Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Chy06g02160 ATGAGCTTTCAAGATATCGAGGCTGGTCGCCCCTTTGCTTCTTCGAGGAGAGACCTCATCAATGGCAAACAAGATCCTACGCAAGCTGTTGCTTCCGGTATATTTCAGATTAATACTGCTGTTGCTACGTTTCAAAGGCTTGTTAATACCTTAGGTACACCAAAGGATACGCCTGAGCTACGCGAGAAGCTGCACAAGACGAGGTTACATATTGGACAGTTGGTTAAAGACACCTCTGCTAAACTTAAACAAGCCAGCGATATAGATCATCATGCTGAAGTGAATGCCAGCAAGAAAATTGCAGATGCTAAACTTGCAAAAGATTTTCAAGCAGTGTTGAAAGAGTTTCAGAAGGCTCAACGACTTGCAGCCGAGAGGGAAACAGCATATTCACCTTTTGTTCCCCAAACTGTTCTACCTTCAAGCTACACAGCTTGGGAGGCAGATGCAAGCTCAGAAAAGAATCTCGAACAGCGTGCCCTTCTTGTGGAATCCAGGAGGCAAGAGGTCTTGCTGTTGGACAATGAAATAGCCTTCAATGAGGCAATAATTGAGGAAAGAGAGCAAGGCATTCATGAAATCCAGCAGCAAATTGGAGAAGTGAATGAAATTTTTAAAGATCTTGCAGTTCTAGTTCATGAACAGGGAGCCATGATTGATGATATTGGATCCAACATAGAGGGGGCACATGCTGCAACGTCACAGGGAACAACTCAGCTTGTAAAAGCTTCGAAGACACAAAGATCGAATTCATCTCTGGCTTGCTTACTTTTGGTGATATTTGGTATTATCCTCCTCATTGTGATCATAATAGTTGTTGCTTAA 825 43.03 MSFQDIEAGRPFASSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSAKLKQASDIDHHAEVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYSPFVPQTVLPSSYTAWEADASSEKNLEQRALLVESRRQEVLLLDNEIAFNEAIIEEREQGIHEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIEGAHAATSQGTTQLVKASKTQRSNSSLACLLLVIFGIILLIVIIIVVA* 275
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
6 25892952 25897081 - Chy6G126880.1 Chy06g02160 229869

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Chy06g02160 274 PANTHER SYNTAXIN OF PLANTS PROTEIN 5 272 - -
Chy06g02160 274 CDD SynN 24 138 IPR006011 GO:0016020
Chy06g02160 274 PANTHER SYNTAXIN 5 272 IPR045242 -
Chy06g02160 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Chy06g02160 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020|GO:0016192
Chy06g02160 274 CDD SNARE_Qa 184 242 - -
Chy06g02160 274 Pfam Syntaxin-like protein 31 130 IPR006011 GO:0016020
Chy06g02160 274 SMART tSNARE_6 176 243 IPR000727 -
Chy06g02160 274 Gene3D - 21 134 - -
Chy06g02160 274 Pfam SNARE domain 218 269 IPR000727 -
Chy06g02160 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484|GO:0006886|GO:0016020
Chy06g02160 274 Gene3D - 174 274 - -
Chy06g02160 274 SMART SynN_4 16 128 IPR006011 GO:0016020
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Chy06g02160 - - K08488 csv:101207682 461.84
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Chy04g01850 Chy-Chr4:24681494 Chy06g02160 Chy-Chr6:25892952 4.32E-10 dispersed
Chy05g01060 Chy-Chr5:15128760 Chy06g02160 Chy-Chr6:25892952 2.86E-10 dispersed
Chy06g02160 Chy-Chr6:25892952 Chy12g00974 Chy-Chr12:15035977 1.46E-08 dispersed
Chy06g02160 Chy-Chr6:25892952 Chy08g00980 Chy-Chr8:17055773 2.91E-09 transposed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Chy03g01173 . 476 779 SNARE and Associated Proteins AT3G24350 62.5 3.1e-90 328.9
Chy08g00517 . 1 310 SNARE and Associated Proteins AT1G08560 66.4 1.4e-99 359.8
Chy02g00640 . 1 303 SNARE and Associated Proteins AT2G18260 53.8 3.7e-84 308.5
Chy04g01850 . 22 279 SNARE and Associated Proteins AT3G11820 80.6 3.0e-113 405.2
Chy08g00980 . 25 284 SNARE and Associated Proteins AT3G11820 70.0 3.5e-98 355.1
Chy12g00974 . 31 281 SNARE and Associated Proteins AT3G11820 65.3 2.4e-91 332.4
Chy04g01397 . 21 280 SNARE and Associated Proteins AT3G11820 51.5 7.2e-67 251.1
Chy04g01850 . 31 279 SNARE and Associated Proteins AT3G52400 69.5 3.8e-90 328.6
Chy08g00980 . 36 284 SNARE and Associated Proteins AT3G52400 66.7 1.7e-85 313.2
Chy12g00974 . 1 281 SNARE and Associated Proteins AT3G52400 56.0 2.1e-80 296.2
Chy12g00974 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 4.0e-107 384.8
Chy04g01850 . 1 278 SNARE and Associated Proteins AT4G03330 56.9 1.9e-80 296.2
Chy08g00980 . 1 302 SNARE and Associated Proteins AT4G03330 54.0 1.8e-78 289.7
Chy04g01397 . 34 280 SNARE and Associated Proteins AT4G03330 54.7 9.1e-67 250.8
Chy12g00974 . 1 299 SNARE and Associated Proteins AT1G61290 79.6 1.2e-127 453.0
Chy04g01850 . 1 279 SNARE and Associated Proteins AT1G61290 62.6 2.2e-89 325.9
Chy08g00980 . 1 296 SNARE and Associated Proteins AT1G61290 55.7 1.3e-81 300.1
Chy04g01397 . 35 280 SNARE and Associated Proteins AT1G61290 50.4 6.7e-62 234.6
Chy12g00974 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 1.2e-124 443.0
Chy04g01850 . 1 279 SNARE and Associated Proteins AT1G11250 62.4 2.3e-91 332.4
Chy08g00980 . 1 296 SNARE and Associated Proteins AT1G11250 55.4 3.0e-83 305.4
Chy04g01397 . 35 280 SNARE and Associated Proteins AT1G11250 51.6 5.4e-64 241.5
Chy04g01397 . 3 299 SNARE and Associated Proteins AT3G03800 73.1 3.0e-110 395.2
Chy11g00597 . 42 297 SNARE and Associated Proteins AT3G03800 58.2 3.3e-77 285.4
Chy04g01397 . 3 198 SNARE and Associated Proteins AT5G08080 76.5 6.6e-75 277.3
Chy11g00597 . 24 214 SNARE and Associated Proteins AT5G08080 59.2 3.9e-51 198.4
Chy06g02160 . 1 256 SNARE and Associated Proteins AT5G16830 58.8 1.4e-74 276.6
Chy06g02160 . 1 256 SNARE and Associated Proteins AT5G46860 65.2 6.9e-79 290.8
Chy06g02160 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 3.3e-73 271.9
Chy06g02160 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 9.2e-52 201.1
Chy10g00436 . 1 336 SNARE and Associated Proteins AT5G05760 65.6 3.9e-111 398.3
Chy03g01173 . 476 779 SNARE and Associated Proteins AT3G24350 62.5 3.1e-90 328.9
Chy05g01060 . 1 317 SNARE and Associated Proteins AT5G26980 75.7 1.5e-123 439.5
Chy01g01727 . 1 310 SNARE and Associated Proteins AT5G26980 66.6 1.6e-101 366.3
Chy01g01727 . 1 309 SNARE and Associated Proteins AT4G02195 67.4 9.8e-104 373.6
Chy05g01060 . 1 317 SNARE and Associated Proteins AT4G02195 62.4 1.5e-99 359.8
Chy05g01060 . 1 317 SNARE and Associated Proteins AT3G05710 74.5 1.2e-125 446.4
Chy01g01727 . 1 310 SNARE and Associated Proteins AT3G05710 63.7 4.1e-97 351.7
Chy01g01059 . 1 234 SNARE and Associated Proteins AT1G16240 73.1 1.5e-90 329.3
Chy06g01863 . 4 231 SNARE and Associated Proteins AT1G16240 65.8 5.6e-77 284.3
Chy01g01059 . 1 234 SNARE and Associated Proteins AT1G79590 72.6 1.1e-89 326.6
Chy06g01863 . 4 231 SNARE and Associated Proteins AT1G79590 65.4 3.8e-77 285.0
Chy11g01970 . 106 260 SNARE and Associated Proteins AT1G28490 69.7 2.9e-53 205.3
Chy04g00793 . 1 261 SNARE and Associated Proteins AT3G09740 77.9 7.5e-110 393.7
Chy04g02075 . 1 235 SNARE and Associated Proteins AT3G09740 76.8 2.1e-96 349.0
Chy04g00793 . 1 261 SNARE and Associated Proteins AT3G45280 65.5 4.0e-87 318.2
Chy04g02075 . 1 230 SNARE and Associated Proteins AT3G45280 64.4 5.1e-74 274.6
Chy04g00793 . 1 261 SNARE and Associated Proteins AT3G61450 68.9 7.9e-96 347.1
Chy04g02075 . 1 235 SNARE and Associated Proteins AT3G61450 66.4 3.8e-82 301.6
Chy03g00164 . 65 309 SNARE and Associated Proteins AT1G51740 73.3 1.7e-92 335.9
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45