Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Cec09g2128 ATGGAACCTAGACAGTGTACAGCTAGTGTTCTTGAAGCATTGATGGGCTTTGATGAGCGGCAATCTCAGCACCATGCTTCAAGACATTCTAAAGTTCTTTCTGACGATTATTTACAAATGGTTGCATCCATTGGAAACTCGAAGAAAAAATCCTCCTCCAGATGTCATCCATTTAGGACGATGGTCAAAGAGCCAGCAGAACTCTTCACTTCTCTCAAAGTAGAAAATAACTTTAGCCGCTGCAACAAGTTATGGGAATGGGAGAAGACGGATTCTACTTTATCAGCAGCATATATGCCACTTACAAGACACACCATCATGAATGAAAAGCACTTTTCAACAGGTAAGGTGATACAGACTTCAAAGGATTTTCAAGATTTACCAGAGGTTCTTGATTCTATGGACATCTCACCAAGACCTACAAGAGGAAAAAATTATATATTCAACCAGGCTGAAAATGGACCGAGTGTTTCTAAAGCACATTATAATTTGACAGAAGGAAATAATGATACAGGCACTAAATTTAAGGACAGGGAACAAGGGCAGGCACACTCGTCAGAGGATCTAGATTTTTTGAAGTCTTCAAGACCTTTTTTAGAGTGGAAAGATAAACTATGTTTTCCTTCCCCTTCACCAACTTATTTAAAAGACTCACGTTTAGTTAATGATAAATGCAAAGTTTGGCATAGTTTTCGAAATGGAAAGCATATTGCTAAAGAAAAAGAAAGGACAATGGAGCATGCACTGCAGCCCATCAAGCAACCATCTCAAGTTTCAAGTATTCTGGATGGAAGTAGGAGAACAACGAGGCATGATTTTGTTAATTTGCATTTGAAGACCTCAAGATCAGAAATCACATCTGATGATGTGCGCAGAAAAGAAACCAATTACAAAAGGAATTCTTCCTCTGGTTTATCTAATTGGACACCGGAATACCATTCCTGCTTCTTTTCAGTTGAGTCATACAAGACCAGAGAATCCAGGGAGAAAGTAATAGAAGAAGAAAGGAAGACTGAGAACTTGATGCTATCTACAGGAGATAGGAAAATGAATGAAATGCCTACACTGCCTCATTATGCAATTTTGCCCAGCGATTTGAATTGCAAACCTGTCAATTATGATTTACAGAAGCATGCTTGTTCTTATAAGGAACATTTGCATTCTGGCAATCCCTTGTGCTTGAGCTGGAAGGCTAAGAGACTAGATCAACTCAGTAAAAACTCCCATAGATTGAGATTTGATTCTACTTCTGCGGCGACTACAAGATCTAGAACCAGGAGCAGATACGAGGCCCTTCGAAATACATGGTTCTTAAAGCATGAAGGTCCTGGTACTTGGCTACAATGCAAGCCATCAAATAGAAGTTCCAATAAAAAGGATGCTTCAGAACCTACCTTGAAATTAAGCTCTAAGAAATTGAAGATTTTTCCTTGCCCTGATTCAGCGAGCGATCATGTTGACAACGATGGCTGTATGGTTGGTGATGATCTGAAGACCACAGTTGAGAAGAAAGACCTTTGTGATCAGCATTCTTTGAACTCTCTATCACCAAGGAGCAAAGTTGTTTTCTGCACACAAAACAGTCCCGTCAAACGAGAAAATCGAGCCATAGAGCATACTTTGAAGAGAGATTATCGAGATGATAAATTTTCAGAGACTGGCGGTGATTCATCTACCAACTCTTGCCGTGCTATGTTTACTTCTATTCAACAGGAAGGTCTTGCCTTTGAAGACTACCCTAGCAAAGAGCAAGATTCTATTGTGAGTTTGGAGGAGGCTTATCAACCTAGCCCAGTTTCGGTCCTTGAACCACTTTTTAAAGAAGAAACATCATTCAGTTCTGAATCCTCGGGCATCAACAGTAGAGATTTAGTGATGCAACTTGAACTTCTGATGTCGGATTCCCCTGGAACTAACTCAGAAGGACATGATTTGTTCGTATCAAGTGACGACGATGGTGGAGAAGGATCTATATGCAGTTCTGATGAAATTAATGACATTATGAGCACATTCAAATTCAAAGATAGTAGAGATTTTTCATACCTTGTTGATGTATTGAGCGAGGCAAGCTTACATTGTAAAAACCTGGAGACGGTTTCTGTTTCGTGGCACGGTCAGGAACATCACGTGATCAGCCCTGCAGTCTTTGGAATCTTAGAGAAGAAGTTTGGGGAACAAATTTCTTGGAGAAGATCAGAAAGAAAACTTCTCTTTGACAGAATAAATTCTGGGTTAGTAGAACTCCTTCAATCATTTGTTGGTGTGCCAGAATGGGCAAAGCCTGTATCGAGAAGATTTCGGCCATTGCTTAACCACGAAATGATCGAGGAAGAACTATGGATCCTGCTGGATAGCCAAGAAAGGGAAATGAAGAAGGATTTAGTAGATAAGCAGTTTGGAAAGGAGATTGGATGGATAGATCTTGGAGAAGAGATTGATTCTATTTGTAGAGAACTAGAGAGATTGTTGGGTTTCGCCGAGGGCGGCGCAGAGTCGAAGAGCACGCCAGAAGAAATGGCGAGGATCAAGGTTCATGAGTTGAGGCAGAAATCGAAGGCGGATCTGTTGTTGCAGCTTAAGGATCTTAAGGCGGAGCTTGCTCTCCTTCGAGTCGCCAAAGTCACCGGTGGTGCCCCGAACAAGCTATCCAAAATCAAGGTAGTGAGATTGTCGATCGCTCAAGTTTTGACAGTAATTTCTCAGAAGCAGAAGGCGGCGTTGAGGGAAGCTTACAAGAAGAAGAAGCTTTTGCCTCTCGATCTTCGCCCCAAGAAGACCAGGGCCATTCGTAGAAGGCTCACCAAGCACCAGGCTTCTTTGAAGACCGAGAGAGAGAAGAAGAAAGAAATGTACTTTCCATTGAGGAAATATGCTATTAAGATTGATTATCAAACTAATCAAAACTGGATCACCATATCCAACCGGATGAATTCCTTGTGTGAAGAGGAAAGTTTCTCATTTTGTGGAATAATGCTTTGGAAATTGGAGGAGGTGAATTCTCGAGTTCTTGTTGCCTCTCGTTTGAAGATGGGTAGTTCTTCAGCTCAAGTGGTAGTGGATGGCGATGGAGATTTAGAGAAGGGGATTTTGAGTTTATCATCGAATCAAAACCCTCTGGCTGAGCTATCGCCGACGCCGTCTCCGTCGTCGACTGCGACGGCTCCGGCTCTGGTCCTATCCAATTCAGGGAAACGGATGGACCAAGCGGGGAAAAAGAAGTACGTGAAGCAAGTAACTGGACGGCACAACGACACTGAGCTTCATCTGGCGGCGCAACGGGGAGATCTAGCCGCCGTGAAGCAGATTCTTGATGATATTGATTCACAGATGGTGCGAAATCTCAGTGGCGCCGATTTCGATGCGGAAGTTGCTGAGGTCCGATCGTTAGTAGTGAACGAGGTCAACGAATTGGGGGAAACGGCTCTGTTCACCGCCGCAGAAAGAGGACACATAGAAGTCGTTAAGGAGCTATTGAAGTATTCCAATAAAGCGACACTTACGACGAAGAACAGATCTAATTTTGATCCGTTGCATATAGCTGCAAGTCAAGGACACCATGCTATTGTTCAGGTGCTTCTTGAACATGAACCTTCTCTAAGCAAAACATTTGGACCGTCGAATGCGACTCCACTCATTACTGCTGCAGCAAGGGGCCATACGGCCGTAGTTGAGGAATTGCTTAACAAAGATCGTAGCCTGCTTGAGATTTGTAGATCTAATGGTAAAAATGCATTGCATTTTGCTGTGCGCCCTGGCCATACTGAAATTGTAAAGCTATTACTCAGCAAAGATCAACAGCTAGCACGAAGAAATGATAAGAAGGGCCAAACTGCACTGCACATGGCTGTCAAAGGGCAGAGTTGTGATGTCGTGAAGTTGCTCCTTGATGCAGATCCTGCCATTGTTATGCTTCCTGATAAATTCGGTAACACTGCACTGCACGTTGCCACGAGGAAAAAGCGAGTGGAGATAGTGCAGGAGCTATTGCTCCTCCCAGATACCAATGTGAATGCATTATCCAGAGACCACAAAACTGCTTTTGACATAGCTGAGGAGCTTCCTCTTTCAGAAGAATCATCAGAAATTAAGGACTGTCTTGCCCGTTACGGTGCTGTCAGAGCCAACGAACTGAACCAACCAAGAGACGAGTTGCGGAACACAGTGACTCAAATTAAGAAAGATGTTCATACCCAGCTTGAACAAACCAGAAAAACAAACAAAAATGTACATAACATCTCTAAAGAGCTCAGAAAGCTGCACAGGGAAGGAATCAACAATGCGACCAATTCGGTCACGGTGGTGGCTGTACTTTTTGCAACCGTTGCTTTTGCAGCCATTTTTACAGTACCTGGTGGCGACACGGATCAAGGAACAGCCGTTGTTGTGGGCACTAGTTCTTTCAAAATCTTCTTCATCTTCAATGCAATCGCATTGTTTACGTCGTTGGCAGTCGTGGTGGTGCAGATTACATTAGTTAGAGGTGAAACGAAAGCTGAAAGACGAGTGGTGGAGATCATAAATAAACTCATGTGGCTGGCTTCTGTTTGTACTTCTGTGGCATTCATGGCGTCGTCTTACATCGTGGTTGGCCGTAAGTACGAATGGGCTGCAATTGTGATCACAGTGGTTGGAGGTGTGATTATGGCTGGTGTTCTTGGTACAATGACTTACTATGTTGTGAAATCTAAGAGAAGTCGATCCATAAGGAAGAAGGAAAAGAGTAATAGAAGAAGTGGCTCAAACTCATGGCATCACTCTGACTTTTCAAATTCAGAAGTTGATCGAATTTATGCTCTTTAG 4800 42.9 MEPRQCTASVLEALMGFDERQSQHHASRHSKVLSDDYLQMVASIGNSKKKSSSRCHPFRTMVKEPAELFTSLKVENNFSRCNKLWEWEKTDSTLSAAYMPLTRHTIMNEKHFSTGKVIQTSKDFQDLPEVLDSMDISPRPTRGKNYIFNQAENGPSVSKAHYNLTEGNNDTGTKFKDREQGQAHSSEDLDFLKSSRPFLEWKDKLCFPSPSPTYLKDSRLVNDKCKVWHSFRNGKHIAKEKERTMEHALQPIKQPSQVSSILDGSRRTTRHDFVNLHLKTSRSEITSDDVRRKETNYKRNSSSGLSNWTPEYHSCFFSVESYKTRESREKVIEEERKTENLMLSTGDRKMNEMPTLPHYAILPSDLNCKPVNYDLQKHACSYKEHLHSGNPLCLSWKAKRLDQLSKNSHRLRFDSTSAATTRSRTRSRYEALRNTWFLKHEGPGTWLQCKPSNRSSNKKDASEPTLKLSSKKLKIFPCPDSASDHVDNDGCMVGDDLKTTVEKKDLCDQHSLNSLSPRSKVVFCTQNSPVKRENRAIEHTLKRDYRDDKFSETGGDSSTNSCRAMFTSIQQEGLAFEDYPSKEQDSIVSLEEAYQPSPVSVLEPLFKEETSFSSESSGINSRDLVMQLELLMSDSPGTNSEGHDLFVSSDDDGGEGSICSSDEINDIMSTFKFKDSRDFSYLVDVLSEASLHCKNLETVSVSWHGQEHHVISPAVFGILEKKFGEQISWRRSERKLLFDRINSGLVELLQSFVGVPEWAKPVSRRFRPLLNHEMIEEELWILLDSQEREMKKDLVDKQFGKEIGWIDLGEEIDSICRELERLLGFAEGGAESKSTPEEMARIKVHELRQKSKADLLLQLKDLKAELALLRVAKVTGGAPNKLSKIKVVRLSIAQVLTVISQKQKAALREAYKKKKLLPLDLRPKKTRAIRRRLTKHQASLKTEREKKKEMYFPLRKYAIKIDYQTNQNWITISNRMNSLCEEESFSFCGIMLWKLEEVNSRVLVASRLKMGSSSAQVVVDGDGDLEKGILSLSSNQNPLAELSPTPSPSSTATAPALVLSNSGKRMDQAGKKKYVKQVTGRHNDTELHLAAQRGDLAAVKQILDDIDSQMVRNLSGADFDAEVAEVRSLVVNEVNELGETALFTAAERGHIEVVKELLKYSNKATLTTKNRSNFDPLHIAASQGHHAIVQVLLEHEPSLSKTFGPSNATPLITAAARGHTAVVEELLNKDRSLLEICRSNGKNALHFAVRPGHTEIVKLLLSKDQQLARRNDKKGQTALHMAVKGQSCDVVKLLLDADPAIVMLPDKFGNTALHVATRKKRVEIVQELLLLPDTNVNALSRDHKTAFDIAEELPLSEESSEIKDCLARYGAVRANELNQPRDELRNTVTQIKKDVHTQLEQTRKTNKNVHNISKELRKLHREGINNATNSVTVVAVLFATVAFAAIFTVPGGDTDQGTAVVVGTSSFKIFFIFNAIALFTSLAVVVVQITLVRGETKAERRVVEIINKLMWLASVCTSVAFMASSYIVVGRKYEWAAIVITVVGGVIMAGVLGTMTYYVVKSKRSRSIRKKEKSNRRSGSNSWHHSDFSNSEVDRIYAL 1599
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
9 38257928 38270420 + CePI673135_09g021280.1 Cec09g2128 212638

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Cec09g2128 1599 Gene3D - 1061 1199 IPR036770 -
Cec09g2128 1599 FunFam 60S ribosomal protein L35 916 961 - -
Cec09g2128 1599 Pfam Domain of unknown function 1422 1528 IPR026961 -
Cec09g2128 1599 FunFam Ankyrin repeat-containing protein ITN1 1233 1353 - -
Cec09g2128 1599 Gene3D - 839 915 IPR036049 GO:0003735(InterPro)|GO:0005840(InterPro)|GO:0006412(InterPro)
Cec09g2128 1599 Pfam Ankyrin repeats (3 copies) 1207 1267 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 Pfam Ankyrin repeats (3 copies) 1087 1198 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 Pfam Ankyrin repeats (3 copies) 1270 1337 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 Gene3D - 1314 1367 IPR036770 -
Cec09g2128 1599 ProSiteProfiles Ankyrin repeat profile. 1240 1272 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 NCBIfam 50S ribosomal protein L29 846 902 IPR001854 GO:0003735(InterPro)|GO:0005840(InterPro)|GO:0006412(InterPro)
Cec09g2128 1599 CDD Ribosomal_L29_HIP 846 902 IPR001854 GO:0003735(InterPro)|GO:0005840(InterPro)|GO:0006412(InterPro)
Cec09g2128 1599 SUPERFAMILY Ribosomal protein L29 (L29p) 842 903 IPR036049 GO:0003735(InterPro)|GO:0005840(InterPro)|GO:0006412(InterPro)
Cec09g2128 1599 SUPERFAMILY Ankyrin repeat 1087 1354 IPR036770 -
Cec09g2128 1599 ProSiteProfiles Ankyrin repeat region circular profile. 1274 1296 - -
Cec09g2128 1599 PANTHER PROTEIN PHOSPHATASE 1 REGULATORY SUBUNIT 1062 1586 - GO:0005886(PANTHER)
Cec09g2128 1599 SMART ANK_2a 1082 1111 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 SMART ANK_2a 1274 1303 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 SMART ANK_2a 1172 1201 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 SMART ANK_2a 1308 1338 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 SMART ANK_2a 1240 1269 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 SMART ANK_2a 1137 1166 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 SMART ANK_2a 1206 1235 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 ProSiteProfiles Ankyrin repeat region circular profile. 1308 1329 - -
Cec09g2128 1599 MobiDBLite consensus disorder prediction 171 187 - -
Cec09g2128 1599 Gene3D - 916 960 - -
Cec09g2128 1599 FunFam Ankyrin repeat-containing protein ITN1 1056 1198 - -
Cec09g2128 1599 Hamap Large ribosomal subunit protein uL29 [rpmC]. 842 902 IPR001854 GO:0003735(InterPro)|GO:0005840(InterPro)|GO:0006412(InterPro)
Cec09g2128 1599 MobiDBLite consensus disorder prediction 165 187 - -
Cec09g2128 1599 ProSiteProfiles Ankyrin repeat profile. 1172 1195 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 ProSiteProfiles Ankyrin repeat profile. 1308 1341 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 ProSiteProfiles Ankyrin repeat profile. 1274 1296 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 ProSiteProfiles Ankyrin repeat region circular profile. 1172 1195 - -
Cec09g2128 1599 FunFam 60S ribosomal protein L35 839 915 - -
Cec09g2128 1599 ProSiteProfiles Ankyrin repeat region circular profile. 1240 1263 - -
Cec09g2128 1599 ProSiteProfiles Ankyrin repeat profile. 1137 1169 IPR002110 GO:0005515(InterPro)
Cec09g2128 1599 Pfam Ribosomal L29 protein 846 902 IPR001854 GO:0003735(InterPro)|GO:0005840(InterPro)|GO:0006412(InterPro)
Cec09g2128 1599 Pfam Domain of unknown function (DUF4378) 678 823 IPR025486 -
Cec09g2128 1599 Gene3D - 1203 1313 IPR036770 -
Cec09g2128 1599 ProSiteProfiles Ankyrin repeat region circular profile. 1137 1159 - -
Cec09g2128 1599 Coils Coil 852 872 - -
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cec09g2128 - - - - 0.0
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cec04g0994 Cec-Chr4:29590337 Cec09g2128 Cec-Chr9:38257928 1.00E-157 dispersed
Cec06g1333 Cec-Chr6:26692094 Cec09g2128 Cec-Chr9:38257928 1.20E-161 dispersed
Cec09g1517 Cec-Chr9:25309000 Cec09g2128 Cec-Chr9:38257928 2.60E-49 dispersed
Cec01g0660 Cec-Chr1:7196822 Cec09g2128 Cec-Chr9:38257928 9.70E-51 transposed
Cec02g1428 Cec-Chr2:31525596 Cec09g2128 Cec-Chr9:38257928 6.40E-55 transposed
Cec07g1442 Cec-Chr7:30002482 Cec09g2128 Cec-Chr9:38257928 1.50E-13 transposed
Cec09g0182 Cec-Chr9:1632148 Cec09g2128 Cec-Chr9:38257928 2.80E-17 transposed
Cec02g2164 Cec-Chr2:39096814 Cec09g2128 Cec-Chr9:38257928 5.70E-54 wgd
Cec04g0990 Cec-Chr4:29557144 Cec09g2128 Cec-Chr9:38257928 4.10E-23 wgd
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cec09g0554 . 1 210 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 83.8 5.5e-90 327.4
Cec10g1128 . 1 209 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 84.2 5.5e-90 327.4
Cec06g1626 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 68.7 1.1e-58 223.4
Cec10g1128 . 1 209 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 85.7 1.9e-90 328.9
Cec09g0554 . 1 212 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 84.0 4.6e-89 324.3
Cec06g1626 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 71.7 1.0e-59 226.9
Cec09g0554 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 89.7 2.5e-90 328.6
Cec10g1128 . 1 196 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 89.8 5.6e-90 327.4
Cec06g1626 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 71.7 1.8e-59 226.1
Cec07g1558 . 9 307 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 71.0 9.0e-115 410.2
Cec07g0998 . 66 343 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 74.6 6.5e-113 404.1
Cec07g1558 . 4 251 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 81.1 9.5e-114 406.8
Cec07g0998 . 62 343 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 72.7 2.0e-111 399.1
Cec04g0433 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G58380 88.0 8.7e-115 410.2
Cec10g1682 . 34 258 Cytoplasmic Ribosomal Protein Gene Family AT1G58380 88.0 8.7e-115 410.2
Cec04g0433 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G59359 88.0 8.7e-115 410.2
Cec10g1682 . 34 258 Cytoplasmic Ribosomal Protein Gene Family AT1G59359 88.0 8.7e-115 410.2
Cec10g1682 . 1 267 Cytoplasmic Ribosomal Protein Gene Family AT2G41840 82.7 6.1e-116 414.1
Cec04g0433 . 36 259 Cytoplasmic Ribosomal Protein Gene Family AT2G41840 88.4 1.5e-114 409.5
Cec04g0433 . 37 260 Cytoplasmic Ribosomal Protein Gene Family AT3G57490 89.8 1.5e-116 416.0
Cec10g1682 . 34 257 Cytoplasmic Ribosomal Protein Gene Family AT3G57490 89.8 1.5e-116 416.0
Cec04g0433 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G58684 88.0 8.7e-115 410.2
Cec10g1682 . 34 258 Cytoplasmic Ribosomal Protein Gene Family AT1G58684 88.0 8.7e-115 410.2
Cec04g0433 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G58983 88.0 8.7e-115 410.2
Cec10g1682 . 34 258 Cytoplasmic Ribosomal Protein Gene Family AT1G58983 88.0 8.7e-115 410.2
Cec09g0090 . 1 232 Cytoplasmic Ribosomal Protein Gene Family AT2G31610 87.1 3.0e-111 398.3
Cec11g0163 . 626 841 Cytoplasmic Ribosomal Protein Gene Family AT2G31610 91.7 1.5e-110 396.0
Cec09g0090 . 1 225 Cytoplasmic Ribosomal Protein Gene Family AT3G53870 90.2 1.0e-111 399.8
Cec11g0163 . 626 844 Cytoplasmic Ribosomal Protein Gene Family AT3G53870 92.2 1.0e-111 399.8
Cec09g0090 . 1 226 Cytoplasmic Ribosomal Protein Gene Family AT5G35530 89.8 2.5e-113 405.2
Cec11g0163 . 626 861 Cytoplasmic Ribosomal Protein Gene Family AT5G35530 87.3 2.7e-112 401.7
Cec05g0579 . 1 261 Cytoplasmic Ribosomal Protein Gene Family AT3G04840 85.9 1.8e-127 452.2
Cec06g0644 . 1 260 Cytoplasmic Ribosomal Protein Gene Family AT3G04840 84.7 1.9e-124 442.2
Cec05g0579 . 1 261 Cytoplasmic Ribosomal Protein Gene Family AT4G34670 86.3 2.4e-127 451.8
Cec06g0644 . 1 260 Cytoplasmic Ribosomal Protein Gene Family AT4G34670 85.1 2.5e-124 441.8
Cec07g0511 . 82 262 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 91.7 2.6e-96 348.2
Cec07g0518 . 57 237 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 91.7 2.6e-96 348.2
Cec09g1037 . 1 181 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 91.2 2.6e-96 348.2
Cec09g1038 . 1 181 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 90.6 4.5e-96 347.4
Cec07g0511 . 100 342 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 93.0 3.0e-132 468.0
Cec07g0518 . 75 317 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 93.0 3.0e-132 468.0
Cec09g1037 . 19 261 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 92.6 3.0e-132 468.0
Cec09g1038 . 19 261 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 92.2 5.2e-132 467.2
Cec07g0511 . 82 342 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 93.5 1.8e-143 505.4
Cec07g0518 . 57 317 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 93.5 1.8e-143 505.4
Cec09g1037 . 1 261 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 93.1 1.8e-143 505.4
Cec09g1038 . 1 261 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 92.7 3.1e-143 504.6
Cec11g0118 . 81 286 Cytoplasmic Ribosomal Protein Gene Family AT2G37270 88.4 4.9e-99 357.5
Cec09g1606 . 2 207 Cytoplasmic Ribosomal Protein Gene Family AT2G37270 87.9 6.4e-99 357.1
Cec09g1608 . 2 207 Cytoplasmic Ribosomal Protein Gene Family AT2G37270 87.9 6.4e-99 357.1
Cec11g0118 . 81 286 Cytoplasmic Ribosomal Protein Gene Family AT3G11940 88.4 4.1e-98 354.4
Cec09g1606 . 2 207 Cytoplasmic Ribosomal Protein Gene Family AT3G11940 87.9 5.4e-98 354.0
Cec09g1608 . 2 207 Cytoplasmic Ribosomal Protein Gene Family AT3G11940 87.9 5.4e-98 354.0
Cec08g1148 . 63 249 Cytoplasmic Ribosomal Protein Gene Family AT4G31700 88.8 1.4e-84 309.3
Cec05g0052 . 63 249 Cytoplasmic Ribosomal Protein Gene Family AT4G31700 87.8 4.0e-84 307.8
Cec08g1148 . 1 249 Cytoplasmic Ribosomal Protein Gene Family AT5G10360 71.9 5.7e-89 323.9
Cec05g0052 . 1 249 Cytoplasmic Ribosomal Protein Gene Family AT5G10360 71.5 7.5e-89 323.6
Cec06g1675 . 1 191 Cytoplasmic Ribosomal Protein Gene Family AT1G48830 81.2 4.9e-85 310.8
Cec01g1651 . 12 202 Cytoplasmic Ribosomal Protein Gene Family AT1G48830 79.1 5.9e-83 303.9
Cec06g1675 . 1 191 Cytoplasmic Ribosomal Protein Gene Family AT3G02560 79.1 1.2e-83 306.2
Cec01g1651 . 12 202 Cytoplasmic Ribosomal Protein Gene Family AT3G02560 79.1 1.5e-81 299.3
Cec06g1675 . 1 188 Cytoplasmic Ribosomal Protein Gene Family AT5G16130 78.7 1.5e-81 299.3
Cec01g1651 . 12 199 Cytoplasmic Ribosomal Protein Gene Family AT5G16130 80.3 1.2e-80 296.2
Cec08g0610 . 1 217 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 86.0 4.2e-96 347.8
Cec11g1251 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 82.8 7.1e-96 347.1
Cec07g1685 . 1 203 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 72.7 6.9e-83 303.9
Cec11g1251 . 1 219 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 84.0 2.2e-99 358.6
Cec08g0610 . 1 220 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 83.6 1.9e-98 355.5
Cec07g1685 . 1 203 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 79.4 4.8e-86 314.3
Cec05g2672 . 1 137 Cytoplasmic Ribosomal Protein Gene Family AT5G15200 91.2 8.3e-67 250.0
Cec08g0150 . 1 137 Cytoplasmic Ribosomal Protein Gene Family AT5G15200 91.2 8.3e-67 250.0
Cec05g2672 . 1 197 Cytoplasmic Ribosomal Protein Gene Family AT5G39850 90.9 4.2e-100 360.9
Cec08g0150 . 1 197 Cytoplasmic Ribosomal Protein Gene Family AT5G39850 90.9 4.2e-100 360.9
Cec01g0231 . 1 176 Cytoplasmic Ribosomal Protein Gene Family AT4G25740 63.6 9.1e-55 209.9
Cec07g0875 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT4G25740 65.9 3.5e-54 208.0
Cec01g0231 . 46 158 Cytoplasmic Ribosomal Protein Gene Family AT5G41520 73.5 1.3e-39 159.5
Cec01g0231 . 1 128 Cytoplasmic Ribosomal Protein Gene Family AT5G52650 83.7 4.7e-58 221.1
Cec07g0875 . 1 127 Cytoplasmic Ribosomal Protein Gene Family AT5G52650 75.8 4.4e-48 188.0
Cec02g0349 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT3G48930 90.6 5.5e-82 300.4
Cec08g1390 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT3G48930 90.0 1.2e-81 299.3
Cec08g1390 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT4G30800 89.9 1.3e-80 295.8
Cec02g0349 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT4G30800 89.3 2.3e-80 295.0
Cec02g0349 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT5G23740 90.6 7.1e-82 300.1
Cec08g1390 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT5G23740 90.6 1.2e-81 299.3
Cec11g0392 . 1 137 Cytoplasmic Ribosomal Protein Gene Family AT1G15930 72.9 2.7e-51 198.4
Cec09g0326 . 137 258 Cytoplasmic Ribosomal Protein Gene Family AT1G15930 76.2 3.2e-49 191.4
Cec11g0392 . 1 137 Cytoplasmic Ribosomal Protein Gene Family AT2G32060 71.4 2.7e-51 198.4
Cec09g0326 . 133 258 Cytoplasmic Ribosomal Protein Gene Family AT2G32060 75.4 3.5e-51 198.0
Cec10g0317 . 1 151 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 93.4 1.9e-76 282.0
Cec06g0048 . 1 151 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 94.0 2.5e-76 281.6
Cec01g0362 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 91.4 1.7e-69 258.8
Cec06g0048 . 1 151 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 94.7 1.1e-76 282.7
Cec10g0317 . 1 151 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 93.4 1.9e-76 282.0
Cec01g0362 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 92.1 7.8e-70 260.0
Cec03g0706 . 550 698 Cytoplasmic Ribosomal Protein Gene Family AT2G36160 92.6 8.0e-75 276.6
Cec10g1895 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT2G36160 91.6 3.1e-71 264.6
Cec10g1894 . 315 456 Cytoplasmic Ribosomal Protein Gene Family AT2G36160 91.5 1.2e-70 262.7
Cec03g0706 . 550 698 Cytoplasmic Ribosomal Protein Gene Family AT3G11510 94.0 1.2e-75 279.3
Cec10g1895 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT3G11510 93.0 4.8e-72 267.3
Cec10g1894 . 315 456 Cytoplasmic Ribosomal Protein Gene Family AT3G11510 93.0 1.8e-71 265.4
Cec03g0706 . 550 698 Cytoplasmic Ribosomal Protein Gene Family AT3G52580 91.9 1.4e-74 275.8
Cec10g1895 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT3G52580 92.3 1.1e-71 266.2
Cec10g1894 . 315 456 Cytoplasmic Ribosomal Protein Gene Family AT3G52580 92.3 4.1e-71 264.2
Cec05g0541 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT1G04270 90.8 3.4e-73 271.2
Cec06g0685 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT1G04270 89.5 6.4e-72 266.9
Cec05g0541 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT5G09490 82.4 2.8e-67 251.5
Cec06g0685 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT5G09490 81.7 3.1e-66 248.1
Cec05g0541 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT5G09500 88.2 1.3e-69 259.2
Cec06g0685 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT5G09500 85.6 3.6e-67 251.1
Cec05g0541 . 36 153 Cytoplasmic Ribosomal Protein Gene Family AT5G09510 94.1 3.7e-59 224.2
Cec06g0685 . 36 153 Cytoplasmic Ribosomal Protein Gene Family AT5G09510 94.1 3.7e-59 224.2
Cec05g0541 . 6 153 Cytoplasmic Ribosomal Protein Gene Family AT5G43640 87.2 1.2e-67 252.7
Cec06g0685 . 4 153 Cytoplasmic Ribosomal Protein Gene Family AT5G43640 85.3 5.1e-66 247.3
Cec05g0541 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT5G63070 62.5 7.5e-47 183.7
Cec06g0685 . 16 153 Cytoplasmic Ribosomal Protein Gene Family AT5G63070 65.3 4.1e-45 177.9
Cec03g0193 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT1G07770 96.9 3.9e-70 260.8
Cec09g2112 . 1 100 Cytoplasmic Ribosomal Protein Gene Family AT1G07770 95.0 4.8e-52 200.7
Cec08g0459 . 54 182 Cytoplasmic Ribosomal Protein Gene Family AT2G19720 79.8 2.0e-58 221.9
Cec03g0193 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT2G39590 90.0 3.2e-64 241.1
Cec09g2112 . 1 100 Cytoplasmic Ribosomal Protein Gene Family AT2G39590 89.0 1.9e-48 188.7
Cec03g0193 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT3G46040 96.9 3.9e-70 260.8
Cec09g2112 . 1 100 Cytoplasmic Ribosomal Protein Gene Family AT3G46040 96.0 1.7e-52 202.2
Cec08g0459 . 54 182 Cytoplasmic Ribosomal Protein Gene Family AT4G29430 80.6 1.2e-58 222.6
Cec03g0193 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT5G59850 96.9 3.9e-70 260.8
Cec09g2112 . 1 100 Cytoplasmic Ribosomal Protein Gene Family AT5G59850 95.0 4.8e-52 200.7
Cec02g0637 . 4 145 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 88.0 2.6e-70 261.5
Cec05g1161 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 89.2 9.8e-70 259.6
Cec05g1191 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 89.2 9.8e-70 259.6
Cec02g0637 . 4 145 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 83.8 5.0e-66 247.3
Cec05g1161 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 84.9 1.1e-65 246.1
Cec05g1191 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 84.9 1.1e-65 246.1
Cec02g0637 . 4 114 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 84.7 3.9e-52 201.1
Cec05g1161 . 6 113 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 86.1 1.5e-51 199.1
Cec05g1191 . 6 113 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 86.1 1.5e-51 199.1
Cec08g0867 . 1 141 Cytoplasmic Ribosomal Protein Gene Family AT2G04390 85.9 5.8e-59 223.8
Cec10g1878 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT2G04390 81.6 3.0e-55 211.5
Cec08g0867 . 1 141 Cytoplasmic Ribosomal Protein Gene Family AT2G05220 86.6 9.8e-59 223.0
Cec10g1878 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT2G05220 81.4 5.0e-55 210.7
Cec08g0867 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT3G10610 84.3 1.5e-59 225.7
Cec10g1878 . 1 121 Cytoplasmic Ribosomal Protein Gene Family AT3G10610 88.4 1.6e-53 205.7
Cec08g0867 . 1 141 Cytoplasmic Ribosomal Protein Gene Family AT5G04800 87.3 2.3e-60 228.4
Cec10g1878 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT5G04800 81.6 4.6e-56 214.2
Cec09g1005 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G22780 96.1 4.4e-81 297.4
Cec08g0766 . 1353 1500 Cytoplasmic Ribosomal Protein Gene Family AT1G22780 95.9 4.1e-79 290.8
Cec09g1005 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G34030 96.1 4.4e-81 297.4
Cec08g0766 . 1353 1500 Cytoplasmic Ribosomal Protein Gene Family AT1G34030 95.9 4.1e-79 290.8
Cec09g1005 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT4G09800 96.1 4.4e-81 297.4
Cec08g0766 . 1353 1500 Cytoplasmic Ribosomal Protein Gene Family AT4G09800 95.9 4.1e-79 290.8
Cec11g0486 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT3G02080 84.6 2.1e-69 258.5
Cec09g0669 . 550 692 Cytoplasmic Ribosomal Protein Gene Family AT3G02080 83.2 1.4e-68 255.8
Cec11g0486 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT5G15520 86.3 6.9e-68 253.4
Cec09g0669 . 550 688 Cytoplasmic Ribosomal Protein Gene Family AT5G15520 84.9 4.5e-67 250.8
Cec11g0486 . 1 142 Cytoplasmic Ribosomal Protein Gene Family AT5G61170 85.9 4.8e-69 257.3
Cec09g0669 . 550 691 Cytoplasmic Ribosomal Protein Gene Family AT5G61170 84.5 3.1e-68 254.6
Cec01g0520 . 1 115 Cytoplasmic Ribosomal Protein Gene Family AT3G45030 92.2 7.1e-53 203.4
Cec05g0891 . 30 146 Cytoplasmic Ribosomal Protein Gene Family AT3G45030 88.9 9.3e-53 203.0
Cec05g0891 . 31 146 Cytoplasmic Ribosomal Protein Gene Family AT3G47370 91.4 1.1e-53 206.1
Cec01g0520 . 1 115 Cytoplasmic Ribosomal Protein Gene Family AT3G47370 92.2 1.6e-52 202.2
Cec01g0520 . 1 115 Cytoplasmic Ribosomal Protein Gene Family AT5G62300 92.2 7.1e-53 203.4
Cec05g0891 . 30 146 Cytoplasmic Ribosomal Protein Gene Family AT5G62300 88.9 9.3e-53 203.0
Cec05g0720 . 1 82 Cytoplasmic Ribosomal Protein Gene Family AT3G53890 82.9 9.5e-38 152.5
Cec05g0720 . 1 81 Cytoplasmic Ribosomal Protein Gene Family AT5G27700 87.7 5.1e-39 156.8
Cec06g0518 . 1 81 Cytoplasmic Ribosomal Protein Gene Family AT5G27700 85.2 7.3e-38 152.9
Cec09g2143 . 1 142 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.4 8.6e-71 263.1
Cec02g2197 . 282 422 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.3 2.5e-70 261.5
Cec10g2061 . 663 800 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.2 2.4e-68 255.0
Cec09g2143 . 1 142 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.5 2.4e-73 271.6
Cec02g2197 . 282 422 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.5 7.1e-73 270.0
Cec10g2061 . 663 800 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.4 6.6e-71 263.5
Cec02g1718 . 1 103 Cytoplasmic Ribosomal Protein Gene Family AT3G04920 85.6 4.5e-46 180.6
Cec06g0991 . 36 138 Cytoplasmic Ribosomal Protein Gene Family AT3G04920 84.6 3.8e-45 177.6
Cec06g0991 . 36 165 Cytoplasmic Ribosomal Protein Gene Family AT5G28060 80.8 1.8e-54 208.8
Cec02g1718 . 1 108 Cytoplasmic Ribosomal Protein Gene Family AT5G28060 88.0 2.5e-51 198.4
Cec04g0157 . 27 108 Cytoplasmic Ribosomal Protein Gene Family AT2G21580 92.7 1.6e-37 152.1
Cec04g0157 . 1 107 Cytoplasmic Ribosomal Protein Gene Family AT4G34555 91.6 3.0e-39 157.9
Cec08g0857 . 1 107 Cytoplasmic Ribosomal Protein Gene Family AT4G34555 88.8 1.1e-38 156.0
Cec03g1710 . 1 107 Cytoplasmic Ribosomal Protein Gene Family AT4G34555 86.9 3.6e-37 151.0
Cec07g0566 . 39 162 Cytoplasmic Ribosomal Protein Gene Family AT2G40510 84.7 1.6e-55 212.2
Cec11g0598 . 1 119 Cytoplasmic Ribosomal Protein Gene Family AT2G40510 85.7 8.1e-55 209.9
Cec07g0566 . 39 162 Cytoplasmic Ribosomal Protein Gene Family AT2G40590 84.7 9.5e-56 213.0
Cec11g0598 . 1 125 Cytoplasmic Ribosomal Protein Gene Family AT2G40590 83.2 4.7e-55 210.7
Cec11g0598 . 1 126 Cytoplasmic Ribosomal Protein Gene Family AT3G56340 84.9 2.7e-55 211.5
Cec07g0566 . 39 160 Cytoplasmic Ribosomal Protein Gene Family AT3G56340 85.2 4.7e-55 210.7
Cec01g0798 . 1 84 Cytoplasmic Ribosomal Protein Gene Family AT2G45710 91.7 4.5e-43 170.2
Cec06g0169 . 1 84 Cytoplasmic Ribosomal Protein Gene Family AT2G45710 92.9 5.9e-43 169.9
Cec01g0798 . 1 86 Cytoplasmic Ribosomal Protein Gene Family AT3G61110 95.3 5.9e-46 179.9
Cec06g0169 . 1 86 Cytoplasmic Ribosomal Protein Gene Family AT3G61110 96.5 7.6e-46 179.5
Cec01g0798 . 1 84 Cytoplasmic Ribosomal Protein Gene Family AT5G47930 92.9 1.3e-42 168.7
Cec06g0169 . 1 84 Cytoplasmic Ribosomal Protein Gene Family AT5G47930 91.7 8.5e-42 166.0
Cec05g2774 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT1G23410 83.0 9.2e-66 246.5
Cec08g1849 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G23410 82.9 2.0e-65 245.4
Cec05g2774 . 1 154 Cytoplasmic Ribosomal Protein Gene Family AT3G62250 96.1 4.3e-71 264.2
Cec08g1849 . 1 154 Cytoplasmic Ribosomal Protein Gene Family AT3G62250 95.5 5.6e-71 263.8
Cec07g0461 . 1 291 Cytoplasmic Ribosomal Protein Gene Family AT2G40010 86.3 6.7e-140 493.8
Cec03g0079 . 1 279 Cytoplasmic Ribosomal Protein Gene Family AT2G40010 81.7 2.6e-128 455.3
Cec07g0461 . 3 291 Cytoplasmic Ribosomal Protein Gene Family AT3G09200 76.1 1.9e-117 419.1
Cec03g0079 . 2 279 Cytoplasmic Ribosomal Protein Gene Family AT3G09200 71.2 1.2e-106 383.3
Cec07g0461 . 3 281 Cytoplasmic Ribosomal Protein Gene Family AT3G11250 88.2 8.3e-138 486.9
Cec03g0079 . 2 278 Cytoplasmic Ribosomal Protein Gene Family AT3G11250 81.2 6.0e-128 454.1
Cec08g0019 . 32 418 Cytoplasmic Ribosomal Protein Gene Family AT1G43170 85.8 2.3e-198 688.3
Cec11g1381 . 71 457 Cytoplasmic Ribosomal Protein Gene Family AT1G43170 82.4 2.9e-193 671.4
Cec11g1381 . 71 456 Cytoplasmic Ribosomal Protein Gene Family AT1G61580 86.8 1.6e-199 692.2
Cec08g0019 . 32 420 Cytoplasmic Ribosomal Protein Gene Family AT1G61580 86.7 7.8e-199 689.9
Cec04g1019 . 2 405 Cytoplasmic Ribosomal Protein Gene Family AT3G09630 83.7 2.3e-193 671.8
Cec10g2068 . 1 406 Cytoplasmic Ribosomal Protein Gene Family AT3G09630 83.0 6.7e-193 670.2
Cec10g2068 . 1 406 Cytoplasmic Ribosomal Protein Gene Family AT5G02870 83.3 9.3e-195 676.4
Cec04g1019 . 2 405 Cytoplasmic Ribosomal Protein Gene Family AT5G02870 83.2 8.7e-193 669.8
Cec11g1400 . 1 290 Cytoplasmic Ribosomal Protein Gene Family AT3G25520 81.7 4.7e-135 477.6
Cec08g1046 . 1 301 Cytoplasmic Ribosomal Protein Gene Family AT3G25520 76.7 2.4e-131 465.3
Cec11g1400 . 1 290 Cytoplasmic Ribosomal Protein Gene Family AT5G39740 80.7 5.8e-133 470.7
Cec08g1046 . 1 301 Cytoplasmic Ribosomal Protein Gene Family AT5G39740 77.1 2.4e-131 465.3
Cec10g1267 . 665 894 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 81.7 7.4e-104 373.6
Cec04g0112 . 2 231 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 80.9 1.1e-102 369.8
Cec09g0387 . 2 231 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 82.6 1.1e-102 369.8
Cec10g1267 . 667 894 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 83.3 3.9e-105 377.9
Cec04g0112 . 4 231 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 82.9 1.5e-104 375.9
Cec09g0387 . 7 231 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 84.0 7.0e-102 367.1
Cec10g1267 . 667 894 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 83.3 8.8e-105 376.7
Cec04g0112 . 4 231 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 82.9 3.3e-104 374.8
Cec09g0387 . 6 231 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 84.5 3.7e-103 371.3
Cec09g1308 . 76 267 Cytoplasmic Ribosomal Protein Gene Family AT1G80750 59.9 3.7e-61 231.9
Cec06g1573 . 97 267 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 85.4 5.7e-75 277.3
Cec07g1575 . 4 178 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 81.7 1.8e-73 272.3
Cec09g0160 . 34 208 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 79.4 1.9e-70 262.3
Cec06g1573 . 97 332 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 87.3 1.3e-114 409.5
Cec07g1575 . 4 243 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 82.9 7.1e-113 403.7
Cec09g0160 . 34 273 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 83.3 1.2e-112 402.9
Cec09g1308 . 75 267 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 55.4 7.0e-60 227.6
Cec06g1573 . 97 332 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 89.4 1.9e-118 422.2
Cec07g1575 . 4 243 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 85.0 2.0e-115 412.1
Cec09g0160 . 34 273 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 85.8 2.6e-115 411.8
Cec09g1308 . 75 267 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 55.4 5.8e-59 224.6
Cec05g1578 . 1 257 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 84.0 4.3e-121 431.0
Cec01g0527 . 33 288 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 83.6 1.8e-119 425.6
Cec01g0529 . 1 257 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 83.3 1.8e-119 425.6
Cec05g1578 . 1 257 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 84.4 8.7e-122 433.3
Cec01g0527 . 33 288 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 84.8 4.3e-121 431.0
Cec01g0529 . 1 257 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 84.4 4.3e-121 431.0
Cec04g1718 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT2G18020 93.4 7.6e-142 500.0
Cec05g1667 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT2G18020 91.9 9.3e-140 493.0
Cec04g1718 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT3G51190 84.9 8.2e-128 453.4
Cec05g1667 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT3G51190 83.0 3.8e-125 444.5
Cec04g1718 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT4G36130 93.8 2.8e-144 508.1
Cec05g1667 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT4G36130 91.9 1.3e-141 499.2
Cec01g0089 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33120 85.1 1.7e-90 328.9
Cec01g0088 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33120 84.5 3.9e-90 327.8
Cec01g0089 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33140 85.1 1.7e-90 328.9
Cec01g0088 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33140 84.5 3.9e-90 327.8
Cec01g0088 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G10450 83.7 3.2e-75 278.1
Cec01g0089 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G10450 83.1 4.2e-75 277.7
Cec02g0037 . 38 217 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 58.3 1.2e-52 202.6
Cec11g0578 . 38 217 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 57.8 1.0e-51 199.5
Cec07g1140 . 75 253 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 57.5 8.8e-51 196.4
Cec02g0037 . 38 216 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 87.7 1.1e-91 332.8
Cec11g0578 . 38 216 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 87.2 9.7e-91 329.7
Cec07g1140 . 75 257 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 85.8 1.7e-90 328.9
Cec07g1140 . 38 257 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 86.8 9.2e-112 399.8
Cec02g0037 . 1 220 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 86.4 1.6e-111 399.1
Cec11g0578 . 1 220 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 86.4 4.6e-111 397.5
Cec02g2323 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT1G08360 88.0 8.1e-105 376.7
Cec01g1295 . 1 214 Cytoplasmic Ribosomal Protein Gene Family AT1G08360 86.9 4.9e-102 367.5
Cec02g2323 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT2G27530 87.0 5.8e-103 370.5
Cec01g1295 . 1 214 Cytoplasmic Ribosomal Protein Gene Family AT2G27530 86.0 3.5e-100 361.3
Cec02g2323 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT5G22440 88.5 1.8e-104 375.6
Cec01g1295 . 1 214 Cytoplasmic Ribosomal Protein Gene Family AT5G22440 87.4 2.2e-102 368.6
Cec03g0656 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 96.7 3.6e-98 354.4
Cec04g2090 . 267 447 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 95.0 2.6e-96 348.2
Cec07g0303 . 1 180 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 91.7 1.5e-91 332.4
Cec03g0656 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 96.7 3.6e-98 354.4
Cec04g2090 . 267 447 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 95.0 2.6e-96 348.2
Cec07g0303 . 1 180 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 91.7 1.5e-91 332.4
Cec03g0656 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 96.7 3.6e-98 354.4
Cec04g2090 . 267 447 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 95.0 2.6e-96 348.2
Cec07g0303 . 1 180 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 91.7 1.5e-91 332.4
Cec03g0656 . 1 182 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 96.7 3.6e-98 354.4
Cec04g2090 . 267 447 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 95.0 2.6e-96 348.2
Cec07g0303 . 1 180 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 91.7 1.5e-91 332.4
Cec04g1043 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT2G37190 90.4 2.6e-82 301.6
Cec10g2038 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT2G37190 88.6 6.3e-81 297.0
Cec02g2225 . 1 161 Cytoplasmic Ribosomal Protein Gene Family AT2G37190 90.7 2.7e-79 291.6
Cec04g1043 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G53430 89.8 2.6e-82 301.6
Cec10g2038 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G53430 88.0 6.3e-81 297.0
Cec02g2225 . 1 161 Cytoplasmic Ribosomal Protein Gene Family AT3G53430 90.1 2.7e-79 291.6
Cec04g1043 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT5G60670 89.8 4.4e-82 300.8
Cec10g2038 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT5G60670 88.0 1.1e-80 296.2
Cec02g2225 . 1 161 Cytoplasmic Ribosomal Protein Gene Family AT5G60670 91.9 2.4e-80 295.0
Cec01g0489 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G49010 82.0 1.8e-93 339.0
Cec07g1831 . 22 203 Cytoplasmic Ribosomal Protein Gene Family AT3G49010 78.0 1.1e-74 276.6
Cec01g0489 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G48960 72.8 1.2e-81 299.7
Cec07g1831 . 20 203 Cytoplasmic Ribosomal Protein Gene Family AT3G48960 68.5 3.2e-66 248.4
Cec01g0489 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT5G23900 81.1 5.2e-93 337.4
Cec07g1831 . 22 203 Cytoplasmic Ribosomal Protein Gene Family AT5G23900 76.4 4.2e-74 274.6
Cec06g0809 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G07110 88.9 2.3e-104 375.2
Cec05g0385 . 1 200 Cytoplasmic Ribosomal Protein Gene Family AT3G07110 88.1 9.9e-100 359.8
Cec06g0809 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G24830 90.8 1.6e-105 379.0
Cec05g0385 . 1 200 Cytoplasmic Ribosomal Protein Gene Family AT3G24830 91.0 1.6e-102 369.0
Cec06g0809 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT4G13170 88.8 2.0e-105 378.6
Cec05g0385 . 1 200 Cytoplasmic Ribosomal Protein Gene Family AT4G13170 88.0 2.6e-100 361.7
Cec06g0809 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT5G48760 90.8 1.3e-107 386.0
Cec05g0385 . 1 200 Cytoplasmic Ribosomal Protein Gene Family AT5G48760 91.0 1.6e-102 369.0
Cec05g0483 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT2G20450 84.6 4.8e-55 210.7
Cec05g0484 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT2G20450 83.8 1.1e-54 209.5
Cec06g0734 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT2G20450 82.3 2.4e-54 208.4
Cec05g0484 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT4G27090 84.6 2.8e-55 211.5
Cec06g0734 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT4G27090 83.1 6.3e-55 210.3
Cec05g0483 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT4G27090 83.8 8.2e-55 209.9
Cec07g1796 . 45 248 Cytoplasmic Ribosomal Protein Gene Family AT4G16720 91.2 1.4e-106 382.5
Cec01g0418 . 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G16720 91.2 5.3e-106 380.6
Cec01g0419 . 1 243 Cytoplasmic Ribosomal Protein Gene Family AT4G16720 76.5 3.3e-100 361.3
Cec07g1796 . 45 248 Cytoplasmic Ribosomal Protein Gene Family AT4G17390 91.7 1.7e-107 385.6
Cec01g0418 . 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G17390 91.7 6.3e-107 383.6
Cec01g0419 . 1 243 Cytoplasmic Ribosomal Protein Gene Family AT4G17390 77.0 3.9e-101 364.4
Cec08g1041 . 942 1115 Cytoplasmic Ribosomal Protein Gene Family AT1G27400 89.7 1.2e-85 312.8
Cec11g1431 . 1 183 Cytoplasmic Ribosomal Protein Gene Family AT1G27400 86.3 4.5e-85 310.8
Cec11g1431 . 1 176 Cytoplasmic Ribosomal Protein Gene Family AT1G67430 67.0 1.4e-54 209.1
Cec08g1041 . 942 1117 Cytoplasmic Ribosomal Protein Gene Family AT1G67430 67.0 1.8e-54 208.8
Cec02g1611 . 3 187 Cytoplasmic Ribosomal Protein Gene Family AT2G47570 80.1 3.9e-79 291.2
Cec03g1793 . 178 362 Cytoplasmic Ribosomal Protein Gene Family AT2G47570 77.4 4.7e-77 284.3
Cec02g1611 . 54 187 Cytoplasmic Ribosomal Protein Gene Family AT3G05590 86.6 3.3e-64 241.1
Cec03g1793 . 229 362 Cytoplasmic Ribosomal Protein Gene Family AT3G05590 87.3 2.2e-63 238.4
Cec02g1611 . 54 187 Cytoplasmic Ribosomal Protein Gene Family AT5G27850 85.8 2.8e-63 238.0
Cec03g1793 . 229 362 Cytoplasmic Ribosomal Protein Gene Family AT5G27850 85.1 1.2e-61 232.6
Cec04g2156 . 16 239 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 76.8 1.9e-93 339.0
Cec11g1702 . 30 208 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 90.5 6.1e-92 334.0
Cec03g0709 . 1 178 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 90.4 2.3e-91 332.0
Cec03g0709 . 4 178 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 90.9 4.2e-91 330.9
Cec11g1702 . 34 208 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 90.9 7.2e-91 330.1
Cec04g2156 . 65 239 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 90.9 1.2e-90 329.3
Cec09g0554 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 89.7 2.5e-90 328.6
Cec10g1128 . 1 196 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 89.8 5.6e-90 327.4
Cec06g1626 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 71.7 1.8e-59 226.1
Cec09g0554 . 1 210 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 83.8 5.5e-90 327.4
Cec10g1128 . 1 209 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 84.2 5.5e-90 327.4
Cec06g1626 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 68.7 1.1e-58 223.4
Cec10g1128 . 1 209 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 85.7 1.9e-90 328.9
Cec09g0554 . 1 212 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 84.0 4.6e-89 324.3
Cec06g1626 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 71.7 1.0e-59 226.9
Cec10g1790 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G09590 84.8 7.4e-82 300.1
Cec10g1790 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G09690 84.8 7.4e-82 300.1
Cec10g1790 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G57660 83.5 2.1e-81 298.5
Cec10g1790 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G57860 83.5 2.1e-81 298.5
Cec09g0563 . 1 117 Cytoplasmic Ribosomal Protein Gene Family AT1G02830 73.5 1.5e-42 169.1
Cec09g0563 . 1 126 Cytoplasmic Ribosomal Protein Gene Family AT3G05560 84.1 1.7e-54 208.8
Cec03g1776 . 143 279 Cytoplasmic Ribosomal Protein Gene Family AT3G05560 70.8 1.4e-45 179.1
Cec09g0563 . 1 126 Cytoplasmic Ribosomal Protein Gene Family AT5G27770 82.5 5.4e-53 203.8
Cec03g1776 . 143 279 Cytoplasmic Ribosomal Protein Gene Family AT5G27770 70.8 2.4e-45 178.3
Cec06g0148 . 936 1075 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.6 1.8e-76 282.0
Cec06g0752 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.6 1.8e-76 282.0
Cec07g0166 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.6 1.8e-76 282.0
Cec06g0148 . 951 1075 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 9.3e-69 256.1
Cec06g0752 . 16 140 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 9.3e-69 256.1
Cec07g0166 . 16 140 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 9.3e-69 256.1
Cec06g0148 . 951 1075 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 9.3e-69 256.1
Cec06g0752 . 16 140 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 9.3e-69 256.1
Cec07g0166 . 16 140 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 9.3e-69 256.1
Cec09g2123 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 79.9 4.4e-60 227.6
Cec11g0097 . 991 1143 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 79.9 4.4e-60 227.6
Cec07g0349 . 111 263 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 77.9 3.1e-58 221.5
Cec09g2123 . 4 153 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 86.0 1.8e-63 238.8
Cec11g0097 . 994 1143 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 86.0 2.4e-63 238.4
Cec07g0349 . 114 263 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 84.7 5.9e-62 233.8
Cec10g1969 . 495 656 Cytoplasmic Ribosomal Protein Gene Family AT2G36620 82.1 2.3e-67 251.9
Cec04g1118 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT2G36620 81.1 1.1e-66 249.6
Cec10g1969 . 495 656 Cytoplasmic Ribosomal Protein Gene Family AT3G53020 82.8 2.1e-65 245.4
Cec04g1118 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT3G53020 81.2 4.0e-64 241.1
Cec05g2099 . 1 168 Cytoplasmic Ribosomal Protein Gene Family AT2G44860 69.6 2.6e-60 228.4
Cec10g1949 . 94 242 Cytoplasmic Ribosomal Protein Gene Family AT2G44860 63.1 2.9e-43 171.8
Cec04g1451 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT3G49910 89.0 3.2e-68 254.6
Cec02g1329 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT3G49910 84.2 3.9e-66 247.7
Cec02g1329 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT5G67510 83.6 9.5e-65 243.0
Cec04g1451 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT5G67510 84.2 1.2e-64 242.7
Cec07g1185 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT2G32220 76.3 1.5e-56 215.7
Cec11g1731 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT2G32220 74.1 2.0e-53 205.3
Cec07g1185 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT3G22230 84.4 1.0e-60 229.6
Cec11g1731 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT3G22230 79.3 8.8e-57 216.5
Cec07g1185 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT4G15000 82.9 5.7e-53 203.8
Cec11g1731 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT4G15000 79.7 4.1e-51 197.6
Cec05g2801 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT1G23290 80.8 2.4e-60 228.4
Cec05g2801 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT1G70600 82.2 5.8e-62 233.8
Cec11g0196 . 21 163 Cytoplasmic Ribosomal Protein Gene Family AT2G19730 74.1 1.5e-54 209.1
Cec07g1475 . 828 1023 Cytoplasmic Ribosomal Protein Gene Family AT2G19730 53.6 7.4e-46 180.3
Cec11g0196 . 21 163 Cytoplasmic Ribosomal Protein Gene Family AT4G29410 73.4 8.7e-55 209.9
Cec07g1475 . 828 1023 Cytoplasmic Ribosomal Protein Gene Family AT4G29410 54.1 1.8e-47 185.7
Cec03g1474 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G36240 83.0 1.2e-51 199.1
Cec03g1474 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G77940 83.9 4.2e-52 200.7
Cec03g1474 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT3G18740 80.4 3.9e-50 194.1
Cec03g1645 . 2 120 Cytoplasmic Ribosomal Protein Gene Family AT2G19740 84.9 4.9e-51 197.2
Cec03g1645 . 6 120 Cytoplasmic Ribosomal Protein Gene Family AT4G26230 87.0 3.7e-51 197.6
Cec03g0695 . 1 133 Cytoplasmic Ribosomal Protein Gene Family AT4G18100 87.2 1.8e-62 235.3
Cec04g2131 . 1 133 Cytoplasmic Ribosomal Protein Gene Family AT4G18100 85.7 5.8e-61 230.3
Cec03g0695 . 1 133 Cytoplasmic Ribosomal Protein Gene Family AT5G46430 85.0 9.0e-62 233.0
Cec04g2131 . 1 133 Cytoplasmic Ribosomal Protein Gene Family AT5G46430 83.5 2.9e-60 228.0
Cec09g1877 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 92.4 2.7e-44 174.5
Cec09g1939 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 91.3 3.6e-44 174.1
Cec06g1821 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 88.0 5.7e-42 166.8
Cec09g1877 . 1 119 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 92.4 3.9e-56 214.2
Cec06g1821 . 1 119 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 89.1 8.1e-54 206.5
Cec09g1939 . 1 105 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 94.3 1.4e-50 195.7
Cec09g1877 . 1 120 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 90.8 1.9e-55 211.8
Cec06g1821 . 1 120 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 88.3 1.8e-53 205.3
Cec09g1939 . 1 105 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 92.4 1.2e-49 192.6
Cec09g2128 . 839 961 Cytoplasmic Ribosomal Protein Gene Family AT3G09500 91.1 2.7e-52 201.4
Cec02g1428 . 60 181 Cytoplasmic Ribosomal Protein Gene Family AT3G09500 91.0 1.0e-51 199.5
Cec09g2128 . 839 961 Cytoplasmic Ribosomal Protein Gene Family AT2G39390 91.9 5.4e-53 203.8
Cec02g1428 . 60 181 Cytoplasmic Ribosomal Protein Gene Family AT2G39390 91.0 6.0e-52 200.3
Cec09g2128 . 839 961 Cytoplasmic Ribosomal Protein Gene Family AT3G55170 89.4 2.3e-51 198.4
Cec02g1428 . 60 181 Cytoplasmic Ribosomal Protein Gene Family AT3G55170 90.2 3.9e-51 197.6
Cec09g2128 . 839 961 Cytoplasmic Ribosomal Protein Gene Family AT5G02610 76.7 9.6e-49 189.9
Cec02g1428 . 60 181 Cytoplasmic Ribosomal Protein Gene Family AT5G02610 76.6 4.7e-48 187.6
Cec05g0982 . 19 112 Cytoplasmic Ribosomal Protein Gene Family AT2G37600 87.2 4.1e-39 157.5
Cec01g0448 . 20 110 Cytoplasmic Ribosomal Protein Gene Family AT2G37600 87.9 3.5e-38 154.5
Cec08g0220 . 8 105 Cytoplasmic Ribosomal Protein Gene Family AT2G37600 81.6 7.7e-38 153.3
Cec05g0982 . 12 112 Cytoplasmic Ribosomal Protein Gene Family AT3G53740 83.2 1.8e-39 158.7
Cec08g0220 . 1 106 Cytoplasmic Ribosomal Protein Gene Family AT3G53740 78.3 1.8e-39 158.7
Cec01g0448 . 13 110 Cytoplasmic Ribosomal Protein Gene Family AT3G53740 82.7 5.8e-38 153.7
Cec05g0982 . 19 112 Cytoplasmic Ribosomal Protein Gene Family AT5G02450 86.2 6.6e-39 156.8
Cec08g0220 . 8 106 Cytoplasmic Ribosomal Protein Gene Family AT5G02450 80.8 1.1e-38 156.0
Cec01g0448 . 20 110 Cytoplasmic Ribosomal Protein Gene Family AT5G02450 85.7 2.1e-37 151.8
Cec09g0451 . 1 105 Cytoplasmic Ribosomal Protein Gene Family AT3G23390 93.3 9.3e-54 206.1
Cec10g1205 . 1 105 Cytoplasmic Ribosomal Protein Gene Family AT3G23390 93.3 9.3e-54 206.1
Cec09g0451 . 1 93 Cytoplasmic Ribosomal Protein Gene Family AT4G14320 92.5 8.0e-46 180.3
Cec10g1205 . 1 93 Cytoplasmic Ribosomal Protein Gene Family AT4G14320 92.5 8.0e-46 180.3
Cec09g0208 . 1 94 Cytoplasmic Ribosomal Protein Gene Family AT1G15250 88.3 6.0e-44 173.3
Cec07g1426 . 1 94 Cytoplasmic Ribosomal Protein Gene Family AT1G15250 88.3 1.0e-43 172.6
Cec09g0208 . 1 95 Cytoplasmic Ribosomal Protein Gene Family AT1G52300 89.5 1.1e-45 179.1
Cec07g1426 . 1 95 Cytoplasmic Ribosomal Protein Gene Family AT1G52300 89.5 1.9e-45 178.3
Cec06g0861 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G10950 94.6 2.4e-45 177.9
Cec09g1283 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G10950 93.5 6.9e-45 176.4
Cec05g0346 . 1 85 Cytoplasmic Ribosomal Protein Gene Family AT3G10950 94.1 1.2e-41 165.6
Cec06g0861 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G60245 92.4 6.9e-45 176.4
Cec09g1283 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G60245 91.3 2.0e-44 174.9
Cec05g0346 . 1 85 Cytoplasmic Ribosomal Protein Gene Family AT3G60245 94.1 4.2e-42 167.2
Cec01g0015 . 1 128 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 99.2 6.2e-68 253.4
Cec07g1083 . 1 128 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 99.2 6.2e-68 253.4
Cec10g0548 . 305 381 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 4.3e-37 151.0
Cec03g0477 . 46 122 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 5.6e-37 150.6
Cec04g1926 . 64 140 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 5.6e-37 150.6
Cec05g1643 . 109 185 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 5.6e-37 150.6
Cec02g1954 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 100.0 7.4e-37 150.2
Cec05g2774 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 100.0 7.4e-37 150.2
Cec08g1849 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 100.0 7.4e-37 150.2
Cec01g0015 . 1 128 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 99.2 6.2e-68 253.4
Cec07g1083 . 1 128 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 99.2 6.2e-68 253.4
Cec10g0548 . 305 381 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 4.3e-37 151.0
Cec03g0477 . 46 122 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 5.6e-37 150.6
Cec04g1926 . 64 140 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 5.6e-37 150.6
Cec05g1643 . 109 185 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 5.6e-37 150.6
Cec02g1954 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 100.0 7.4e-37 150.2
Cec05g2774 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 100.0 7.4e-37 150.2
Cec08g1849 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 100.0 7.4e-37 150.2
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0005359 1 5 0 0 0 1 2 1 1 1 1 1 2 1 1 2 1 2 2 1 1 1 1 1 1 1 1 5 1 0 39