Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Chy02g00640 ATGAACGACTTGATGACGAAATCGTTCTTAAGTTATGTAGAATTGAAGAAACAGGCGCAGAGGGAAGCTGTAGGCGGTGGCGGCCACGGCTTCGACATTGAATCCGGTGGCCAAAAACTGAATCCGACGGAAGAACAGAACCTGTCTCTGTTTTTCGAAAAAGTCGATGAAATCAAGACCCAAATGGAAGAGACAACCAATCTCTTAGTTGACATTCAGAAACTAAATCAAGAAGCCAAATCAACCCACAACGCCAAAATCCTCCGTGGATTAAGAGACAGAATCGACTCGGATATGGTTTCAACCCTCCGCAGAGCAAGAATCCTCAAAGAAAAATTGGCCTCTCTCGACCAATCCAACACCGCCAACCGCCTGATCTCCGTCGCATACGGCGAAGGAACCATCGTGGACAGGACAAGAACTTCAATCACGAACGGATTGAGAGTGAAATTGAGAGAAATGATGAACGAATTTCAGGGGTTGAGAGAAAAAGTTGTGGCGGATCATAAGGAAGATCTAAGAAGAAGGTATTTTAGTGCAACTGGGGAACAACCCAGTGAAGAACAAGTGGAGAAGATTATGTCTGGGAGTTTGAAATTGGAAACGTTAGGAGGGAAATTGAGTGAGACCGAGTCAGAGGACCGAGTGAGGCACGAGTCAGTGATGGATATACAGAAGAGTTTGAATAAGCTTCATCAGGTGTTTTTGGATATGGCGATTTTGGTTGAGAGTGAAGGGGAGAAAATCGAGGATATTGAAGAGAATGTGGCGAAAGCTGGGCAGTTCATCAACGGCGGAACTCGAAGCCTTTATTATGCGAAGCAGATGAAGAGGAAGAACAAGAAATGGGTGTATTGGGTTTGGGCTATCATTTTTGTTATATTGCTTGTTTGCATTGTTTCAATGTTGGTTTGTTGA 918 44.23 MNDLMTKSFLSYVELKKQAQREAVGGGGHGFDIESGGQKLNPTEEQNLSLFFEKVDEIKTQMEETTNLLVDIQKLNQEAKSTHNAKILRGLRDRIDSDMVSTLRRARILKEKLASLDQSNTANRLISVAYGEGTIVDRTRTSITNGLRVKLREMMNEFQGLREKVVADHKEDLRRRYFSATGEQPSEEQVEKIMSGSLKLETLGGKLSETESEDRVRHESVMDIQKSLNKLHQVFLDMAILVESEGEKIEDIEENVAKAGQFINGGTRSLYYAKQMKRKNKKWVYWVWAIIFVILLVCIVSMLVC* 306
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
2 3907457 3908374 + Chy2G029070.1 Chy02g00640 220088

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Chy02g00640 305 Coils Coil 55 75 - -
Chy02g00640 305 PANTHER SYNTAXIN-112 4 301 - -
Chy02g00640 305 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 211 273 IPR000727 -
Chy02g00640 305 CDD SNARE_syntaxin1-like 217 270 - -
Chy02g00640 305 Gene3D - 43 176 - -
Chy02g00640 305 SMART tSNARE_6 206 273 IPR000727 -
Chy02g00640 305 SMART SynN_4 43 170 IPR006011 GO:0016020
Chy02g00640 305 SUPERFAMILY t-snare proteins 47 266 IPR010989 GO:0016020|GO:0016192
Chy02g00640 305 CDD SynN 51 198 IPR006011 GO:0016020
Chy02g00640 305 PANTHER SYNTAXIN 4 301 IPR045242 -
Chy02g00640 305 Gene3D - 206 304 - -
Chy02g00640 305 Pfam Syntaxin 51 246 IPR006011 GO:0016020
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Chy02g00640 K08486 STX1B_2_3; syntaxin 1B/2/3 - csv:101217836 584.334
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Chy02g00640 Chy-Chr2:3907457 Chy08g00517 Chy-Chr8:12391637 2.93E-73 dispersed
Chy02g00640 Chy-Chr2:3907457 Chy04g01850 Chy-Chr4:24681494 3.66E-59 transposed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi4g990 Blo04g00912 Blo16g00051 . . Bpe15g00424 . . . . . Cma03g00740 . Car03g00676 . Sed14g1127 . Cpe10g00620 Bhi03g01315 Tan03g1990 Cmetu08g1065 . Hepe04g1076 . . . . . . . . . . . . . . . . . . . Bda11g01860 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Csa06g03248 Chy02g00640 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Chy03g01173 . 476 779 SNARE and Associated Proteins AT3G24350 62.5 3.1e-90 328.9
Chy08g00517 . 1 310 SNARE and Associated Proteins AT1G08560 66.4 1.4e-99 359.8
Chy02g00640 . 1 303 SNARE and Associated Proteins AT2G18260 53.8 3.7e-84 308.5
Chy04g01850 . 22 279 SNARE and Associated Proteins AT3G11820 80.6 3.0e-113 405.2
Chy08g00980 . 25 284 SNARE and Associated Proteins AT3G11820 70.0 3.5e-98 355.1
Chy12g00974 . 31 281 SNARE and Associated Proteins AT3G11820 65.3 2.4e-91 332.4
Chy04g01397 . 21 280 SNARE and Associated Proteins AT3G11820 51.5 7.2e-67 251.1
Chy04g01850 . 31 279 SNARE and Associated Proteins AT3G52400 69.5 3.8e-90 328.6
Chy08g00980 . 36 284 SNARE and Associated Proteins AT3G52400 66.7 1.7e-85 313.2
Chy12g00974 . 1 281 SNARE and Associated Proteins AT3G52400 56.0 2.1e-80 296.2
Chy12g00974 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 4.0e-107 384.8
Chy04g01850 . 1 278 SNARE and Associated Proteins AT4G03330 56.9 1.9e-80 296.2
Chy08g00980 . 1 302 SNARE and Associated Proteins AT4G03330 54.0 1.8e-78 289.7
Chy04g01397 . 34 280 SNARE and Associated Proteins AT4G03330 54.7 9.1e-67 250.8
Chy12g00974 . 1 299 SNARE and Associated Proteins AT1G61290 79.6 1.2e-127 453.0
Chy04g01850 . 1 279 SNARE and Associated Proteins AT1G61290 62.6 2.2e-89 325.9
Chy08g00980 . 1 296 SNARE and Associated Proteins AT1G61290 55.7 1.3e-81 300.1
Chy04g01397 . 35 280 SNARE and Associated Proteins AT1G61290 50.4 6.7e-62 234.6
Chy12g00974 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 1.2e-124 443.0
Chy04g01850 . 1 279 SNARE and Associated Proteins AT1G11250 62.4 2.3e-91 332.4
Chy08g00980 . 1 296 SNARE and Associated Proteins AT1G11250 55.4 3.0e-83 305.4
Chy04g01397 . 35 280 SNARE and Associated Proteins AT1G11250 51.6 5.4e-64 241.5
Chy04g01397 . 3 299 SNARE and Associated Proteins AT3G03800 73.1 3.0e-110 395.2
Chy11g00597 . 42 297 SNARE and Associated Proteins AT3G03800 58.2 3.3e-77 285.4
Chy04g01397 . 3 198 SNARE and Associated Proteins AT5G08080 76.5 6.6e-75 277.3
Chy11g00597 . 24 214 SNARE and Associated Proteins AT5G08080 59.2 3.9e-51 198.4
Chy06g02160 . 1 256 SNARE and Associated Proteins AT5G16830 58.8 1.4e-74 276.6
Chy06g02160 . 1 256 SNARE and Associated Proteins AT5G46860 65.2 6.9e-79 290.8
Chy06g02160 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 3.3e-73 271.9
Chy06g02160 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 9.2e-52 201.1
Chy10g00436 . 1 336 SNARE and Associated Proteins AT5G05760 65.6 3.9e-111 398.3
Chy03g01173 . 476 779 SNARE and Associated Proteins AT3G24350 62.5 3.1e-90 328.9
Chy05g01060 . 1 317 SNARE and Associated Proteins AT5G26980 75.7 1.5e-123 439.5
Chy01g01727 . 1 310 SNARE and Associated Proteins AT5G26980 66.6 1.6e-101 366.3
Chy01g01727 . 1 309 SNARE and Associated Proteins AT4G02195 67.4 9.8e-104 373.6
Chy05g01060 . 1 317 SNARE and Associated Proteins AT4G02195 62.4 1.5e-99 359.8
Chy05g01060 . 1 317 SNARE and Associated Proteins AT3G05710 74.5 1.2e-125 446.4
Chy01g01727 . 1 310 SNARE and Associated Proteins AT3G05710 63.7 4.1e-97 351.7
Chy01g01059 . 1 234 SNARE and Associated Proteins AT1G16240 73.1 1.5e-90 329.3
Chy06g01863 . 4 231 SNARE and Associated Proteins AT1G16240 65.8 5.6e-77 284.3
Chy01g01059 . 1 234 SNARE and Associated Proteins AT1G79590 72.6 1.1e-89 326.6
Chy06g01863 . 4 231 SNARE and Associated Proteins AT1G79590 65.4 3.8e-77 285.0
Chy11g01970 . 106 260 SNARE and Associated Proteins AT1G28490 69.7 2.9e-53 205.3
Chy04g00793 . 1 261 SNARE and Associated Proteins AT3G09740 77.9 7.5e-110 393.7
Chy04g02075 . 1 235 SNARE and Associated Proteins AT3G09740 76.8 2.1e-96 349.0
Chy04g00793 . 1 261 SNARE and Associated Proteins AT3G45280 65.5 4.0e-87 318.2
Chy04g02075 . 1 230 SNARE and Associated Proteins AT3G45280 64.4 5.1e-74 274.6
Chy04g00793 . 1 261 SNARE and Associated Proteins AT3G61450 68.9 7.9e-96 347.1
Chy04g02075 . 1 235 SNARE and Associated Proteins AT3G61450 66.4 3.8e-82 301.6
Chy03g00164 . 65 309 SNARE and Associated Proteins AT1G51740 73.3 1.7e-92 335.9
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002433 5 3 5 4 2 1 2 1 2 2 1 1 2 1 2 1 1 3 2 1 2 3 2 2 1 1 1 2 1 4 61
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Chy02g00640 Chy_Chr02 FPKM 4.677397 4.984058 7.139485 7.239217 5.406341 4.50219 5.769467 14.365815 13.758629 14.075619