Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Chy02g02491	ATGGCGTTTCTTGGACTTCTCTTGGTGGGTCTTCTTCTATCTTTGGGATGTGATTCTGCTCTTGCCAACAACAATGGAGGTGGTTGGATTAGTGCCCACGCCACATTCTACGGTGGGGGTGACGCCGCTGGTACAATGGGAGGGGCTTGTGGCTATGGAAATCTGTACAGCCAGGGATATGGGACGAACACAGCAGCTCTGAGTACAGCTTTATTCAACAATGGACTGAGTTGTGGCGCTTGCTTTGAAATCAAATGTGTAAATGACCCAAAATGGTGTCTTCAAAAGTCCATAGTGGTTACTGCCACAAACTTTTGTCCACCAAACAATGCGCTCCCAAACAACGCCGGCGGCTGGTGTAACCCTCCCCAACACCATTTCGATCTCTCCCAACCCGTCTTCGAACAAATCGCTGGTTACAAAGCCGGCATTGTCCCAGTTGCATACAGAAGGGTATCTTGTGAGAAGAAAGGAGGCATTAGATTCACAATCAATGGTCATTCGTACTTCAATTTAGTCCTTGTAACCAACGTTGGTGGAGGTGGGGATGTTCATGGTGTGTGGATTAAAGGGTCGAAAACAGGGTGGGAAGCAATGTCGAGGAATTGGGGACAGAATTGGCAGAGCAATTCATATCTGAATGGACAAAGCTTATCGTTCAAAGTGACCACCGGCGATGGCCGAACAGTGATATCCAATGACGTAGCGCCAGCTCAGTGGAGCTTTGGTCAAACTTTTAGAGAAATGGCCACCGTCACCACTCAAGCTTCTGCCGCCGTTTTCCGGCCATGTGCCGCCCGATCAAGATTCCTTTCCGGTTCTTCCGGTAAACTCCAACGTGTGCTCTCAGTTAAGCCAGTTTCTGCTTCTTCGTCTTCATCTTTCAAGGTTGAAGCCAAGAAAGGAGAATGGTTGCCTGGTCTCCCATCTCCGGTGTACTTAAACGGCAGTCTTCCCGGCGACAATGGATTTGACCCATTGGGATTAGCGGAAGACCCAGAGAACTTGAGGTGGTATGTTCAAGCGGAGCTGGTGAATGGGCGGTGGGCGATGCTTGGTGTCGCCGGAATGCTTCTACCGGAGGTTTTCACGAAGATTGGAATCATCAACGCCCCTCAATGGTACGACGCTGGAAAGGCAGAGTACTTCGCCTCGTCGTCAACTCTGTTTGTAATCGAGTTTATCCTCTTCCATTACGTCGAAATCCGAAGATGGCAAGACATTAAAAACCCTGGCTGTGTTAACCAAGACCCCATTTTCAAGCAATACAGTTTGCCCCCAAATGAATGTGGTTACCCTGGTGGGATTTTCAATCCCCTGAATTTCGCCCCAACTCTTGAAGCTAAAGAGAAGGAAATAGCCAATGGGAGACTTGCGATGTTGGCGTTTTTGGGGTTCATAGTGCAACACAATGTGACAGGGAAAGGGCCATTTGACAATCTTTTGCAGCACATCTCAGACCCATGGCACAACACCATTGTCCAGACATTTGGTGGCAACTAA	1503	48.77	MAFLGLLLVGLLLSLGCDSALANNNGGGWISAHATFYGGGDAAGTMGGACGYGNLYSQGYGTNTAALSTALFNNGLSCGACFEIKCVNDPKWCLQKSIVVTATNFCPPNNALPNNAGGWCNPPQHHFDLSQPVFEQIAGYKAGIVPVAYRRVSCEKKGGIRFTINGHSYFNLVLVTNVGGGGDVHGVWIKGSKTGWEAMSRNWGQNWQSNSYLNGQSLSFKVTTGDGRTVISNDVAPAQWSFGQTFREMATVTTQASAAVFRPCAARSRFLSGSSGKLQRVLSVKPVSASSSSSFKVEAKKGEWLPGLPSPVYLNGSLPGDNGFDPLGLAEDPENLRWYVQAELVNGRWAMLGVAGMLLPEVFTKIGIINAPQWYDAGKAEYFASSSTLFVIEFILFHYVEIRRWQDIKNPGCVNQDPIFKQYSLPPNECGYPGGIFNPLNFAPTLEAKEKEIANGRLAMLAFLGFIVQHNVTGKGPFDNLLQHISDPWHNTIVQTFGGN*	501

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
2	28417130	28421364	+	Chy2G047580.1	Chy02g02491	221939

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Chy02g02491	500	SUPERFAMILY	PHL pollen allergen	156	247	IPR036749	-
Chy02g02491	500	PANTHER	CHLOROPHYLL A-B BINDING PROTEIN, CHLOROPLASTIC	249	500	-	-
Chy02g02491	500	PRINTS	Expansin/Lol pI family signature	28	43	IPR007118	GO:0005576
Chy02g02491	500	PRINTS	Expansin/Lol pI family signature	142	158	IPR007118	GO:0005576
Chy02g02491	500	PRINTS	Expansin/Lol pI family signature	46	64	IPR007118	GO:0005576
Chy02g02491	500	PRINTS	Expansin/Lol pI family signature	234	248	IPR007118	GO:0005576
Chy02g02491	500	PRINTS	Expansin/Lol pI family signature	68	86	IPR007118	GO:0005576
Chy02g02491	500	PRINTS	Expansin/Lol pI family signature	196	210	IPR007118	GO:0005576
Chy02g02491	500	Pfam	Lytic transglycolase	64	149	IPR009009	-
Chy02g02491	500	Gene3D	-	15	155	IPR036908	-
Chy02g02491	500	ProSiteProfiles	Expansin, family-45 endoglucanase-like domain profile.	47	159	IPR007112	-
Chy02g02491	500	PANTHER	CHLOROPHYLL A/B BINDING PROTEIN	249	500	IPR001344	GO:0009765\|GO:0016020
Chy02g02491	500	SUPERFAMILY	Barwin-like endoglucanases	28	177	IPR036908	-
Chy02g02491	500	Gene3D	-	157	251	IPR036749	-
Chy02g02491	500	PRINTS	Expansin signature	158	170	IPR002963	GO:0009664
Chy02g02491	500	PRINTS	Expansin signature	205	226	IPR002963	GO:0009664
Chy02g02491	500	PRINTS	Expansin signature	234	250	IPR002963	GO:0009664
Chy02g02491	500	PRINTS	Expansin signature	59	73	IPR002963	GO:0009664
Chy02g02491	500	PRINTS	Expansin signature	170	191	IPR002963	GO:0009664
Chy02g02491	500	PRINTS	Expansin signature	134	147	IPR002963	GO:0009664
Chy02g02491	500	PRINTS	Expansin signature	98	108	IPR002963	GO:0009664
Chy02g02491	500	PRINTS	Expansin signature	117	134	IPR002963	GO:0009664
Chy02g02491	500	PRINTS	Expansin signature	86	97	IPR002963	GO:0009664
Chy02g02491	500	SMART	dpbb_1	64	149	IPR007112	-
Chy02g02491	500	Gene3D	Chlorophyll a/b binding protein domain	311	490	-	-
Chy02g02491	500	Pfam	Chlorophyll A-B binding protein	311	470	IPR022796	-
Chy02g02491	500	Pfam	Expansin C-terminal domain	160	237	IPR007117	-
Chy02g02491	500	SUPERFAMILY	Chlorophyll a-b binding protein	301	497	-	-
Chy02g02491	500	ProSiteProfiles	Expansin, Cellulose-binding-like domain profile.	169	248	IPR007117	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Chy02g02491	K08910	LHCA4; light-harvesting complex I chlorophyll a/b binding protein 4	-	csv:101222701	499.975

WGDs- Genes

Select	Gene_1	Gene_2	Event_name
	Chy02g02491	Chy12g01533	CCT
	Chy02g02491	Chy12g01533	ECH

Dupl-types

Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
Chy02g02491	Chy-Chr2:28417130	Chy05g00682	Chy-Chr5:8773611	1.91E-127	dispersed
Chy02g01290	Chy-Chr2:9438167	Chy02g02491	Chy-Chr2:28417130	3.05E-60	transposed
Chy02g01569	Chy-Chr2:13904381	Chy02g02491	Chy-Chr2:28417130	8.12E-39	transposed
Chy03g00521	Chy-Chr3:7204554	Chy02g02491	Chy-Chr2:28417130	3.76E-29	transposed
Chy03g01543	Chy-Chr3:17608116	Chy02g02491	Chy-Chr2:28417130	6.38E-63	transposed
Chy09g00695	Chy-Chr9:9241369	Chy02g02491	Chy-Chr2:28417130	3.87E-44	transposed
Chy10g00781	Chy-Chr10:13858504	Chy02g02491	Chy-Chr2:28417130	1.46E-71	transposed
Chy12g01533	Chy-Chr12:19057148	Chy02g02491	Chy-Chr2:28417130	2.00E-162	transposed
Chy10g01014	Chy-Chr10:15516342	Chy02g02491	Chy-Chr2:28417130	3.93E-132	wgd
Chy12g01532	Chy-Chr12:19055053	Chy02g02491	Chy-Chr2:28417130	4.17E-92	wgd

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi17g566	Blo04g00773	.	Bda06g00542	Bda15g00608	Bpe12g00541	.	.	Bma12g00994	.	.	.	Cma11g00139	Car10g00187	Car11g00156	.	.	Cpe04g01495	.	.	.	.	.	.	.	Cla06g01586	Cam06g1755	Cec06g1811	Cco06g1814	Clacu06g1721	Cmu06g1664	Cre06g2478	Cone2ag0840	Cone16ag0175	.	.	Lsi02g00081	Csa01g00560	Chy12g01533	Cme12g01983	Blo13g00003	Blo15g00312	.	.	Bpe07g00779	.	.	Bma08g00227	Sed08g2078	Cmo10g00213	Cmo11g00172	.	.	.	.	.	Cpe18g00788	Bhi08g01147	Tan05g2431	Cmetu02g0368	Lac10g0087	Hepe07g2501	.	.	Cla04g01190	Cam04g1247	Cec01g1758	Cco01g1804	Clacu04g1276	Cmu04g1254	Cre01g1547	.	Csa01g00241	Chy02g02491	Cme02g01877

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Chy12g00180	.	1	399	Chloroplast and Mitochondria Gene Families	AT2G28800	64.5	1.3e-135	479.9
Chy03g01693	.	71	425	Chloroplast and Mitochondria Gene Families	AT2G28800	54.7	1.7e-98	356.7
Chy03g00521	.	3	256	Chloroplast and Mitochondria Gene Families	AT1G15820	79.7	8.1e-117	416.8
Chy01g00514	.	1	266	Chloroplast and Mitochondria Gene Families	AT3G27690	89.9	1.1e-144	509.6
Chy02g00166	.	2	266	Chloroplast and Mitochondria Gene Families	AT3G27690	76.4	9.0e-120	426.8
Chy11g01011	.	2	263	Chloroplast and Mitochondria Gene Families	AT3G27690	78.8	2.6e-119	425.2
Chy04g01189	.	1	266	Chloroplast and Mitochondria Gene Families	AT3G27690	76.6	6.5e-118	420.6
Chy06g01728	.	5	265	Chloroplast and Mitochondria Gene Families	AT3G27690	66.8	4.3e-98	354.8
Chy02g00167	.	2	218	Chloroplast and Mitochondria Gene Families	AT3G27690	73.5	1.2e-92	336.7
Chy09g00113	.	70	273	Chloroplast and Mitochondria Gene Families	AT3G27690	52.6	1.4e-51	200.3
Chy10g00781	.	16	254	Chloroplast and Mitochondria Gene Families	AT3G61470	86.7	1.7e-127	452.2
Chy02g01290	.	56	261	Chloroplast and Mitochondria Gene Families	AT3G61470	65.0	2.5e-86	315.5
Chy02g02491	CCT,ECH	270	497	Chloroplast and Mitochondria Gene Families	AT3G61470	51.3	6.0e-64	241.1
Chy09g00695	.	1	198	Chloroplast and Mitochondria Gene Families	AT3G54890	81.6	9.1e-90	326.6
Chy08g00647	.	3	284	Chloroplast and Mitochondria Gene Families	AT3G08940	83.7	5.1e-136	480.7
Chy07g00435	.	55	245	Chloroplast and Mitochondria Gene Families	AT1G76570	77.5	3.4e-88	322.0
Chy07g00436	.	46	149	Chloroplast and Mitochondria Gene Families	AT1G76570	78.8	5.0e-47	185.3
Chy02g01569	.	1	293	Chloroplast and Mitochondria Gene Families	AT1G61520	76.5	3.4e-121	431.4
Chy01g00514	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G05070	90.2	7.2e-145	510.0
Chy02g00166	.	5	266	Chloroplast and Mitochondria Gene Families	AT2G05070	77.9	2.3e-119	425.2
Chy11g01011	.	7	263	Chloroplast and Mitochondria Gene Families	AT2G05070	79.4	2.6e-118	421.8
Chy04g01189	.	27	266	Chloroplast and Mitochondria Gene Families	AT2G05070	83.8	2.2e-117	418.7
Chy06g01728	.	8	265	Chloroplast and Mitochondria Gene Families	AT2G05070	68.2	1.7e-98	355.9
Chy02g00167	.	5	218	Chloroplast and Mitochondria Gene Families	AT2G05070	74.4	7.1e-92	334.0
Chy01g00514	.	1	237	Chloroplast and Mitochondria Gene Families	AT2G05100	89.9	1.2e-125	446.4
Chy11g01011	.	7	239	Chloroplast and Mitochondria Gene Families	AT2G05100	78.2	4.0e-102	368.2
Chy02g00166	.	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	75.1	2.2e-100	362.5
Chy04g01189	.	27	237	Chloroplast and Mitochondria Gene Families	AT2G05100	82.5	3.2e-99	358.6
Chy02g00167	.	5	218	Chloroplast and Mitochondria Gene Families	AT2G05100	74.4	2.5e-91	332.4
Chy06g01728	.	8	236	Chloroplast and Mitochondria Gene Families	AT2G05100	67.6	1.9e-83	306.2
Chy08g00647	.	3	167	Chloroplast and Mitochondria Gene Families	AT2G40100	72.8	7.2e-67	250.4
Chy11g01011	.	1	263	Chloroplast and Mitochondria Gene Families	AT1G29930	88.6	1.2e-134	476.1
Chy02g00166	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29930	87.7	5.8e-134	473.8
Chy04g01189	.	4	266	Chloroplast and Mitochondria Gene Families	AT1G29930	84.6	5.8e-126	447.2
Chy01g00514	.	3	266	Chloroplast and Mitochondria Gene Families	AT1G29930	78.7	2.4e-116	415.2
Chy02g00167	.	1	218	Chloroplast and Mitochondria Gene Families	AT1G29930	85.9	9.6e-105	376.7
Chy06g01728	.	34	265	Chloroplast and Mitochondria Gene Families	AT1G29930	70.4	1.5e-94	342.8
Chy09g00113	.	53	273	Chloroplast and Mitochondria Gene Families	AT1G29930	51.1	1.7e-53	206.5
Chy11g01011	.	1	263	Chloroplast and Mitochondria Gene Families	AT1G29920	88.3	4.4e-134	474.2
Chy02g00166	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29920	87.3	2.2e-133	471.9
Chy04g01189	.	4	266	Chloroplast and Mitochondria Gene Families	AT1G29920	84.6	7.5e-126	446.8
Chy01g00514	.	30	266	Chloroplast and Mitochondria Gene Families	AT1G29920	83.8	3.2e-116	414.8
Chy02g00167	.	1	218	Chloroplast and Mitochondria Gene Families	AT1G29920	85.5	3.6e-104	374.8
Chy06g01728	.	34	265	Chloroplast and Mitochondria Gene Families	AT1G29920	70.4	1.5e-94	342.8
Chy09g00113	.	53	273	Chloroplast and Mitochondria Gene Families	AT1G29920	51.1	1.7e-53	206.5
Chy11g01011	.	1	263	Chloroplast and Mitochondria Gene Families	AT1G29910	88.3	4.4e-134	474.2
Chy02g00166	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29910	87.3	2.2e-133	471.9
Chy04g01189	.	4	266	Chloroplast and Mitochondria Gene Families	AT1G29910	84.6	7.5e-126	446.8
Chy01g00514	.	30	266	Chloroplast and Mitochondria Gene Families	AT1G29910	83.8	3.2e-116	414.8
Chy02g00167	.	1	218	Chloroplast and Mitochondria Gene Families	AT1G29910	85.5	3.6e-104	374.8
Chy06g01728	.	34	265	Chloroplast and Mitochondria Gene Families	AT1G29910	70.4	1.5e-94	342.8
Chy09g00113	.	53	273	Chloroplast and Mitochondria Gene Families	AT1G29910	51.1	1.7e-53	206.5
Chy09g00113	.	11	289	Chloroplast and Mitochondria Gene Families	AT4G10340	84.0	3.8e-136	481.1
Chy02g00166	.	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.0	6.0e-57	218.0
Chy04g01189	.	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	7.8e-57	217.6
Chy11g01011	.	51	255	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	1.0e-56	217.2
Chy01g00514	.	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.6	2.8e-54	209.1
Chy06g01728	.	46	252	Chloroplast and Mitochondria Gene Families	AT4G10340	54.5	1.2e-52	203.8
Chy11g01011	.	1	263	Chloroplast and Mitochondria Gene Families	AT2G34420	88.6	7.5e-134	473.4
Chy02g00166	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34420	86.9	2.4e-132	468.4
Chy04g01189	.	4	266	Chloroplast and Mitochondria Gene Families	AT2G34420	85.0	1.2e-126	449.5
Chy01g00514	.	3	266	Chloroplast and Mitochondria Gene Families	AT2G34420	77.2	1.4e-116	416.0
Chy02g00167	.	1	218	Chloroplast and Mitochondria Gene Families	AT2G34420	84.5	6.8e-103	370.5
Chy06g01728	.	34	265	Chloroplast and Mitochondria Gene Families	AT2G34420	70.8	1.5e-94	342.8
Chy09g00113	.	53	273	Chloroplast and Mitochondria Gene Families	AT2G34420	50.2	8.4e-53	204.1
Chy02g00166	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34430	88.0	1.8e-135	478.8
Chy11g01011	.	1	263	Chloroplast and Mitochondria Gene Families	AT2G34430	87.5	1.8e-132	468.8
Chy04g01189	.	4	266	Chloroplast and Mitochondria Gene Families	AT2G34430	85.3	1.6e-128	455.7
Chy01g00514	.	30	266	Chloroplast and Mitochondria Gene Families	AT2G34430	82.9	2.3e-114	408.7
Chy02g00167	.	1	218	Chloroplast and Mitochondria Gene Families	AT2G34430	85.8	5.1e-106	380.9
Chy06g01728	.	34	265	Chloroplast and Mitochondria Gene Families	AT2G34430	71.5	6.9e-95	344.0
Chy08g00647	.	2	284	Chloroplast and Mitochondria Gene Families	AT5G01530	84.9	1.7e-139	492.3
Chy06g01591	.	48	308	Chloroplast and Mitochondria Gene Families	AT5G40810	93.1	7.8e-144	506.5
Chy06g01591	.	1	308	Chloroplast and Mitochondria Gene Families	AT3G27240	86.4	3.9e-150	527.7
Chy11g01383	.	5	324	Chloroplast and Mitochondria Gene Families	AT2G30160	75.1	5.4e-142	500.7
Chy08g00612	.	9	311	Chloroplast and Mitochondria Gene Families	AT2G30160	65.5	1.8e-113	406.0
Chy11g01383	.	5	327	Chloroplast and Mitochondria Gene Families	AT1G07030	74.5	5.9e-141	497.3
Chy08g00612	.	5	311	Chloroplast and Mitochondria Gene Families	AT1G07030	68.5	9.9e-120	426.8
Chy01g01724	.	1	305	Chloroplast and Mitochondria Gene Families	AT2G47490	76.1	6.1e-135	477.2
Chy09g00893	.	11	312	Chloroplast and Mitochondria Gene Families	AT2G47490	64.9	7.2e-112	400.6
Chy09g00893	.	10	303	Chloroplast and Mitochondria Gene Families	AT1G25380	72.5	1.7e-120	429.5
Chy01g01724	.	11	297	Chloroplast and Mitochondria Gene Families	AT1G25380	64.2	4.0e-106	381.7
Chy12g00977	.	627	1206	Chloroplast and Mitochondria Gene Families	AT4G21490	74.5	6.2e-258	886.7
Chy11g01079	.	1	586	Chloroplast and Mitochondria Gene Families	AT4G21490	68.8	5.8e-240	827.0
Chy01g00375	.	1	575	Chloroplast and Mitochondria Gene Families	AT4G21490	64.1	2.6e-224	775.0
Chy01g02191	.	5	186	Chloroplast and Mitochondria Gene Families	AT1G17530	65.4	4.8e-63	237.7
Chy02g01804	.	1	172	Chloroplast and Mitochondria Gene Families	AT1G17530	56.9	3.3e-48	188.3
Chy02g01804	.	1	172	Chloroplast and Mitochondria Gene Families	AT3G04800	55.5	1.4e-46	183.0
Chy01g02191	.	22	186	Chloroplast and Mitochondria Gene Families	AT3G04800	55.1	1.1e-41	166.8
Chy01g02191	.	15	186	Chloroplast and Mitochondria Gene Families	AT1G72750	68.4	2.1e-61	232.3
Chy02g01804	.	3	172	Chloroplast and Mitochondria Gene Families	AT1G72750	56.6	6.4e-47	184.1
Chy10g01108	.	700	874	Chloroplast and Mitochondria Gene Families	AT1G26100	66.3	1.3e-65	246.5
Chy09g00143	.	1	226	Chloroplast and Mitochondria Gene Families	AT5G38630	70.9	6.8e-91	330.5
Chy04g00019	.	23	218	Chloroplast and Mitochondria Gene Families	AT4G25570	73.0	4.1e-82	301.6
Chy02g02696	.	26	334	Chloroplast and Mitochondria Gene Families	AT5G14040	84.9	1.1e-154	543.1
Chy06g01467	.	11	350	Chloroplast and Mitochondria Gene Families	AT5G14040	74.0	1.5e-151	532.7
Chy01g00582	.	11	298	Chloroplast and Mitochondria Gene Families	AT5G14040	52.7	5.3e-85	311.6
Chy06g01467	.	8	356	Chloroplast and Mitochondria Gene Families	AT3G48850	69.7	8.3e-144	506.9
Chy02g02696	.	27	334	Chloroplast and Mitochondria Gene Families	AT3G48850	75.3	1.6e-139	492.7
Chy01g00582	.	11	297	Chloroplast and Mitochondria Gene Families	AT3G48850	50.9	2.0e-84	309.7
Chy01g00582	.	14	311	Chloroplast and Mitochondria Gene Families	AT2G17270	76.2	6.2e-132	467.2
Chy06g01467	.	57	355	Chloroplast and Mitochondria Gene Families	AT2G17270	51.8	1.8e-86	316.2
Chy09g00188	.	16	313	Chloroplast and Mitochondria Gene Families	AT5G15640	77.7	4.6e-130	461.1
Chy07g00267	.	60	393	Chloroplast and Mitochondria Gene Families	AT5G26200	68.3	1.3e-125	446.4
Chy01g02185	.	1	347	Chloroplast and Mitochondria Gene Families	AT5G26200	57.3	4.2e-105	378.3
Chy01g02185	.	1	351	Chloroplast and Mitochondria Gene Families	AT1G72820	74.9	4.5e-147	517.7
Chy07g00267	.	49	394	Chloroplast and Mitochondria Gene Families	AT1G72820	67.9	1.9e-129	459.1
Chy08g00665	.	1	107	Chloroplast and Mitochondria Gene Families	AT1G72820	76.6	1.3e-40	164.1
Chy09g01257	.	33	230	Chloroplast and Mitochondria Gene Families	AT5G52570	51.3	2.8e-44	175.6
Chy06g00974	.	1	219	Chloroplast and Mitochondria Gene Families	AT4G25700	61.4	5.1e-67	251.1
Chy09g01257	.	33	148	Chloroplast and Mitochondria Gene Families	AT4G25700	77.6	9.0e-48	187.2
Chy01g00388	.	113	291	Chloroplast and Mitochondria Gene Families	AT4G03320	51.7	3.3e-55	212.2
Chy06g01726	.	75	363	Chloroplast and Mitochondria Gene Families	AT5G54290	80.1	2.6e-121	432.2
Chy02g02178	.	55	549	Chloroplast and Mitochondria Gene Families	AT2G18710	85.7	3.2e-240	827.8

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0001994	2	2	3	3	2	2	3	2	2	2	2	2	3	2	2	3	2	2	3	2	2	2	2	2	2	2	2	3	2	1	66