Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Chy01g01059 ATGGCGTATACTTTAGAATCATGGACGAAGGAATACAATGAAGCTTTGAAACTCTCTGAAGATATCAATGGCATGATTTCTGAGAGAAGTTCACTTGCTGCGTCTGGACCGGAAGCTCAGCGTCATGCCTCAGCTATACGCAGGAAGATCACAATATTGGGTACCAGACTTGATACCTTGCAGAGTCAATTACCCAAACTTCAAGGAAAGCAACCAATACCAGAGAAAGAGATGAATCGCCGCAGGGACATGATTGGAAATTTGAGATCAAAGGCTAAGCAGATGGCTTCAACTTTGAACATGTCTAACTTTGCCAACCGGGATAGCTTACTTGGCCCAGAAATAAAGCCAGCTGATGTCGTGAACAGAACAGAAGGCTTAGATAACCGAGGCCTAGTTGGTTTTCAACGACAAATTATGAGAGAACAAGATGAAGGCCTTGAGAAACTGGAAGGGACTATAATTAGCACAAAACATATTGCATTAGCTGTCAATGAAGAACTTAACCTTCACACGAGACTGATTGATGATTTGGATGAACATGTCGATGTTACAGATTCCCGATTACGGCGAGTGCAGAAGAGGCTGGCAATATTGAACAAGCAGACCAAGGGTGGTTGCACTTGCATGTCGATGATTTTATCAGTTGTTGGGATCGTCGTTCTCATTGCTGTCATATGGCTACTGGTCAAGTATTTGTAA 702 42.88 MAYTLESWTKEYNEALKLSEDINGMISERSSLAASGPEAQRHASAIRRKITILGTRLDTLQSQLPKLQGKQPIPEKEMNRRRDMIGNLRSKAKQMASTLNMSNFANRDSLLGPEIKPADVVNRTEGLDNRGLVGFQRQIMREQDEGLEKLEGTIISTKHIALAVNEELNLHTRLIDDLDEHVDVTDSRLRRVQKRLAILNKQTKGGCTCMSMILSVVGIVVLIAVIWLLVKYL* 234
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
1 11777833 11779421 + Chy1G010590.1 Chy01g01059 218240

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Chy01g01059 233 SMART tSNARE_6 132 199 IPR000727 -
Chy01g01059 233 Pfam SNARE domain 174 224 IPR000727 -
Chy01g01059 233 CDD SNARE_Qc 140 197 - -
Chy01g01059 233 Gene3D - 139 201 - -
Chy01g01059 233 SUPERFAMILY SNARE fusion complex 128 199 - -
Chy01g01059 233 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 137 199 IPR000727 -
Chy01g01059 233 PANTHER TARGET SNARE COILED-COIL DOMAIN-CONTAINING PROTEIN-RELATED 6 228 - -
Chy01g01059 233 PANTHER SYNTAXIN 6 228 IPR045242 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Chy01g01059 K08503 SYP5; syntaxin of plants SYP5 - csv:101208669 428.328
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Chy01g01059 Chy-Chr1:11777833 Chy06g01863 Chy-Chr6:22511495 9.92E-117 dispersed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi19g583 Blo03g00538 . Bda07g00381 Bda09g00411 . Bpe08g01109 . . Cmo16g00959 . Cma01g01111 Cma09g00975 Car01g00980 Car09g00889 Sed07g2705 Cpe06g00787 Cpe02g00792 Bhi09g01700 Tan01g3132 Cmetu01g0482 . Hepe01g1245 Mch11g1220 . . . . . . . . Cone6ag0041 Cone9ag0047 Cone14ag1185 Cone15ag1202 Lsi02g01877 . . . . . Bda05g00693 . . Bpe03g00767 Bma07g01281 Bma14g00320 . Cmo01g01156 Cmo09g00974 . Cma16g00924 . Car16g00895 Cpe14g00748 . . . . . . . . Cla09g01036 Cam09g1092 Cec09g1092 Cco09g1113 . . Cre09g1057 . . Chy01g01059 Cme01g00994
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Chy03g01173 . 476 779 SNARE and Associated Proteins AT3G24350 62.5 3.1e-90 328.9
Chy08g00517 . 1 310 SNARE and Associated Proteins AT1G08560 66.4 1.4e-99 359.8
Chy02g00640 . 1 303 SNARE and Associated Proteins AT2G18260 53.8 3.7e-84 308.5
Chy04g01850 . 22 279 SNARE and Associated Proteins AT3G11820 80.6 3.0e-113 405.2
Chy08g00980 . 25 284 SNARE and Associated Proteins AT3G11820 70.0 3.5e-98 355.1
Chy12g00974 . 31 281 SNARE and Associated Proteins AT3G11820 65.3 2.4e-91 332.4
Chy04g01397 . 21 280 SNARE and Associated Proteins AT3G11820 51.5 7.2e-67 251.1
Chy04g01850 . 31 279 SNARE and Associated Proteins AT3G52400 69.5 3.8e-90 328.6
Chy08g00980 . 36 284 SNARE and Associated Proteins AT3G52400 66.7 1.7e-85 313.2
Chy12g00974 . 1 281 SNARE and Associated Proteins AT3G52400 56.0 2.1e-80 296.2
Chy12g00974 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 4.0e-107 384.8
Chy04g01850 . 1 278 SNARE and Associated Proteins AT4G03330 56.9 1.9e-80 296.2
Chy08g00980 . 1 302 SNARE and Associated Proteins AT4G03330 54.0 1.8e-78 289.7
Chy04g01397 . 34 280 SNARE and Associated Proteins AT4G03330 54.7 9.1e-67 250.8
Chy12g00974 . 1 299 SNARE and Associated Proteins AT1G61290 79.6 1.2e-127 453.0
Chy04g01850 . 1 279 SNARE and Associated Proteins AT1G61290 62.6 2.2e-89 325.9
Chy08g00980 . 1 296 SNARE and Associated Proteins AT1G61290 55.7 1.3e-81 300.1
Chy04g01397 . 35 280 SNARE and Associated Proteins AT1G61290 50.4 6.7e-62 234.6
Chy12g00974 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 1.2e-124 443.0
Chy04g01850 . 1 279 SNARE and Associated Proteins AT1G11250 62.4 2.3e-91 332.4
Chy08g00980 . 1 296 SNARE and Associated Proteins AT1G11250 55.4 3.0e-83 305.4
Chy04g01397 . 35 280 SNARE and Associated Proteins AT1G11250 51.6 5.4e-64 241.5
Chy04g01397 . 3 299 SNARE and Associated Proteins AT3G03800 73.1 3.0e-110 395.2
Chy11g00597 . 42 297 SNARE and Associated Proteins AT3G03800 58.2 3.3e-77 285.4
Chy04g01397 . 3 198 SNARE and Associated Proteins AT5G08080 76.5 6.6e-75 277.3
Chy11g00597 . 24 214 SNARE and Associated Proteins AT5G08080 59.2 3.9e-51 198.4
Chy06g02160 . 1 256 SNARE and Associated Proteins AT5G16830 58.8 1.4e-74 276.6
Chy06g02160 . 1 256 SNARE and Associated Proteins AT5G46860 65.2 6.9e-79 290.8
Chy06g02160 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 3.3e-73 271.9
Chy06g02160 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 9.2e-52 201.1
Chy10g00436 . 1 336 SNARE and Associated Proteins AT5G05760 65.6 3.9e-111 398.3
Chy03g01173 . 476 779 SNARE and Associated Proteins AT3G24350 62.5 3.1e-90 328.9
Chy05g01060 . 1 317 SNARE and Associated Proteins AT5G26980 75.7 1.5e-123 439.5
Chy01g01727 . 1 310 SNARE and Associated Proteins AT5G26980 66.6 1.6e-101 366.3
Chy01g01727 . 1 309 SNARE and Associated Proteins AT4G02195 67.4 9.8e-104 373.6
Chy05g01060 . 1 317 SNARE and Associated Proteins AT4G02195 62.4 1.5e-99 359.8
Chy05g01060 . 1 317 SNARE and Associated Proteins AT3G05710 74.5 1.2e-125 446.4
Chy01g01727 . 1 310 SNARE and Associated Proteins AT3G05710 63.7 4.1e-97 351.7
Chy01g01059 . 1 234 SNARE and Associated Proteins AT1G16240 73.1 1.5e-90 329.3
Chy06g01863 . 4 231 SNARE and Associated Proteins AT1G16240 65.8 5.6e-77 284.3
Chy01g01059 . 1 234 SNARE and Associated Proteins AT1G79590 72.6 1.1e-89 326.6
Chy06g01863 . 4 231 SNARE and Associated Proteins AT1G79590 65.4 3.8e-77 285.0
Chy11g01970 . 106 260 SNARE and Associated Proteins AT1G28490 69.7 2.9e-53 205.3
Chy04g00793 . 1 261 SNARE and Associated Proteins AT3G09740 77.9 7.5e-110 393.7
Chy04g02075 . 1 235 SNARE and Associated Proteins AT3G09740 76.8 2.1e-96 349.0
Chy04g00793 . 1 261 SNARE and Associated Proteins AT3G45280 65.5 4.0e-87 318.2
Chy04g02075 . 1 230 SNARE and Associated Proteins AT3G45280 64.4 5.1e-74 274.6
Chy04g00793 . 1 261 SNARE and Associated Proteins AT3G61450 68.9 7.9e-96 347.1
Chy04g02075 . 1 235 SNARE and Associated Proteins AT3G61450 66.4 3.8e-82 301.6
Chy03g00164 . 65 309 SNARE and Associated Proteins AT1G51740 73.3 1.7e-92 335.9
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002063 3 5 2 3 2 1 3 1 2 1 1 1 3 2 2 3 1 4 3 1 2 2 1 2 2 2 1 5 3 1 65
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Chy01g01059 Chy_Chr01 FPKM 12.197541 12.497025 14.463881 14.885899 11.222674 10.310927 11.615193 14.978712 14.046415 16.799261