Gene search
Sequence information
| Select | Gene | Cds | Cds_length | GC_content | Pep | Pep_length |
|---|---|---|---|---|---|---|
| Cec10g2046 | ATGTTGATCAGGTTGAGAATTTGTGTGTATCTTCAGTGTAAGATTGAGTTATATTTCGGGGACTGGCTAGAGTTTAATAATTTATCCTCTTACGTTTGGAGGGAGAGGAAAGGAAAAGCTCGAGGGACTGATCCGACCAAAATTGAGTTGGGTCGGTTTACGGCATCGCAAAATCGAATATACGTTCATTTGAGTCGGTTTTTCTACTTTGCAAAATTGAACCAGATTGGTGCTGGATATTCACGGAACCACTTTTACTGCCGTACGTCACCGGAAAACCGACCGGGGCGCGGAGGCGAAGAATCAAAGATGAGCGTGATCGACCTTTTGACCAGAGTAGATGCGATTTGCCAGAAGTACGACAAATATGACGTTGAAAAGCAGAGAGATCTCAATGTTTCTGGCGACGATGCCTTCGCTCGACTCTACGCCACTGTCGAAGCTGACATTGAAGCCGCTCTCCAGAAAGCTGAGGATGCTTCTAAAGAGAAGAATAGGGCATCGGTGGTGGCGTTGAATGCGGAGATTCGTCGTACCAAGGCACGATTACTGGAGGAGGTCCCCAAGTTGCAGAGATTGGCTGTAAAGAGGGTTAAAGGGCTATCAACCGAAGATCTTACCACTCGAAATGATCTGGTGCTTGCATTGCCAGAGAGGATTCAAGCTATACCAGATGGAACTGCGACTTCCACGAAGAATAATGGGGGTTGGACATCCTCAGCTTCGCGTGCTGAAATCAAATTTGACTCAGATGGGCGATTCAATGATGAGTACTTCCAACACACTGAGGAGTCAAGTCAGTTCAGGCAAGAGTATGAAATGCGGAAAATGAAGCAGGATCAAGGACTGGACATGATATCAGAAGGGTTAGATACTCTGAAGAACATGGCACATGATATGAATGAGGAAATAGATAGGCAAGTCCCTTTGATGGACGAGATTGACACTAAGGTGGACAAGGCTGCATCTGACCTTAAGAACACCAACGTTAGATTAAAAGACACAGTTAACCAGCTAAGGTCCAGCAGAAATTTCTGTATTGATATCATTCTGTTGTGTATAATCTTGGGGATTGCTGCCTATCTATACAATGTGTTGAAGAAGTGA | 1107 | 44.9 | MLIRLRICVYLQCKIELYFGDWLEFNNLSSYVWRERKGKARGTDPTKIELGRFTASQNRIYVHLSRFFYFAKLNQIGAGYSRNHFYCRTSPENRPGRGGEESKMSVIDLLTRVDAICQKYDKYDVEKQRDLNVSGDDAFARLYATVEADIEAALQKAEDASKEKNRASVVALNAEIRRTKARLLEEVPKLQRLAVKRVKGLSTEDLTTRNDLVLALPERIQAIPDGTATSTKNNGGWTSSASRAEIKFDSDGRFNDEYFQHTEESSQFRQEYEMRKMKQDQGLDMISEGLDTLKNMAHDMNEEIDRQVPLMDEIDTKVDKAASDLKNTNVRLKDTVNQLRSSRNFCIDIILLCIILGIAAYLYNVLKK | 368 |
Gff information
| Chromosome | Start | End | Strand | Old_gene | Gene | Num |
|---|---|---|---|---|---|---|
| 10 | 35202391 | 35206630 | - | CePI673135_10g020460.1 | Cec10g2046 | 214961 |
Annotation
| Select | Seq ID | Length | Analysis | Description | Start | End | IPR | GO |
|---|---|---|---|---|---|---|---|---|
| Cec10g2046 | 368 | SMART | tSNARE_6 | 268 | 335 | IPR000727 | - | |
| Cec10g2046 | 368 | Pfam | SNARE domain | 310 | 359 | IPR000727 | - | |
| Cec10g2046 | 368 | SUPERFAMILY | SNARE fusion complex | 266 | 333 | - | - | |
| Cec10g2046 | 368 | CDD | SNARE_Qc | 278 | 333 | - | - | |
| Cec10g2046 | 368 | ProSitePatterns | Syntaxin / epimorphin family signature. | 279 | 318 | IPR006012 | GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro) | |
| Cec10g2046 | 368 | PANTHER | SYNTAXIN | 146 | 353 | IPR045242 | GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER) | |
| Cec10g2046 | 368 | FunFam | Putative syntaxin-71-like | 273 | 334 | - | - | |
| Cec10g2046 | 368 | Coils | Coil | 322 | 342 | - | - | |
| Cec10g2046 | 368 | Coils | Coil | 143 | 163 | - | - | |
| Cec10g2046 | 368 | Gene3D | - | 273 | 334 | - | - | |
| Cec10g2046 | 368 | ProSiteProfiles | t-SNARE coiled-coil homology domain profile. | 273 | 335 | IPR000727 | - |
Pathway
| Select | Query | KO | Definition | Second KO | KEGG Genes ID | GHOSTX Score |
|---|---|---|---|---|---|---|
| Cec10g2046 | K08506 | - | - | csv:101215905 | 494.582 |
Dupl-types
| Select | Gene1 | Location1 | Gene2 | Location2 | E-value | Duplicated-type |
|---|---|---|---|---|---|---|
| Cec10g2046 | Cec-Chr10:35202391 | Cec02g2216 | Cec-Chr2:39590193 | 7.80E-100 | wgd |
Deco-Alignment
| Select | Vvi1 | Blo1 | Blo2 | Bda1 | Bda2 | Bpe1 | Bpe2 | Bma1 | Bma2 | Cmo1 | Cmo2 | Cma1 | Cma2 | Car1 | Car2 | Sed1 | Cpe1 | Cpe2 | Bhi1 | Tan1 | Cmetu1 | Lac1 | Hepe1 | Mch1 | Lcy1 | Cla1 | Cam1 | Cec1 | Cco1 | Clacu1 | Cmu1 | Cre1 | Cone1 | Cone2 | Cone3 | Cone4 | Lsi1 | Csa1 | Chy1 | Cme1 | Blo3 | Blo4 | Bda3 | Bda4 | Bpe3 | Bpe4 | Bma3 | Bma4 | Sed2 | Cmo3 | Cmo4 | Cma3 | Cma4 | Car3 | Car4 | Cpe3 | Cpe4 | Bhi2 | Tan2 | Cmetu2 | Lac2 | Hepe2 | Mch2 | Lcy2 | Cla2 | Cam2 | Cec2 | Cco2 | Clacu2 | Cmu2 | Cre2 | Lsi2 | Csa2 | Chy2 | Cme2 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Vvi8g590 | . | . | . | . | Bpe04g01584 | . | . | . | . | Cmo14g00195 | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | Cone13ag1275 | Cone19ag1262 | . | . | . | Cme04g02538 | . | . | . | . | . | . | . | . | Sed04g1347 | . | . | . | Cma14g00203 | . | Car14g00181 | Cpe03g00174 | . | Bhi11g02112 | Tan08g1893 | Cmetu04g1845 | Lac10g3026 | Hepe05g0250 | . | . | Cla10g01938 | Cam10g2004 | Cec10g2046 | Cco10g2031 | Clacu10g2011 | Cmu10g2760 | Cre10g2153 | Lsi03g02035 | Csa03g03265 | Chy04g02075 | . |
Syn-Families
| Select | Gene | Event_type | S_start | S_end | Function | Ath_gene | Identity(%) | E-value | Score |
|---|---|---|---|---|---|---|---|---|---|
| Cec08g1324 | . | 37 | 351 | SNARE and Associated Proteins | AT3G24350 | 61.0 | 1.7e-94 | 343.2 | |
| Cec04g0715 | . | 1 | 309 | SNARE and Associated Proteins | AT1G08560 | 69.3 | 6.0e-101 | 364.4 | |
| Cec04g1660 | . | 23 | 325 | SNARE and Associated Proteins | AT2G18260 | 54.2 | 7.7e-85 | 310.8 | |
| Cec10g1837 | . | 19 | 279 | SNARE and Associated Proteins | AT3G11820 | 80.5 | 1.3e-114 | 409.8 | |
| Cec04g1193 | . | 22 | 282 | SNARE and Associated Proteins | AT3G11820 | 71.6 | 5.0e-103 | 371.3 | |
| Cec03g0540 | . | 31 | 281 | SNARE and Associated Proteins | AT3G11820 | 66.5 | 1.0e-92 | 337.0 | |
| Cec10g1365 | . | 442 | 696 | SNARE and Associated Proteins | AT3G11820 | 52.5 | 8.0e-69 | 257.7 | |
| Cec10g1837 | . | 1 | 279 | SNARE and Associated Proteins | AT3G52400 | 63.6 | 4.7e-91 | 331.6 | |
| Cec04g1193 | . | 33 | 282 | SNARE and Associated Proteins | AT3G52400 | 64.8 | 1.7e-85 | 313.2 | |
| Cec03g0540 | . | 1 | 281 | SNARE and Associated Proteins | AT3G52400 | 56.4 | 3.4e-81 | 298.9 | |
| Cec10g1365 | . | 444 | 696 | SNARE and Associated Proteins | AT3G52400 | 51.0 | 6.0e-62 | 235.0 | |
| Cec03g0540 | . | 1 | 299 | SNARE and Associated Proteins | AT4G03330 | 69.2 | 2.9e-108 | 388.7 | |
| Cec10g1837 | . | 1 | 279 | SNARE and Associated Proteins | AT4G03330 | 58.2 | 4.2e-83 | 305.1 | |
| Cec04g1193 | . | 1 | 297 | SNARE and Associated Proteins | AT4G03330 | 52.3 | 6.3e-79 | 291.2 | |
| Cec10g1365 | . | 433 | 696 | SNARE and Associated Proteins | AT4G03330 | 53.8 | 3.9e-68 | 255.4 | |
| Cec03g0540 | . | 1 | 299 | SNARE and Associated Proteins | AT1G61290 | 79.3 | 9.6e-128 | 453.4 | |
| Cec10g1837 | . | 1 | 279 | SNARE and Associated Proteins | AT1G61290 | 62.4 | 6.1e-90 | 327.8 | |
| Cec04g1193 | . | 1 | 297 | SNARE and Associated Proteins | AT1G61290 | 56.6 | 1.2e-85 | 313.5 | |
| Cec10g1365 | . | 448 | 696 | SNARE and Associated Proteins | AT1G61290 | 50.6 | 8.3e-63 | 237.7 | |
| Cec03g0540 | . | 1 | 299 | SNARE and Associated Proteins | AT1G11250 | 78.3 | 1.7e-124 | 442.6 | |
| Cec10g1837 | . | 1 | 279 | SNARE and Associated Proteins | AT1G11250 | 62.0 | 4.9e-92 | 334.7 | |
| Cec04g1193 | . | 1 | 292 | SNARE and Associated Proteins | AT1G11250 | 57.2 | 6.2e-87 | 317.8 | |
| Cec10g1365 | . | 432 | 696 | SNARE and Associated Proteins | AT1G11250 | 50.6 | 2.1e-66 | 249.6 | |
| Cec10g1365 | . | 417 | 715 | SNARE and Associated Proteins | AT3G03800 | 74.2 | 6.7e-113 | 404.1 | |
| Cec02g0887 | . | 38 | 271 | SNARE and Associated Proteins | AT3G03800 | 59.8 | 6.4e-71 | 264.6 | |
| Cec10g1365 | . | 417 | 614 | SNARE and Associated Proteins | AT5G08080 | 78.4 | 1.0e-78 | 290.0 | |
| Cec02g0887 | . | 24 | 224 | SNARE and Associated Proteins | AT5G08080 | 58.7 | 1.3e-52 | 203.4 | |
| Cec10g0147 | . | 1 | 256 | SNARE and Associated Proteins | AT5G16830 | 59.2 | 6.6e-75 | 277.7 | |
| Cec10g0147 | . | 1 | 256 | SNARE and Associated Proteins | AT5G46860 | 66.0 | 3.0e-80 | 295.4 | |
| Cec10g0147 | . | 1 | 256 | SNARE and Associated Proteins | AT4G17730 | 60.9 | 5.8e-73 | 271.2 | |
| Cec10g0147 | . | 65 | 256 | SNARE and Associated Proteins | AT1G32270 | 59.9 | 3.3e-52 | 202.6 | |
| Cec07g0462 | . | 1 | 336 | SNARE and Associated Proteins | AT5G05760 | 65.9 | 1.8e-111 | 399.4 | |
| Cec08g1324 | . | 37 | 351 | SNARE and Associated Proteins | AT3G24350 | 61.0 | 1.7e-94 | 343.2 | |
| Cec02g1601 | . | 34 | 359 | SNARE and Associated Proteins | AT5G26980 | 76.7 | 7.8e-128 | 453.8 | |
| Cec09g0536 | . | 1 | 317 | SNARE and Associated Proteins | AT5G26980 | 66.2 | 6.9e-100 | 360.9 | |
| Cec02g1601 | . | 34 | 359 | SNARE and Associated Proteins | AT4G02195 | 64.0 | 3.5e-104 | 375.2 | |
| Cec09g0536 | . | 1 | 317 | SNARE and Associated Proteins | AT4G02195 | 66.1 | 1.9e-102 | 369.4 | |
| Cec02g1601 | . | 34 | 359 | SNARE and Associated Proteins | AT3G05710 | 76.1 | 1.1e-129 | 459.9 | |
| Cec09g0536 | . | 1 | 317 | SNARE and Associated Proteins | AT3G05710 | 63.7 | 3.6e-96 | 348.6 | |
| Cec09g1092 | . | 1 | 209 | SNARE and Associated Proteins | AT1G16240 | 72.7 | 5.7e-80 | 294.3 | |
| Cec10g0467 | . | 32 | 247 | SNARE and Associated Proteins | AT1G16240 | 68.5 | 1.2e-77 | 286.6 | |
| Cec10g0467 | . | 27 | 247 | SNARE and Associated Proteins | AT1G79590 | 67.0 | 5.5e-79 | 291.2 | |
| Cec09g1092 | . | 1 | 209 | SNARE and Associated Proteins | AT1G79590 | 71.3 | 5.1e-77 | 284.6 | |
| Cec06g0054 | . | 136 | 326 | SNARE and Associated Proteins | AT1G28490 | 71.7 | 8.1e-67 | 250.4 | |
| Cec10g2046 | . | 104 | 367 | SNARE and Associated Proteins | AT3G09740 | 79.3 | 1.0e-112 | 403.3 | |
| Cec02g2216 | . | 1 | 265 | SNARE and Associated Proteins | AT3G09740 | 67.8 | 1.9e-95 | 345.9 | |
| Cec02g2216 | . | 1 | 265 | SNARE and Associated Proteins | AT3G45280 | 65.9 | 7.5e-92 | 334.0 | |
| Cec10g2046 | . | 104 | 367 | SNARE and Associated Proteins | AT3G45280 | 64.0 | 3.2e-87 | 318.5 | |
| Cec10g2046 | . | 104 | 364 | SNARE and Associated Proteins | AT3G61450 | 68.2 | 5.4e-95 | 344.4 | |
| Cec02g2216 | . | 1 | 262 | SNARE and Associated Proteins | AT3G61450 | 61.4 | 3.0e-85 | 312.0 | |
| Cec11g0667 | . | 65 | 307 | SNARE and Associated Proteins | AT1G51740 | 73.1 | 1.4e-89 | 326.2 |
Syn-Orthogroups
| Select | Orthogroup | Bda | Bhi | Blo | Bma | Bpe | Cam | Car | Cco | Cec | Chy | Cla | Clacu | Cma | Cme | Cmetu | Cmo | Cmu | Cone | Cpe | Cre | Csa | HCH | Hepe | Lac | Lcy | Lsi | Mch | Sed | Tan | Vvi | Total |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| OG0002038 | 1 | 2 | 1 | 1 | 1 | 2 | 3 | 2 | 2 | 2 | 2 | 2 | 3 | 3 | 2 | 3 | 2 | 2 | 3 | 2 | 3 | 2 | 2 | 2 | 2 | 2 | 3 | 2 | 2 | 2 | 63 |