCCAAGATTGTTGAGCTGCAGACCGCCTTTCTCTGTCCCCATGGCCGCGGCATTGCCCTCACTCACCCCATTACTTATCTTTGCCAGAATCTTTGGTCTGCTTGTTGCCGTTCTGGCCTTCGTTTGGGCTTTTGCATTCAGTTCCAGCTTCGGCCATCGCTCCCCTGCCCGCGATGACCATCTCTTCGACGTTCTGCATCCTTTGTTCATGGTAATTGGTCTCATTCTCCTCAGCGGGGAAGCAATTTTGGTCCATAGCTGGTTGCCTGGTTCGAGAAATTTGAGGAAATCTGTTCATCTGAGTCTTCAAGGGCTGGCTTTAGCTTCTGGGATTTCCGGAATTTGGACCAAGTTTCATTGGGATCGTGGCTTTTTGGCTAATTTCCACAGTTTACATTCTTGGATGGGTTTGATTGTTGTCACTTTGTTCGGAGCTCAGTGGATGATGGGGTTTCTGAGCTTCTGGCATTGGAGGGAGGTGAGGGCAACAAGAGAAAGAGTGCTGCCATGGCATGTGTTCCTTGGGTTATACAGTTATGCATTGGCAGTGGTAACAGCAGAAACAGGGCTTCTTGAGAAGTTGACATTGTTGCAAACCAAGAGAAATGTTCCTAGGAAGGGTCCTGAAGCCACGTTTGTAAACAGTCTAGGCTTGGCACTGGCTTTGCTAACTGGAACTGTTATGCTCACTGCTATATCTCCTAAATATCCTCCTTCCCTCCCCACCACCAAACAACAACCATTTTTCTCTAATTCAAAGCCCTTACCTTCTTAA	2577	46.1	MASESGSRSSSAADSYIGSLISLTSKSEIRYEGVLYNINTEESSIGLRNVRSFGTEGRKKDGPQVPPSDKVFEYILFRGSDIKDLQVKSSPPVQTTSLINNDPAIIQSHYPCPASTSSSLPPPVSGPLPDINSQAMPMGIPGSNFQGGLPLYQAGGNVGSWGASPTPSPPNPSGGGLALPMYWQGYYGPPNGLPHMQQQSLLRPPPGLSLPSSLQQPLQYPNLNTSLPTGAPNLLEVPSSLFSANPSTPSLSSTAMPPVTVSSSLPSVLSAPQTSEISSSSVVNKTVNSALPQAPLSTNLPSLSPLTASSDVSPVVPPTINKTTTVSGPALSYQTVSQSTSSVVGTLNSALTGAPVPTLVTPGQLLQTTVASSSLETVQKDVEVVQTSSSLAAEQTVPAADTQPPLLPLPVSSQAIHKPNGSTLQTRYIHRGRGRGRRFGNSHQTERFTEDFDFTAMNEKFNKDEVWGHLGKNTKSHPKYNDGDEKFSDEDDVYEEDDGESSKLEIKPVYNKDDFFDTLSCNNPDNEAQHGRRTRYYEQIKLDTETFGEFARFRGGRGGFSSGRGGRRGGYYGRGYGHVGRGRGRGMHNYNLLLTTVLLAEPRLLSCRPPFSVPMAAALPSLTPLLIFARIFGLLVAVLAFVWAFAFSSSFGHRSPARDDHLFDVLHPLFMVIGLILLSGEAILVHSWLPGSRNLRKSVHLSLQGLALASGISGIWTKFHWDRGFLANFHSLHSWMGLIVVTLFGAQWMMGFLSFWHWREVRATRERVLPWHVFLGLYSYALAVVTAETGLLEKLTLLQTKRNVPRKGPEATFVNSLGLALALLTGTVMLTAISPKYPPSLPTTKQQPFFSNSKPLPS	858

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
5	36360908	36369286	-	CePI673135_05g025350.1	Cec05g2535	204338

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Cec05g2535	858	ProSiteProfiles	Cytochrome b561 domain profile.	628	833	IPR006593	-
Cec05g2535	858	MobiDBLite	consensus disorder prediction	468	486	-	-
Cec05g2535	858	SMART	561_7	666	791	IPR006593	-
Cec05g2535	858	Pfam	Eukaryotic cytochrome b561	666	796	IPR006593	-
Cec05g2535	858	CDD	LSm14_N	16	87	IPR025609	-
Cec05g2535	858	PANTHER	SCD6 PROTEIN-RELATED	13	586	-	GO:0000932(PANTHER)\|GO:0003729(PANTHER)\|GO:0033962(PANTHER)\|GO:0034063(PANTHER)
Cec05g2535	858	ProSiteProfiles	Sm domain profile.	8	91	IPR047575	GO:0003723(InterPro)
Cec05g2535	858	Pfam	FDF domain	447	550	IPR019050	-
Cec05g2535	858	Pfam	Scd6-like Sm domain	16	89	IPR025609	-
Cec05g2535	858	CDD	Cyt_b561_ACYB-1_like	660	799	-	-
Cec05g2535	858	Gene3D	-	6	92	-	-
Cec05g2535	858	SMART	FDF_2	446	551	IPR019050	-
Cec05g2535	858	MobiDBLite	consensus disorder prediction	468	502	-	-
Cec05g2535	858	ProSiteProfiles	TFG box profile.	531	551	IPR025768	-
Cec05g2535	858	FunFam	Trailer hitch, isoform C	10	92	-	-
Cec05g2535	858	SUPERFAMILY	Sm-like ribonucleoproteins	15	92	IPR010920	-
Cec05g2535	858	ProSiteProfiles	DFDF domain profile.	440	476	IPR025762	-
Cec05g2535	858	ProSiteProfiles	FFD box profile.	508	523	IPR025761	-
Cec05g2535	858	FunFam	Cytochrome b reductase 1	619	840	-	-
Cec05g2535	858	Gene3D	-	616	838	-	-
Cec05g2535	858	SMART	LSM14_2	10	110	IPR025609	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Cec05g2535	K18749	-	-	csv:101205721	893.649

Dupl-types

Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
Cec07g0728	Cec-Chr7:14361103	Cec05g2535	Cec-Chr5:36360908	5.10E-22	transposed
Cec09g1347	Cec-Chr9:16962880	Cec05g2535	Cec-Chr5:36360908	1.10E-27	transposed
Cec11g0556	Cec-Chr11:6087148	Cec05g2535	Cec-Chr5:36360908	3.80E-44	transposed
Cec01g0577	Cec-Chr1:6054412	Cec05g2535	Cec-Chr5:36360908	8.90E-170	wgd

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi1g247	Blo01g00476	.	.	.	.	.	Bma14g01693	.	Cmo04g01615	Cmo18g01071	.	.	Car04g01593	.	Sed06g1855	Cpe09g00267	Cpe01g01755	Bhi07g01381	Tan04g0909	Cmetu10g0348	Lac13g0448	Hepe10g1862	.	.	Cla05g02337	Cam05g2511	Cec05g2535	Cco05g2578	Clacu05g2505	Cmu05g2367	Cre05g2484	Cone13ag0863	Cone19ag0863	.	.	Lsi04g00298	Csa05g02074	.	Cme10g00301	.	Blo11g00828	.	.	Bpe11g01686	.	.	.	.	.	.	Cma04g01995	.	.	Car15g01281	Cpe13g00029	.	Bhi12g00822	.	.	.	.	.	Lcy10g0875	Cla01g00562	Cam01g0585	Cec01g0577	Cco01g0601	Clacu01g0580	Cmu01g0551	Cre09g1956	Lsi09g00611	.	.	.

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Cec03g0162	.	16	451	Chloroplast and Mitochondria Gene Families	AT2G28800	62.6	1.3e-138	490.0
Cec08g1809	.	71	432	Chloroplast and Mitochondria Gene Families	AT2G28800	55.0	1.9e-100	363.2
Cec08g0719	.	3	255	Chloroplast and Mitochondria Gene Families	AT1G15820	82.4	3.7e-120	427.9
Cec02g0290	.	1	265	Chloroplast and Mitochondria Gene Families	AT3G27690	88.7	1.0e-142	503.1
Cec02g1928	.	2	267	Chloroplast and Mitochondria Gene Families	AT3G27690	78.4	6.5e-121	430.6
Cec04g2142	.	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	77.4	3.2e-120	428.3
Cec04g2143	.	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	76.7	2.7e-119	425.2
Cec03g0717	.	43	234	Chloroplast and Mitochondria Gene Families	AT3G27690	89.6	2.3e-102	369.0
Cec10g0627	.	5	266	Chloroplast and Mitochondria Gene Families	AT3G27690	66.9	1.1e-96	350.1
Cec08g0043	.	109	312	Chloroplast and Mitochondria Gene Families	AT3G27690	53.8	6.5e-52	201.4
Cec11g1417	.	3	268	Chloroplast and Mitochondria Gene Families	AT3G61470	80.5	9.6e-129	456.4
Cec03g1553	.	56	261	Chloroplast and Mitochondria Gene Families	AT3G61470	66.0	1.2e-86	316.6
Cec06g1811	.	22	249	Chloroplast and Mitochondria Gene Families	AT3G61470	50.8	1.4e-63	240.0
Cec09g2164	.	1	198	Chloroplast and Mitochondria Gene Families	AT3G54890	81.6	5.6e-90	327.4
Cec04g0849	.	3	285	Chloroplast and Mitochondria Gene Families	AT3G08940	82.0	2.9e-134	474.9
Cec10g2202	.	41	306	Chloroplast and Mitochondria Gene Families	AT3G08940	83.9	2.9e-126	448.4
Cec11g1955	.	59	326	Chloroplast and Mitochondria Gene Families	AT1G76570	79.5	2.9e-130	461.8
Cec03g1252	.	1	273	Chloroplast and Mitochondria Gene Families	AT1G61520	86.4	1.3e-136	482.6
Cec02g0290	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G05070	89.4	2.9e-144	508.1
Cec04g2142	.	5	265	Chloroplast and Mitochondria Gene Families	AT2G05070	79.3	9.9e-121	429.9
Cec04g2143	.	5	265	Chloroplast and Mitochondria Gene Families	AT2G05070	78.6	4.9e-120	427.6
Cec02g1928	.	7	267	Chloroplast and Mitochondria Gene Families	AT2G05070	78.9	6.4e-120	427.2
Cec03g0717	.	43	234	Chloroplast and Mitochondria Gene Families	AT2G05070	89.6	4.6e-102	367.9
Cec10g0627	.	7	266	Chloroplast and Mitochondria Gene Families	AT2G05070	68.0	3.4e-97	351.7
Cec08g0043	.	109	312	Chloroplast and Mitochondria Gene Families	AT2G05070	54.3	4.4e-52	201.8
Cec02g0290	.	1	237	Chloroplast and Mitochondria Gene Families	AT2G05100	89.5	1.6e-125	446.0
Cec04g2142	.	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	76.9	5.5e-102	367.9
Cec04g2143	.	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	76.4	1.6e-101	366.3
Cec02g1928	.	7	239	Chloroplast and Mitochondria Gene Families	AT2G05100	76.9	4.7e-101	364.8
Cec03g0717	.	43	206	Chloroplast and Mitochondria Gene Families	AT2G05100	89.0	6.8e-84	307.8
Cec10g0627	.	7	238	Chloroplast and Mitochondria Gene Families	AT2G05100	67.6	4.9e-82	301.6
Cec08g0043	.	109	296	Chloroplast and Mitochondria Gene Families	AT2G05100	53.1	1.5e-43	173.7
Cec04g0849	.	3	167	Chloroplast and Mitochondria Gene Families	AT2G40100	72.2	2.9e-66	248.4
Cec10g2202	.	41	203	Chloroplast and Mitochondria Gene Families	AT2G40100	67.9	1.1e-60	229.9
Cec02g1928	.	1	267	Chloroplast and Mitochondria Gene Families	AT1G29930	88.4	1.7e-136	482.3
Cec04g2142	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	88.8	3.8e-136	481.1
Cec04g2143	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	88.4	6.5e-136	480.3
Cec02g0290	.	3	265	Chloroplast and Mitochondria Gene Families	AT1G29930	78.3	3.3e-116	414.8
Cec03g0717	.	1	234	Chloroplast and Mitochondria Gene Families	AT1G29930	76.8	8.5e-112	400.2
Cec10g0627	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29930	65.2	9.4e-95	343.6
Cec02g1928	.	1	267	Chloroplast and Mitochondria Gene Families	AT1G29920	88.1	6.5e-136	480.3
Cec04g2142	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	88.4	1.4e-135	479.2
Cec04g2143	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	88.0	2.5e-135	478.4
Cec02g0290	.	3	265	Chloroplast and Mitochondria Gene Families	AT1G29920	77.9	2.0e-116	415.6
Cec03g0717	.	1	234	Chloroplast and Mitochondria Gene Families	AT1G29920	76.4	3.2e-111	398.3
Cec10g0627	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29920	65.2	1.6e-94	342.8
Cec08g0043	.	92	312	Chloroplast and Mitochondria Gene Families	AT1G29920	50.7	6.8e-53	204.5
Cec02g1928	.	1	267	Chloroplast and Mitochondria Gene Families	AT1G29910	88.1	6.5e-136	480.3
Cec04g2142	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	88.4	1.4e-135	479.2
Cec04g2143	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	88.0	2.5e-135	478.4
Cec02g0290	.	3	265	Chloroplast and Mitochondria Gene Families	AT1G29910	77.9	2.0e-116	415.6
Cec03g0717	.	1	234	Chloroplast and Mitochondria Gene Families	AT1G29910	76.4	3.2e-111	398.3
Cec10g0627	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29910	65.2	1.6e-94	342.8
Cec08g0043	.	92	312	Chloroplast and Mitochondria Gene Families	AT1G29910	50.7	6.8e-53	204.5
Cec08g0043	.	47	327	Chloroplast and Mitochondria Gene Families	AT4G10340	84.7	5.0e-139	490.7
Cec04g2143	.	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.9	3.7e-57	218.8
Cec04g2142	.	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.5	6.3e-57	218.0
Cec02g1928	.	51	255	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	1.1e-56	217.2
Cec02g0290	.	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.6	2.9e-54	209.1
Cec10g0627	.	48	254	Chloroplast and Mitochondria Gene Families	AT4G10340	54.0	3.6e-52	202.2
Cec03g0717	.	27	222	Chloroplast and Mitochondria Gene Families	AT4G10340	51.8	1.1e-50	197.2
Cec02g1928	.	1	267	Chloroplast and Mitochondria Gene Families	AT2G34420	88.4	1.1e-135	479.6
Cec04g2142	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	88.0	1.6e-134	475.7
Cec04g2143	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	87.6	2.7e-134	474.9
Cec02g0290	.	3	265	Chloroplast and Mitochondria Gene Families	AT2G34420	77.2	6.7e-117	417.2
Cec03g0717	.	1	234	Chloroplast and Mitochondria Gene Families	AT2G34420	74.9	1.8e-109	392.5
Cec10g0627	.	24	266	Chloroplast and Mitochondria Gene Families	AT2G34420	70.1	7.9e-94	340.5
Cec04g2143	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	88.3	7.6e-137	483.4
Cec04g2142	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	88.3	2.9e-136	481.5
Cec02g1928	.	1	267	Chloroplast and Mitochondria Gene Families	AT2G34430	88.1	1.9e-135	478.8
Cec02g0290	.	31	265	Chloroplast and Mitochondria Gene Families	AT2G34430	83.2	1.8e-114	409.1
Cec03g0717	.	1	234	Chloroplast and Mitochondria Gene Families	AT2G34430	76.3	2.9e-112	401.7
Cec10g0627	.	36	266	Chloroplast and Mitochondria Gene Families	AT2G34430	70.5	8.0e-94	340.5
Cec04g0849	.	2	285	Chloroplast and Mitochondria Gene Families	AT5G01530	83.2	4.4e-138	487.6
Cec10g2202	.	38	306	Chloroplast and Mitochondria Gene Families	AT5G01530	86.7	6.6e-134	473.8
Cec10g0767	.	120	379	Chloroplast and Mitochondria Gene Families	AT5G40810	93.5	2.4e-143	505.0
Cec10g0767	.	73	379	Chloroplast and Mitochondria Gene Families	AT3G27240	85.7	1.2e-149	526.2
Cec02g2028	.	5	327	Chloroplast and Mitochondria Gene Families	AT2G30160	74.7	1.3e-141	499.6
Cec04g0807	.	9	311	Chloroplast and Mitochondria Gene Families	AT2G30160	63.9	1.5e-110	396.4
Cec02g2028	.	5	323	Chloroplast and Mitochondria Gene Families	AT1G07030	75.8	5.6e-142	500.7
Cec04g0807	.	5	311	Chloroplast and Mitochondria Gene Families	AT1G07030	67.2	2.8e-117	418.7
Cec09g0539	.	1	305	Chloroplast and Mitochondria Gene Families	AT2G47490	76.4	2.2e-135	478.8
Cec01g0586	.	9	312	Chloroplast and Mitochondria Gene Families	AT2G47490	63.5	1.4e-110	396.4
Cec01g0586	.	10	364	Chloroplast and Mitochondria Gene Families	AT1G25380	63.7	2.2e-123	439.1
Cec09g0539	.	11	297	Chloroplast and Mitochondria Gene Families	AT1G25380	64.6	2.5e-106	382.5
Cec03g0537	.	5	584	Chloroplast and Mitochondria Gene Families	AT4G21490	75.2	1.1e-260	896.0
Cec02g1805	.	1	585	Chloroplast and Mitochondria Gene Families	AT4G21490	70.0	5.0e-242	833.9
Cec02g0140	.	1	574	Chloroplast and Mitochondria Gene Families	AT4G21490	64.5	7.2e-225	776.9
Cec09g0077	.	5	186	Chloroplast and Mitochondria Gene Families	AT1G17530	64.3	3.2e-62	235.0
Cec06g1009	.	4	179	Chloroplast and Mitochondria Gene Families	AT1G17530	59.0	1.5e-51	199.5
Cec06g1009	.	12	183	Chloroplast and Mitochondria Gene Families	AT3G04800	59.5	2.0e-51	199.1
Cec09g0077	.	22	186	Chloroplast and Mitochondria Gene Families	AT3G04800	53.9	1.5e-41	166.4
Cec09g0077	.	15	187	Chloroplast and Mitochondria Gene Families	AT1G72750	68.0	2.0e-62	235.7
Cec06g1009	.	5	183	Chloroplast and Mitochondria Gene Families	AT1G72750	58.8	2.8e-53	205.3
Cec05g2535	.	663	837	Chloroplast and Mitochondria Gene Families	AT1G26100	69.1	1.3e-66	250.0
Cec11g0556	.	1	226	Chloroplast and Mitochondria Gene Families	AT5G38630	70.5	7.9e-90	327.0
Cec09g1347	.	23	230	Chloroplast and Mitochondria Gene Families	AT4G25570	69.0	1.7e-83	306.2
Cec01g0680	.	2	219	Chloroplast and Mitochondria Gene Families	AT1G14730	52.8	1.5e-64	243.0
Cec01g0787	.	9	363	Chloroplast and Mitochondria Gene Families	AT5G14040	81.5	7.3e-170	593.6
Cec05g1439	.	10	364	Chloroplast and Mitochondria Gene Families	AT5G14040	76.0	1.3e-158	556.2
Cec06g2021	.	39	340	Chloroplast and Mitochondria Gene Families	AT5G14040	86.4	1.1e-154	543.1
Cec02g0347	.	11	297	Chloroplast and Mitochondria Gene Families	AT5G14040	52.1	8.9e-83	304.3
Cec01g0787	.	8	363	Chloroplast and Mitochondria Gene Families	AT3G48850	71.5	2.5e-146	515.4
Cec05g1439	.	11	363	Chloroplast and Mitochondria Gene Families	AT3G48850	72.0	1.0e-144	510.0
Cec06g2021	.	10	340	Chloroplast and Mitochondria Gene Families	AT3G48850	68.7	5.3e-141	497.7
Cec02g0347	.	11	297	Chloroplast and Mitochondria Gene Families	AT3G48850	50.5	6.0e-84	308.1
Cec02g0347	.	14	308	Chloroplast and Mitochondria Gene Families	AT2G17270	76.9	1.3e-132	469.5
Cec05g1439	.	64	362	Chloroplast and Mitochondria Gene Families	AT2G17270	52.5	3.4e-88	322.0
Cec01g0787	.	62	352	Chloroplast and Mitochondria Gene Families	AT2G17270	52.6	4.6e-85	311.6
Cec11g0505	.	71	374	Chloroplast and Mitochondria Gene Families	AT5G15640	76.5	3.3e-131	464.9
Cec05g0805	.	17	320	Chloroplast and Mitochondria Gene Families	AT5G15640	50.7	1.6e-80	296.6
Cec05g1996	.	122	455	Chloroplast and Mitochondria Gene Families	AT5G26200	66.5	5.6e-124	441.0
Cec09g0081	.	1	344	Chloroplast and Mitochondria Gene Families	AT5G26200	57.8	6.4e-104	374.4
Cec09g0081	.	1	348	Chloroplast and Mitochondria Gene Families	AT1G72820	76.1	9.6e-148	520.0
Cec05g1996	.	111	456	Chloroplast and Mitochondria Gene Families	AT1G72820	69.1	1.6e-131	466.1
Cec01g0233	.	83	285	Chloroplast and Mitochondria Gene Families	AT5G52570	51.7	3.1e-49	192.2
Cec05g1000	.	1	219	Chloroplast and Mitochondria Gene Families	AT4G25700	63.2	1.2e-69	260.0
Cec01g0233	.	69	204	Chloroplast and Mitochondria Gene Families	AT4G25700	72.1	1.4e-54	209.9
Cec02g0156	.	148	326	Chloroplast and Mitochondria Gene Families	AT4G03320	52.2	8.3e-57	217.6
Cec10g0629	.	72	364	Chloroplast and Mitochondria Gene Families	AT5G54290	77.6	6.2e-118	421.0
Cec06g1482	.	53	543	Chloroplast and Mitochondria Gene Families	AT2G18710	85.2	2.1e-237	818.5

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0001922	1	2	3	2	2	2	4	2	2	2	2	2	3	2	2	4	2	2	4	2	2	2	2	2	2	2	1	2	3	1	66