Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Chy10g00436 ATGGGTTCCGCTTATCGTGATCGGACGTCGGAATTTCGTTCACTATTGGAGACGCTGAAGAAGATTGGCGGAGCCACATCCGCCATCAATCAAGCTCAAAATGAACCATCGGCGTCTACGCCCTCCGGGTCCCCGGCCTTTGCACGATCAGAATTCAGCAAAAAGGCCTCCCGCATCGGATTAGGAATCCAAGATACCTCTCAGAAAATTGTGAGGCTCGCTCAGTTGGCGAAAAGATCATCAATGTTTGATGACCCAATCAGGGAAATACAGGAAATGACTGCTTTGATTAAGAATGATATTACATCCTTGAACGTAGCTATCACAGACTTGCAAACCATCCATAACATGGAGACAACAGAGGGGAATTCTTCAGAGGATAGAGTGGTTCATTCAACAGCTGTCTGTGATGATCTGAAGAGCAGACTTATGGGAGCTACAAAACAGCTACAAGATGTGCTAACCACAAGAACAGAGAATATCAAGGCCAATGAGAGCCGGAGGCAAATATTTTCTGCAAATGCATCTAGGGAAAGTCCTTTTCAAAATCAAGCCAAAGCTGTAACACAACCTCCACCTTGGTCAAGCAATACATCTGGAAGTGCCCAATCATCACTGTTGTCATCAAATGGAGCTCAAGTTGGGGGTCAATTGAGACGAAGGTTAGCTGTGGAGAACATGAACACCCCATCACAGCAAATGGAGATGTCGATGTTACAGCAGGTGGTTCCTAGGCAGGAAAATTATTCACAAAGTCGTGCAGTTGCTCTCCATAATGTGGAATCCACCATATCAGAACTCAGTGGAATTTTTTCACATCTTGCCACAATGGTAGCTCATCAAGGAGAACTTGCTATCAGGATTGATGACAATATGGACGAATCATTGGCAAATGTAGATGGCGCTCGGAGTGCTCTTTTAAGGCATCTTAGCCAGATATCATCAAATAGATGGCTTCTCATAAAAATATTTGCCATTTTAATTATTTTCTTGATGGTCTTTATTTTCTTGGCATAA 1017 43.56 MGSAYRDRTSEFRSLLETLKKIGGATSAINQAQNEPSASTPSGSPAFARSEFSKKASRIGLGIQDTSQKIVRLAQLAKRSSMFDDPIREIQEMTALIKNDITSLNVAITDLQTIHNMETTEGNSSEDRVVHSTAVCDDLKSRLMGATKQLQDVLTTRTENIKANESRRQIFSANASRESPFQNQAKAVTQPPPWSSNTSGSAQSSLLSSNGAQVGGQLRRRLAVENMNTPSQQMEMSMLQQVVPRQENYSQSRAVALHNVESTISELSGIFSHLATMVAHQGELAIRIDDNMDESLANVDGARSALLRHLSQISSNRWLLIKIFAILIIFLMVFIFLA* 339
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
10 10415137 10417817 - Chy10G176300.1 Chy10g00436 234811

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Chy10g00436 338 SUPERFAMILY t-snare proteins 49 302 IPR010989 GO:0016020|GO:0016192
Chy10g00436 338 PANTHER SYNTAXIN-31 4 337 - -
Chy10g00436 338 SMART tSNARE_6 242 309 IPR000727 -
Chy10g00436 338 MobiDBLite consensus disorder prediction 28 47 - -
Chy10g00436 338 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 247 309 IPR000727 -
Chy10g00436 338 CDD SNARE_syntaxin5 250 335 - -
Chy10g00436 338 Pfam Syntaxin-5 N-terminal, Sly1p-binding domain 6 21 IPR021538 -
Chy10g00436 338 Gene3D - 48 302 - -
Chy10g00436 338 Pfam SNARE domain 284 335 IPR000727 -
Chy10g00436 338 MobiDBLite consensus disorder prediction 173 211 - -
Chy10g00436 338 MobiDBLite consensus disorder prediction 28 48 - -
Chy10g00436 338 PANTHER SYNTAXIN 4 337 IPR045242 -
Chy10g00436 338 ProSitePatterns Syntaxin / epimorphin family signature. 253 292 IPR006012 GO:0005484|GO:0006886|GO:0016020
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Chy10g00436 K08490 STX5; syntaxin 5 - csv:101213786 595.89
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Chy03g01173 Chy-Chr3:14915132 Chy10g00436 Chy-Chr10:10415137 7.25E-87 dispersed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi13g19 . . . . . Bpe15g01148 . . Cmo04g00161 Cmo04g01191 Cma04g01124 Cma04g00161 Car04g00154 . . . Cpe01g00138 . . . . . . . Cla07g00385 Cam07g0410 Cec07g0462 Cco07g0418 Clacu07g0410 Cmu07g0454 Cre07g0761 . Cone5ag0210 . . . . Chy10g00436 Cme10g01057 . Blo04g00243 Bda14g00262 . . . . . . . . . . . . Cpe01g01046 . . . . . . . . . . . . . . . . Csa05g00800 . .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Chy03g01173 . 476 779 SNARE and Associated Proteins AT3G24350 62.5 3.1e-90 328.9
Chy08g00517 . 1 310 SNARE and Associated Proteins AT1G08560 66.4 1.4e-99 359.8
Chy02g00640 . 1 303 SNARE and Associated Proteins AT2G18260 53.8 3.7e-84 308.5
Chy04g01850 . 22 279 SNARE and Associated Proteins AT3G11820 80.6 3.0e-113 405.2
Chy08g00980 . 25 284 SNARE and Associated Proteins AT3G11820 70.0 3.5e-98 355.1
Chy12g00974 . 31 281 SNARE and Associated Proteins AT3G11820 65.3 2.4e-91 332.4
Chy04g01397 . 21 280 SNARE and Associated Proteins AT3G11820 51.5 7.2e-67 251.1
Chy04g01850 . 31 279 SNARE and Associated Proteins AT3G52400 69.5 3.8e-90 328.6
Chy08g00980 . 36 284 SNARE and Associated Proteins AT3G52400 66.7 1.7e-85 313.2
Chy12g00974 . 1 281 SNARE and Associated Proteins AT3G52400 56.0 2.1e-80 296.2
Chy12g00974 . 1 299 SNARE and Associated Proteins AT4G03330 67.9 4.0e-107 384.8
Chy04g01850 . 1 278 SNARE and Associated Proteins AT4G03330 56.9 1.9e-80 296.2
Chy08g00980 . 1 302 SNARE and Associated Proteins AT4G03330 54.0 1.8e-78 289.7
Chy04g01397 . 34 280 SNARE and Associated Proteins AT4G03330 54.7 9.1e-67 250.8
Chy12g00974 . 1 299 SNARE and Associated Proteins AT1G61290 79.6 1.2e-127 453.0
Chy04g01850 . 1 279 SNARE and Associated Proteins AT1G61290 62.6 2.2e-89 325.9
Chy08g00980 . 1 296 SNARE and Associated Proteins AT1G61290 55.7 1.3e-81 300.1
Chy04g01397 . 35 280 SNARE and Associated Proteins AT1G61290 50.4 6.7e-62 234.6
Chy12g00974 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 1.2e-124 443.0
Chy04g01850 . 1 279 SNARE and Associated Proteins AT1G11250 62.4 2.3e-91 332.4
Chy08g00980 . 1 296 SNARE and Associated Proteins AT1G11250 55.4 3.0e-83 305.4
Chy04g01397 . 35 280 SNARE and Associated Proteins AT1G11250 51.6 5.4e-64 241.5
Chy04g01397 . 3 299 SNARE and Associated Proteins AT3G03800 73.1 3.0e-110 395.2
Chy11g00597 . 42 297 SNARE and Associated Proteins AT3G03800 58.2 3.3e-77 285.4
Chy04g01397 . 3 198 SNARE and Associated Proteins AT5G08080 76.5 6.6e-75 277.3
Chy11g00597 . 24 214 SNARE and Associated Proteins AT5G08080 59.2 3.9e-51 198.4
Chy06g02160 . 1 256 SNARE and Associated Proteins AT5G16830 58.8 1.4e-74 276.6
Chy06g02160 . 1 256 SNARE and Associated Proteins AT5G46860 65.2 6.9e-79 290.8
Chy06g02160 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 3.3e-73 271.9
Chy06g02160 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 9.2e-52 201.1
Chy10g00436 . 1 336 SNARE and Associated Proteins AT5G05760 65.6 3.9e-111 398.3
Chy03g01173 . 476 779 SNARE and Associated Proteins AT3G24350 62.5 3.1e-90 328.9
Chy05g01060 . 1 317 SNARE and Associated Proteins AT5G26980 75.7 1.5e-123 439.5
Chy01g01727 . 1 310 SNARE and Associated Proteins AT5G26980 66.6 1.6e-101 366.3
Chy01g01727 . 1 309 SNARE and Associated Proteins AT4G02195 67.4 9.8e-104 373.6
Chy05g01060 . 1 317 SNARE and Associated Proteins AT4G02195 62.4 1.5e-99 359.8
Chy05g01060 . 1 317 SNARE and Associated Proteins AT3G05710 74.5 1.2e-125 446.4
Chy01g01727 . 1 310 SNARE and Associated Proteins AT3G05710 63.7 4.1e-97 351.7
Chy01g01059 . 1 234 SNARE and Associated Proteins AT1G16240 73.1 1.5e-90 329.3
Chy06g01863 . 4 231 SNARE and Associated Proteins AT1G16240 65.8 5.6e-77 284.3
Chy01g01059 . 1 234 SNARE and Associated Proteins AT1G79590 72.6 1.1e-89 326.6
Chy06g01863 . 4 231 SNARE and Associated Proteins AT1G79590 65.4 3.8e-77 285.0
Chy11g01970 . 106 260 SNARE and Associated Proteins AT1G28490 69.7 2.9e-53 205.3
Chy04g00793 . 1 261 SNARE and Associated Proteins AT3G09740 77.9 7.5e-110 393.7
Chy04g02075 . 1 235 SNARE and Associated Proteins AT3G09740 76.8 2.1e-96 349.0
Chy04g00793 . 1 261 SNARE and Associated Proteins AT3G45280 65.5 4.0e-87 318.2
Chy04g02075 . 1 230 SNARE and Associated Proteins AT3G45280 64.4 5.1e-74 274.6
Chy04g00793 . 1 261 SNARE and Associated Proteins AT3G61450 68.9 7.9e-96 347.1
Chy04g02075 . 1 235 SNARE and Associated Proteins AT3G61450 66.4 3.8e-82 301.6
Chy03g00164 . 65 309 SNARE and Associated Proteins AT1G51740 73.3 1.7e-92 335.9
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0006940 1 1 1 1 1 1 2 1 1 1 1 1 2 1 1 2 1 1 2 1 1 1 1 1 1 1 1 3 1 1 36
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Chy10g00436 Chy_Chr10 FPKM 0.0 0.0 0.508958 0.0 0.0 0.0 0.0 0.0 0.0 0.0