Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Cla03g01649 ATGGCGGATACTGAAACATTTGCCTTCCAGGCCGAGATTAATCAGCTTCTCAGTCTCATTATCAACACCTTTTACAGCAACAAGGAGATCTTCCTCCGAGAACTTATCAGCAATGCCTCCGATGCTCTAGATAAGATCCGATTCGAGAGCTTGACTGACAAGAGCAAGCTAGATGCTCAGCCTGAGCTCTTTATTCACATCATTCCTGATAAGGCAAACAACACATTGTCGATTATTGACAGTGGTATTGGAATGACCAAGGCTGATTTGGTGAACAATCTGGGTACCATTGCACGATCTGGGACCAAGGAATTCATGGAAGCTCTTGCAGCCGGTGCTGATGTGAGCATGATTGGTCAGTTTGGAGTTGGTTTCTACTCAGCCTACCTTGTGGCTGAAAAGGTTATTGTTACCACTAAACACAATGATGATGAGCAGTATGTTTGGGAGTCCCAAGCTGGGGGTTCGTTCACAGTCACCAGGGACACATCTGGTGAGAATCTTGGCCGAGGTACTAAGATTACCCTGTACCTCAAGGAAGATCAGCTTGAATACCTTGAGGAGCGTCGTCTCAAGGACTTGATCAAGAAGCACTCTGAGTTTATTAGCTACCCAATCTCTCTCTGGGTTGAGAAGACCATTGAGAAGGAAATCTCTGATGATGAAGATGAGGAAGAGAAGAAGGACGAGGAAGGAAAGGTTGAGGAAGTTGATGAAGAGAAGGAGAAGGAAGAAAAGAAAAAGAAGAAGATCAAGGAAGTTTCACATGAGTGGTCGTTAGTGAACAAACAGAAGCCTATCTGGATGAGGAAGCCAGAAGAGATTACGAAGGAAGAGTATGCTGCTTTCTACAAGAGCCTTACCAACGACTGGGAGGAGCATCTAGCCGTAAAGCACTTCTCTGTTGAAGGTCAATTGGAATTCAAGGCTATCCTCTTTGTTCCCAAGAGGGCTCCTTTTGATCTCTTCGACACAAAGAAGAAGCCGAACAACATTAAGTTGTATGTTCGCCGCGTCTTCATCATGGACAACTGTGAGGAATTGATTCCTGAATACCTTGGCTTTGTTAAGGGCATTGTCGACTCTGAGGATCTTCCCCTCAATATATCTAGAGAAATGTTGCAGCAGAACAAGATCTTGAAGGTCATCCGGAAGAACTTGGTCAAGAAGTGCCTTGAGCTCTTCTTTGAGATTGCCGAGAACAAAGAAGACTACAACAAGTTCTACGAGGCATTCTCCAAGAACTTGAAGCTTGGTATCCACGAGGATTCCCAGAACAGGCCTAAGATTGCTGAACTTCTCCGTTTCCACTCTACCAAGAGTGGTGATGAGTTGACCAGCCTGAAGGATTATGTGACCAGAATGAAGGAAGGCCAGAATGATATCTTTTACATCACTGGTGAAAGCAAGAAAGCTGTTGAAAATTCTCCTTTCCTTGAGAAGCTCAAGAAGAAGGGTTACGAAGTTCTGTTCATGGTTGATGCAATCGATGAGTACGCAGTTGGTCAGTTGAAGGAATTTGAAGGCAAGAAGCTTGTGTCAGCAACCAAGGAAGGTCTGAAACTTGATGAGAGTGAAGATGAAAAGAAGAAGAAGGAAGCTTTGAAGGAGAAGTTCGAGGGGCTATGCAAGGTGATAAAGGATGTTTTGGGCGACAAAGTTGAGAAGGTTGTTGTTTCTGACCGTGTTGTGGATTCTCCCTGCTGTTTGGTAACTGGTGAATATGGGTGGACAGCCAACATGGAACGAATCATGAAAGCTCAAGCATTGAAGGACAATAGCATGGCTGGTTACATGTCTAGCAAGAAGACGATGGAAATCAACCCTGAGAACCCCATCATGGAAGAGCTCAGGAAGAGGGCCGAGGTGGACAAGAACGACAAATCCGTTAAAGACCTTGTTCTCCTTCTCTTTGAGACTTCCCTTCTAACTTCCGGGTTCAGCCTTGACGACCCGAATACCTTTGGAAACAGAATTCACAGGATGTTGAAGCTCGGGTTAAGCATTGATGAGGAAGCTGGAGAGGGCGATTCTGAAATGCCTCCCCTTGAGGATGCCGATGCTGATGCAGAGGGTAGCAAGATGGAGGAGATACTGATCTCACGAAGTTGCTGGACGGATTCTGAAAATCTACGCAAGCGGCAGGAGATCTGGGCTACCTGGCGTTGGTCGGCGGTTTCTGGCAACAACCGGAGTGTTGCGGCAGAACTAGGAACGGGCGACGGTGGAGCTGGAGGTAGACGGCGGCAGAGTTGTGAACAGACGGGTTGGGAAGGCGAATCCAGGTTTTCTACTGAAGACGTATCTGCCCAGAATCAAGTCAAGGCATCAGTGCAACGGAAAATTCGGCAAAGCATAGCGGAAGAAAAAAATATTCTTAGAGAACACATCTGGGTTCGCACATTCACTTACTTCAGTTCTTCATCACTGACGGCTTTAGCAAATGTTTGTCCTATTTGGTTTGCAGATCCCAACATTATGAGAAAATTACAAGTAGACAGAGGTGCAATAAAGTTTGTCCTTGCTGGTGCTAACATAATGTGCCCTGGTCTTACATCTCCTGGGGGTGCCTTGGACGATGAAGTTGAAGCGGAAACACCTGTGGCAATAATGGCGGAAGGGAAGCAACATGCTCTTGCTATTGGCTTCACAAAGATGTCAGCTAAGGAAATAAGGGCAACGAACAAAGGGATCGGAGTGGACAATATGCATTACCTTAACGACGGTCTTTGGAAGGGGATCGATCTCGTAGCAGGAGGTAAGAGTAAGAAGACCAAGAGAACTGCACCCAAGTCTGATGATATCTACCTAAAGTTACTCGTCAAGCTTTACCGCTTCCTTGTCCGTCGGACTGGAAGCAATTTCAATGCTGTGATTCTCAAGCGCTTGTTTATGAGCAAGGTTAACAAGCCTCCACTTTCGCTGTCTAGGCTTATCCAGTTCATGAAAGGAAAGGAAAGTAAGATTGCAGTTGTTGTTGGGACTATTACCGATGATATTCGTGTCTATGAAGTCCCAGCATTGAAAGTTGCTGCTCTGAGGTTTACTGAGACAGCAAGGGCAAGGATCGAAAAGGCTGGTGGGGAATGTTTGACATTTGACCAGCTTGCTTTGAGGGCTCCTCTGGGTCAGAACACGGTTCTTCTTAGAGGTCCTAAGAACTCTCGGGAGGCAGTGAAGCATTTCGGTCCGGCACCTGGTGTACCACACAGCCATTCCAAGCCATATGTGAGGTCCAAGGGAAGGAAGTTTGAGAGGGCTAGAGGAAAGAGAAACAGCAGGGGATATAGGGTTTGA 3297 46.22 MADTETFAFQAEINQLLSLIINTFYSNKEIFLRELISNASDALDKIRFESLTDKSKLDAQPELFIHIIPDKANNTLSIIDSGIGMTKADLVNNLGTIARSGTKEFMEALAAGADVSMIGQFGVGFYSAYLVAEKVIVTTKHNDDEQYVWESQAGGSFTVTRDTSGENLGRGTKITLYLKEDQLEYLEERRLKDLIKKHSEFISYPISLWVEKTIEKEISDDEDEEEKKDEEGKVEEVDEEKEKEEKKKKKIKEVSHEWSLVNKQKPIWMRKPEEITKEEYAAFYKSLTNDWEEHLAVKHFSVEGQLEFKAILFVPKRAPFDLFDTKKKPNNIKLYVRRVFIMDNCEELIPEYLGFVKGIVDSEDLPLNISREMLQQNKILKVIRKNLVKKCLELFFEIAENKEDYNKFYEAFSKNLKLGIHEDSQNRPKIAELLRFHSTKSGDELTSLKDYVTRMKEGQNDIFYITGESKKAVENSPFLEKLKKKGYEVLFMVDAIDEYAVGQLKEFEGKKLVSATKEGLKLDESEDEKKKKEALKEKFEGLCKVIKDVLGDKVEKVVVSDRVVDSPCCLVTGEYGWTANMERIMKAQALKDNSMAGYMSSKKTMEINPENPIMEELRKRAEVDKNDKSVKDLVLLLFETSLLTSGFSLDDPNTFGNRIHRMLKLGLSIDEEAGEGDSEMPPLEDADADAEGSKMEEILISRSCWTDSENLRKRQEIWATWRWSAVSGNNRSVAAELGTGDGGAGGRRRQSCEQTGWEGESRFSTEDVSAQNQVKASVQRKIRQSIAEEKNILREHIWVRTFTYFSSSSLTALANVCPIWFADPNIMRKLQVDRGAIKFVLAGANIMCPGLTSPGGALDDEVEAETPVAIMAEGKQHALAIGFTKMSAKEIRATNKGIGVDNMHYLNDGLWKGIDLVAGGKSKKTKRTAPKSDDIYLKLLVKLYRFLVRRTGSNFNAVILKRLFMSKVNKPPLSLSRLIQFMKGKESKIAVVVGTITDDIRVYEVPALKVAALRFTETARARIEKAGGECLTFDQLALRAPLGQNTVLLRGPKNSREAVKHFGPAPGVPHSHSKPYVRSKGRKFERARGKRNSRGYRV 1098
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
3 32361471 32378894 - ClCG03G017220.2 Cla03g01649 270149

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Cla03g01649 1098 Gene3D - 262 430 - -
Cla03g01649 1098 Gene3D - 2 230 IPR036890 -
Cla03g01649 1098 CDD HATPase_Hsp90-like 14 202 - -
Cla03g01649 1098 SUPERFAMILY ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase 5 212 IPR036890 -
Cla03g01649 1098 Pfam Ribosomal protein 60S L18 and 50S L18e 913 1098 IPR021131 -
Cla03g01649 1098 Gene3D - 518 667 IPR037196 -
Cla03g01649 1098 Pfam Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase 27 181 IPR003594 -
Cla03g01649 1098 Pfam PUA domain 829 906 IPR002478 GO:0003723
Cla03g01649 1098 PRINTS 90kDa heat shock protein signature 170 187 IPR020575 -
Cla03g01649 1098 PRINTS 90kDa heat shock protein signature 5 25 IPR020575 -
Cla03g01649 1098 PRINTS 90kDa heat shock protein signature 75 92 IPR020575 -
Cla03g01649 1098 PRINTS 90kDa heat shock protein signature 188 206 IPR020575 -
Cla03g01649 1098 PRINTS 90kDa heat shock protein signature 26 48 IPR020575 -
Cla03g01649 1098 PRINTS 90kDa heat shock protein signature 93 110 IPR020575 -
Cla03g01649 1098 PRINTS 90kDa heat shock protein signature 118 140 IPR020575 -
Cla03g01649 1098 Coils Coil 522 542 - -
Cla03g01649 1098 MobiDBLite consensus disorder prediction 1061 1098 - -
Cla03g01649 1098 Gene3D - 763 913 - -
Cla03g01649 1098 ProSiteProfiles PUA domain profile. 827 907 - -
Cla03g01649 1098 PANTHER HEAT SHOCK PROTEIN 90 FAMILY MEMBER 1 697 IPR001404 GO:0005524|GO:0006457|GO:0016887|GO:0051082|GO:0140662
Cla03g01649 1098 Hamap Chaperone protein HtpG [htpG]. 2 664 IPR001404 GO:0005524|GO:0006457|GO:0016887|GO:0051082|GO:0140662
Cla03g01649 1098 ProSitePatterns Heat shock hsp90 proteins family signature. 25 34 IPR019805 GO:0005524|GO:0006457|GO:0051082
Cla03g01649 1098 MobiDBLite consensus disorder prediction 736 766 - -
Cla03g01649 1098 Gene3D - 914 1098 - -
Cla03g01649 1098 Gene3D - 431 517 - -
Cla03g01649 1098 SMART pua_5 828 907 IPR002478 GO:0003723
Cla03g01649 1098 SUPERFAMILY Ribosomal protein S5 domain 2-like 263 518 IPR020568 -
Cla03g01649 1098 MobiDBLite consensus disorder prediction 219 248 - -
Cla03g01649 1098 MobiDBLite consensus disorder prediction 219 238 - -
Cla03g01649 1098 SMART HKATPase_4 27 182 IPR003594 -
Cla03g01649 1098 SUPERFAMILY PUA domain-like 827 911 IPR015947 -
Cla03g01649 1098 SUPERFAMILY HSP90 C-terminal domain 542 663 IPR037196 -
Cla03g01649 1098 SUPERFAMILY Ribosomal proteins L15p and L18e 931 1050 IPR036227 -
Cla03g01649 1098 TIGRFAM unchar_dom_2: uncharacterized domain 2 829 908 IPR004521 GO:0003723
Cla03g01649 1098 Coils Coil 220 257 - -
Cla03g01649 1098 Pfam Hsp90 protein 184 682 IPR001404 GO:0005524|GO:0006457|GO:0016887|GO:0051082|GO:0140662
Cla03g01649 1098 MobiDBLite consensus disorder prediction 1075 1098 - -
Cla03g01649 1098 PANTHER HEAT SHOCK PROTEIN 81-2 1 697 - -
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cla03g01649 K04079 HSP90A, htpG; molecular chaperone HtpG - csv:101221822 1221.84
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cla02g00916 Cla-Chr2:13900794 Cla03g01649 Cla-Chr3:32361471 2.61E-159 dispersed
Cla02g01506 Cla-Chr2:29608592 Cla03g01649 Cla-Chr3:32361471 4.80E-120 dispersed
Cla03g01649 Cla-Chr3:32361471 Cla03g01651 Cla-Chr3:32405652 0 dispersed
Cla03g01649 Cla-Chr3:32361471 Cla03g01650 Cla-Chr3:32387147 0 tandem
       

Deco-Alignment


Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi14g157 . . . . . . . . Cmo10g01211 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cma11g01197 . . Cpe04g00214 . . . . . . . . Cla03g01649 Cam03g1738 Cec03g1788 Cco03g1793 Clacu03g1759 Cmu03g2309 Cre03g1989 . . . .
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cla10g01063 CCT,ECH 105 306 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 84.2 2.3e-86 315.5
Cla09g00526 CCT,ECH 1 275 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 64.4 7.6e-82 300.4
Cla06g01413 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 68.7 2.0e-58 222.6
Cla10g01063 CCT,ECH 105 316 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 82.5 3.9e-86 314.7
Cla09g00526 CCT,ECH 1 275 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 65.5 8.3e-81 297.0
Cla06g01413 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 71.7 1.8e-59 226.1
Cla10g01063 CCT,ECH 105 317 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 83.1 2.8e-87 318.5
Cla09g00526 CCT,ECH 1 275 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 64.4 5.9e-82 300.8
Cla06g01413 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 71.7 3.2e-59 225.3
Cla08g00265 . 234 529 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 75.2 6.4e-119 424.1
Cla07g01366 . 9 317 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 68.7 2.6e-112 402.1
Cla07g00861 . 9 336 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 63.1 4.7e-106 381.3
Cla08g00265 . 242 510 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 76.7 1.5e-114 409.5
Cla07g01366 . 4 261 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 78.0 2.7e-111 398.7
Cla07g00861 . 5 336 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 62.2 1.7e-105 379.4
Cla04g00340 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G58380 88.0 9.2e-115 410.2
Cla10g01583 . 34 258 Cytoplasmic Ribosomal Protein Gene Family AT1G58380 88.0 9.2e-115 410.2
Cla04g00340 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G59359 88.0 9.2e-115 410.2
Cla10g01583 . 34 258 Cytoplasmic Ribosomal Protein Gene Family AT1G59359 88.0 9.2e-115 410.2
Cla10g01583 . 1 267 Cytoplasmic Ribosomal Protein Gene Family AT2G41840 82.7 6.4e-116 414.1
Cla04g00340 . 36 259 Cytoplasmic Ribosomal Protein Gene Family AT2G41840 88.4 1.6e-114 409.5
Cla04g00340 . 37 260 Cytoplasmic Ribosomal Protein Gene Family AT3G57490 89.8 1.6e-116 416.0
Cla10g01583 . 34 257 Cytoplasmic Ribosomal Protein Gene Family AT3G57490 89.8 1.6e-116 416.0
Cla04g00340 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G58684 88.0 9.2e-115 410.2
Cla10g01583 . 34 258 Cytoplasmic Ribosomal Protein Gene Family AT1G58684 88.0 9.2e-115 410.2
Cla04g00340 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G58983 88.0 9.2e-115 410.2
Cla10g01583 . 34 258 Cytoplasmic Ribosomal Protein Gene Family AT1G58983 88.0 9.2e-115 410.2
Cla09g00084 . 1 232 Cytoplasmic Ribosomal Protein Gene Family AT2G31610 87.1 3.2e-111 398.3
Cla11g00140 . 686 901 Cytoplasmic Ribosomal Protein Gene Family AT2G31610 91.7 1.6e-110 396.0
Cla11g00140 . 686 904 Cytoplasmic Ribosomal Protein Gene Family AT3G53870 92.2 1.1e-111 399.8
Cla09g00084 . 1 225 Cytoplasmic Ribosomal Protein Gene Family AT3G53870 90.2 1.1e-111 399.8
Cla09g00084 . 1 233 Cytoplasmic Ribosomal Protein Gene Family AT5G35530 87.6 2.0e-113 405.6
Cla11g00140 . 686 921 Cytoplasmic Ribosomal Protein Gene Family AT5G35530 87.3 2.9e-112 401.7
Cla05g00516 CCT,ECH 1 261 Cytoplasmic Ribosomal Protein Gene Family AT3G04840 86.3 3.9e-128 454.5
Cla06g00602 CCT,ECH 173 432 Cytoplasmic Ribosomal Protein Gene Family AT3G04840 85.1 1.5e-124 442.6
Cla05g00516 CCT,ECH 1 261 Cytoplasmic Ribosomal Protein Gene Family AT4G34670 86.6 5.1e-128 454.1
Cla06g00602 CCT,ECH 173 432 Cytoplasmic Ribosomal Protein Gene Family AT4G34670 85.5 2.0e-124 442.2
Cla07g00425 . 34 214 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 91.7 2.8e-96 348.2
Cla09g00983 . 174 352 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 89.9 1.5e-94 342.4
Cla07g00425 . 52 294 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 93.0 3.2e-132 468.0
Cla09g00983 . 190 432 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 92.2 7.1e-132 466.8
Cla07g00425 . 34 294 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 93.5 1.9e-143 505.4
Cla09g00983 . 174 432 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 92.3 1.4e-141 499.2
Cla09g01451 . 2 207 Cytoplasmic Ribosomal Protein Gene Family AT2G37270 87.9 6.8e-99 357.1
Cla11g00101 . 62 266 Cytoplasmic Ribosomal Protein Gene Family AT2G37270 88.3 2.0e-98 355.5
Cla09g01451 . 2 207 Cytoplasmic Ribosomal Protein Gene Family AT3G11940 87.9 5.7e-98 354.0
Cla11g00101 . 62 266 Cytoplasmic Ribosomal Protein Gene Family AT3G11940 88.3 1.7e-97 352.4
Cla08g01122 . 296 482 Cytoplasmic Ribosomal Protein Gene Family AT4G31700 88.8 1.5e-84 309.3
Cla05g00049 . 99 264 Cytoplasmic Ribosomal Protein Gene Family AT4G31700 80.3 1.0e-69 260.0
Cla01g01820 . 48 199 Cytoplasmic Ribosomal Protein Gene Family AT4G31700 65.0 9.0e-50 193.7
Cla08g01122 . 234 482 Cytoplasmic Ribosomal Protein Gene Family AT5G10360 71.9 6.0e-89 323.9
Cla05g00049 . 37 264 Cytoplasmic Ribosomal Protein Gene Family AT5G10360 70.1 2.3e-80 295.4
Cla01g01820 . 1 199 Cytoplasmic Ribosomal Protein Gene Family AT5G10360 56.1 6.7e-48 187.6
Cla06g01461 . 1 191 Cytoplasmic Ribosomal Protein Gene Family AT1G48830 81.2 5.1e-85 310.8
Cla04g01090 CCT,ECH 306 496 Cytoplasmic Ribosomal Protein Gene Family AT1G48830 78.5 8.2e-83 303.5
Cla06g01461 . 1 191 Cytoplasmic Ribosomal Protein Gene Family AT3G02560 79.1 1.3e-83 306.2
Cla04g01090 CCT,ECH 306 496 Cytoplasmic Ribosomal Protein Gene Family AT3G02560 78.5 2.0e-81 298.9
Cla06g01461 . 1 188 Cytoplasmic Ribosomal Protein Gene Family AT5G16130 78.7 1.5e-81 299.3
Cla04g01090 CCT,ECH 306 493 Cytoplasmic Ribosomal Protein Gene Family AT5G16130 79.8 1.7e-80 295.8
Cla08g00607 . 1 217 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 86.4 8.8e-97 350.1
Cla11g01181 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 82.8 7.5e-96 347.1
Cla07g01489 . 76 291 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 77.4 3.7e-95 344.7
Cla11g01181 . 1 219 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 84.0 2.4e-99 358.6
Cla07g01489 . 76 294 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 84.0 3.1e-99 358.2
Cla08g00607 . 1 220 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 84.1 4.0e-99 357.8
Cla05g02453 . 1 137 Cytoplasmic Ribosomal Protein Gene Family AT5G15200 92.0 3.9e-67 251.1
Cla08g00104 . 1 137 Cytoplasmic Ribosomal Protein Gene Family AT5G15200 91.2 8.8e-67 250.0
Cla05g02453 . 1 197 Cytoplasmic Ribosomal Protein Gene Family AT5G39850 91.4 2.0e-100 362.1
Cla08g00104 . 1 197 Cytoplasmic Ribosomal Protein Gene Family AT5G39850 90.9 4.5e-100 360.9
Cla07g00759 CCT,ECH 37 215 Cytoplasmic Ribosomal Protein Gene Family AT4G25740 65.4 1.2e-52 203.0
Cla01g00233 CCT,ECH 4 187 Cytoplasmic Ribosomal Protein Gene Family AT4G25740 60.3 3.4e-52 201.4
Cla01g00233 CCT,ECH 48 155 Cytoplasmic Ribosomal Protein Gene Family AT5G41520 75.0 5.1e-39 157.5
Cla01g00233 CCT,ECH 4 130 Cytoplasmic Ribosomal Protein Gene Family AT5G52650 83.6 1.9e-57 219.2
Cla07g00759 CCT,ECH 37 160 Cytoplasmic Ribosomal Protein Gene Family AT5G52650 75.2 1.5e-46 183.0
Cla02g00339 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT3G48930 89.4 8.4e-81 296.6
Cla08g01347 . 38 198 Cytoplasmic Ribosomal Protein Gene Family AT3G48930 87.0 3.9e-78 287.7
Cla02g00339 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT4G30800 89.3 5.4e-80 293.9
Cla08g01347 . 38 198 Cytoplasmic Ribosomal Protein Gene Family AT4G30800 87.0 4.3e-77 284.3
Cla02g00339 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT5G23740 89.3 1.1e-80 296.2
Cla08g01347 . 38 198 Cytoplasmic Ribosomal Protein Gene Family AT5G23740 87.6 3.9e-78 287.7
Cla11g00351 . 13 149 Cytoplasmic Ribosomal Protein Gene Family AT1G15930 72.9 2.8e-51 198.4
Cla09g00293 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT1G15930 70.6 6.2e-51 197.2
Cla09g00293 . 12 140 Cytoplasmic Ribosomal Protein Gene Family AT2G32060 74.4 5.6e-52 200.7
Cla11g00351 . 13 149 Cytoplasmic Ribosomal Protein Gene Family AT2G32060 71.4 2.8e-51 198.4
Cla06g00039 . 1 178 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 79.8 6.7e-72 266.9
Cla01g00350 . 40 182 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 90.9 4.8e-70 260.8
Cla10g00294 . 4 142 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 92.8 3.1e-69 258.1
Cla06g00039 . 1 178 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 80.3 3.0e-72 268.1
Cla01g00350 . 40 182 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 91.6 2.2e-70 261.9
Cla10g00294 . 4 142 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 92.8 3.1e-69 258.1
Cla03g00664 . 552 700 Cytoplasmic Ribosomal Protein Gene Family AT2G36160 92.6 8.4e-75 276.6
Cla10g01785 . 508 681 Cytoplasmic Ribosomal Protein Gene Family AT2G36160 74.7 5.5e-66 247.3
Cla03g00664 . 552 700 Cytoplasmic Ribosomal Protein Gene Family AT3G11510 94.0 1.3e-75 279.3
Cla10g01785 . 508 681 Cytoplasmic Ribosomal Protein Gene Family AT3G11510 75.9 8.4e-67 250.0
Cla03g00664 . 552 700 Cytoplasmic Ribosomal Protein Gene Family AT3G52580 91.9 1.4e-74 275.8
Cla10g01785 . 508 681 Cytoplasmic Ribosomal Protein Gene Family AT3G52580 75.3 1.9e-66 248.8
Cla06g00638 CCT 1 153 Cytoplasmic Ribosomal Protein Gene Family AT1G04270 89.5 6.7e-72 266.9
Cla05g00485 CCT 1 170 Cytoplasmic Ribosomal Protein Gene Family AT1G04270 81.8 3.3e-71 264.6
Cla06g00638 CCT 1 153 Cytoplasmic Ribosomal Protein Gene Family AT5G09490 81.7 3.2e-66 248.1
Cla05g00485 CCT 1 170 Cytoplasmic Ribosomal Protein Gene Family AT5G09490 74.1 5.2e-64 240.7
Cla06g00638 CCT 1 153 Cytoplasmic Ribosomal Protein Gene Family AT5G09500 85.6 3.8e-67 251.1
Cla05g00485 CCT 7 170 Cytoplasmic Ribosomal Protein Gene Family AT5G09500 79.9 1.9e-66 248.8
Cla06g00638 CCT 36 153 Cytoplasmic Ribosomal Protein Gene Family AT5G09510 94.1 3.9e-59 224.2
Cla05g00485 CCT 37 170 Cytoplasmic Ribosomal Protein Gene Family AT5G09510 82.8 5.3e-56 213.8
Cla06g00638 CCT 4 153 Cytoplasmic Ribosomal Protein Gene Family AT5G43640 85.3 5.4e-66 247.3
Cla05g00485 CCT 12 170 Cytoplasmic Ribosomal Protein Gene Family AT5G43640 79.9 2.3e-64 241.9
Cla06g00638 CCT 16 153 Cytoplasmic Ribosomal Protein Gene Family AT5G63070 65.3 4.3e-45 177.9
Cla05g00485 CCT 1 170 Cytoplasmic Ribosomal Protein Gene Family AT5G63070 56.8 9.7e-45 176.8
Cla03g00186 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT1G07770 96.9 4.1e-70 260.8
Cla09g01957 . 61 190 Cytoplasmic Ribosomal Protein Gene Family AT1G07770 96.9 4.1e-70 260.8
Cla03g00186 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT2G39590 90.0 3.4e-64 241.1
Cla09g01957 . 61 190 Cytoplasmic Ribosomal Protein Gene Family AT2G39590 90.0 3.4e-64 241.1
Cla03g00186 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT3G46040 96.9 4.1e-70 260.8
Cla09g01957 . 61 190 Cytoplasmic Ribosomal Protein Gene Family AT3G46040 96.9 4.1e-70 260.8
Cla03g00186 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT5G59850 96.9 4.1e-70 260.8
Cla09g01957 . 61 190 Cytoplasmic Ribosomal Protein Gene Family AT5G59850 96.9 4.1e-70 260.8
Cla02g00608 . 4 145 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 88.0 2.7e-70 261.5
Cla05g01055 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 89.2 1.0e-69 259.6
Cla05g01086 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 89.2 1.0e-69 259.6
Cla02g00608 . 4 145 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 83.8 5.3e-66 247.3
Cla05g01055 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 84.9 1.2e-65 246.1
Cla05g01086 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 84.9 1.2e-65 246.1
Cla02g00608 . 4 114 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 84.7 4.2e-52 201.1
Cla05g01055 . 6 113 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 86.1 1.6e-51 199.1
Cla05g01086 . 6 113 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 86.1 1.6e-51 199.1
Cla08g00846 . 1 141 Cytoplasmic Ribosomal Protein Gene Family AT2G04390 85.9 6.1e-59 223.8
Cla10g01769 . 29 150 Cytoplasmic Ribosomal Protein Gene Family AT2G04390 89.3 3.5e-54 208.0
Cla08g00846 . 1 141 Cytoplasmic Ribosomal Protein Gene Family AT2G05220 86.6 1.0e-58 223.0
Cla10g01769 . 29 163 Cytoplasmic Ribosomal Protein Gene Family AT2G05220 82.2 2.6e-54 208.4
Cla08g00846 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT3G10610 84.3 1.6e-59 225.7
Cla10g01769 . 29 149 Cytoplasmic Ribosomal Protein Gene Family AT3G10610 88.4 1.7e-53 205.7
Cla08g00846 . 1 141 Cytoplasmic Ribosomal Protein Gene Family AT5G04800 87.3 2.5e-60 228.4
Cla10g01769 . 29 162 Cytoplasmic Ribosomal Protein Gene Family AT5G04800 82.8 7.0e-55 210.3
Cla08g00749 CCT 1315 1462 Cytoplasmic Ribosomal Protein Gene Family AT1G22780 95.3 1.3e-78 289.3
Cla09g00951 CCT 88 217 Cytoplasmic Ribosomal Protein Gene Family AT1G22780 95.4 1.6e-68 255.8
Cla08g00749 CCT 1315 1462 Cytoplasmic Ribosomal Protein Gene Family AT1G34030 95.3 1.3e-78 289.3
Cla09g00951 CCT 88 217 Cytoplasmic Ribosomal Protein Gene Family AT1G34030 95.4 1.6e-68 255.8
Cla08g00749 CCT 1315 1462 Cytoplasmic Ribosomal Protein Gene Family AT4G09800 95.3 1.3e-78 289.3
Cla09g00951 CCT 88 217 Cytoplasmic Ribosomal Protein Gene Family AT4G09800 95.4 1.6e-68 255.8
Cla11g00440 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT3G02080 85.3 1.7e-69 258.8
Cla09g00641 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT3G02080 83.2 1.5e-68 255.8
Cla11g00440 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT5G15520 87.1 5.6e-68 253.8
Cla09g00641 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT5G15520 84.9 4.7e-67 250.8
Cla11g00440 . 1 142 Cytoplasmic Ribosomal Protein Gene Family AT5G61170 86.6 3.9e-69 257.7
Cla09g00641 . 1 142 Cytoplasmic Ribosomal Protein Gene Family AT5G61170 84.5 3.3e-68 254.6
Cla01g00507 CCT 2 121 Cytoplasmic Ribosomal Protein Gene Family AT3G45030 90.8 4.7e-55 210.7
Cla05g00807 CCT 2 121 Cytoplasmic Ribosomal Protein Gene Family AT3G45030 90.8 4.7e-55 210.7
Cla01g00507 CCT 1 121 Cytoplasmic Ribosomal Protein Gene Family AT3G47370 91.7 4.2e-56 214.2
Cla05g00807 CCT 1 121 Cytoplasmic Ribosomal Protein Gene Family AT3G47370 91.7 4.2e-56 214.2
Cla01g00507 CCT 2 121 Cytoplasmic Ribosomal Protein Gene Family AT5G62300 90.8 4.7e-55 210.7
Cla05g00807 CCT 2 121 Cytoplasmic Ribosomal Protein Gene Family AT5G62300 90.8 4.7e-55 210.7
Cla02g02035 . 62 202 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.3 2.7e-70 261.5
Cla09g01988 . 8 148 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.3 3.5e-70 261.2
Cla10g01953 . 681 820 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 93.6 5.0e-69 257.3
Cla02g02035 . 62 202 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.5 7.5e-73 270.0
Cla09g01988 . 8 148 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.5 9.7e-73 269.6
Cla10g01953 . 681 820 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 95.7 1.4e-71 265.8
Cla02g01612 . 68 170 Cytoplasmic Ribosomal Protein Gene Family AT3G04920 85.6 4.7e-46 180.6
Cla06g00899 . 84 186 Cytoplasmic Ribosomal Protein Gene Family AT3G04920 84.6 4.0e-45 177.6
Cla02g01612 . 68 175 Cytoplasmic Ribosomal Protein Gene Family AT5G28060 88.0 2.6e-51 198.4
Cla06g00899 . 84 191 Cytoplasmic Ribosomal Protein Gene Family AT5G28060 87.0 2.2e-50 195.3
Cla04g00067 . 27 108 Cytoplasmic Ribosomal Protein Gene Family AT2G21580 92.7 1.7e-37 152.1
Cla04g00067 . 1 107 Cytoplasmic Ribosomal Protein Gene Family AT4G34555 91.6 3.2e-39 157.9
Cla03g01585 . 1 107 Cytoplasmic Ribosomal Protein Gene Family AT4G34555 86.9 3.9e-37 151.0
Cla11g00548 CCT,ECH 1 119 Cytoplasmic Ribosomal Protein Gene Family AT2G40510 85.7 8.6e-55 209.9
Cla07g00478 CCT,ECH 5 127 Cytoplasmic Ribosomal Protein Gene Family AT2G40510 84.6 8.6e-55 209.9
Cla11g00548 CCT,ECH 1 125 Cytoplasmic Ribosomal Protein Gene Family AT2G40590 83.2 5.0e-55 210.7
Cla07g00478 CCT,ECH 5 127 Cytoplasmic Ribosomal Protein Gene Family AT2G40590 84.6 5.0e-55 210.7
Cla11g00548 CCT,ECH 1 126 Cytoplasmic Ribosomal Protein Gene Family AT3G56340 84.9 2.9e-55 211.5
Cla07g00478 CCT,ECH 5 125 Cytoplasmic Ribosomal Protein Gene Family AT3G56340 85.1 2.4e-54 208.4
Cla06g00153 . 57 140 Cytoplasmic Ribosomal Protein Gene Family AT2G45710 94.0 1.3e-43 172.2
Cla01g00774 . 1 84 Cytoplasmic Ribosomal Protein Gene Family AT2G45710 92.9 2.8e-43 171.0
Cla06g00153 . 57 142 Cytoplasmic Ribosomal Protein Gene Family AT3G61110 97.7 1.6e-46 181.8
Cla01g00774 . 1 86 Cytoplasmic Ribosomal Protein Gene Family AT3G61110 96.5 3.6e-46 180.6
Cla01g00774 . 1 84 Cytoplasmic Ribosomal Protein Gene Family AT5G47930 94.0 8.2e-43 169.5
Cla06g00153 . 57 140 Cytoplasmic Ribosomal Protein Gene Family AT5G47930 92.9 1.8e-42 168.3
Cla05g02554 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT1G23410 83.0 9.7e-66 246.5
Cla08g01745 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G23410 82.9 2.2e-65 245.4
Cla05g02554 . 1 156 Cytoplasmic Ribosomal Protein Gene Family AT3G62250 95.5 9.1e-72 266.5
Cla08g01745 . 1 154 Cytoplasmic Ribosomal Protein Gene Family AT3G62250 95.5 5.9e-71 263.8
Cla07g00384 . 1 359 Cytoplasmic Ribosomal Protein Gene Family AT2G40010 69.6 1.3e-128 456.4
Cla03g00079 . 1 279 Cytoplasmic Ribosomal Protein Gene Family AT2G40010 81.0 2.4e-127 452.2
Cla03g00079 . 2 279 Cytoplasmic Ribosomal Protein Gene Family AT3G09200 71.2 1.2e-106 383.3
Cla07g00384 . 3 359 Cytoplasmic Ribosomal Protein Gene Family AT3G09200 61.3 3.5e-106 381.7
Cla03g00079 . 2 278 Cytoplasmic Ribosomal Protein Gene Family AT3G11250 81.2 6.3e-128 454.1
Cla07g00384 . 3 350 Cytoplasmic Ribosomal Protein Gene Family AT3G11250 70.7 3.1e-127 451.8
Cla08g00211 . 1 426 Cytoplasmic Ribosomal Protein Gene Family AT1G43170 77.7 4.4e-192 667.5
Cla11g01300 . 1 431 Cytoplasmic Ribosomal Protein Gene Family AT1G43170 74.0 4.2e-187 651.0
Cla11g01300 . 1 430 Cytoplasmic Ribosomal Protein Gene Family AT1G61580 78.1 4.7e-194 674.1
Cla08g00211 . 1 428 Cytoplasmic Ribosomal Protein Gene Family AT1G61580 78.6 1.5e-192 669.1
Cla10g01960 . 1 406 Cytoplasmic Ribosomal Protein Gene Family AT3G09630 83.0 5.4e-193 670.6
Cla04g00865 . 2 423 Cytoplasmic Ribosomal Protein Gene Family AT3G09630 80.3 1.0e-191 666.4
Cla10g01960 . 1 406 Cytoplasmic Ribosomal Protein Gene Family AT5G02870 83.0 3.7e-194 674.5
Cla04g00865 . 2 423 Cytoplasmic Ribosomal Protein Gene Family AT5G02870 79.9 3.9e-191 664.5
Cla11g01318 . 1 286 Cytoplasmic Ribosomal Protein Gene Family AT3G25520 82.2 5.5e-134 474.2
Cla08g01019 . 37 335 Cytoplasmic Ribosomal Protein Gene Family AT3G25520 77.3 2.6e-131 465.3
Cla11g01318 . 1 286 Cytoplasmic Ribosomal Protein Gene Family AT5G39740 81.1 6.7e-132 467.2
Cla08g01019 . 37 335 Cytoplasmic Ribosomal Protein Gene Family AT5G39740 77.3 3.3e-131 464.9
Cla09g00354 CCT 2 231 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 83.0 3.9e-103 371.3
Cla10g01196 CCT 2 266 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 70.6 1.4e-97 352.8
Cla04g00030 . 2 217 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 81.5 3.5e-96 348.2
Cla09g00354 CCT 7 231 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 84.0 3.3e-102 368.2
Cla10g01196 CCT 4 266 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 71.5 2.2e-98 355.5
Cla04g00030 . 4 217 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 82.7 9.3e-97 350.1
Cla09g00354 CCT 6 231 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 84.5 1.7e-103 372.5
Cla10g01196 CCT 4 266 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 71.5 4.9e-98 354.4
Cla04g00030 . 4 217 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 82.7 2.1e-96 349.0
Cla09g01222 . 3 281 Cytoplasmic Ribosomal Protein Gene Family AT1G80750 52.3 2.7e-70 262.3
Cla06g01365 . 496 666 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 85.4 6.0e-75 277.3
Cla07g01384 . 4 178 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 81.7 2.5e-73 271.9
Cla09g00144 . 4 178 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 80.6 6.9e-71 263.8
Cla06g01365 . 496 731 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 87.3 1.4e-114 409.5
Cla09g00144 . 4 243 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 84.2 1.5e-113 406.0
Cla07g01384 . 4 243 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 82.9 9.8e-113 403.3
Cla06g01365 . 496 731 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 89.4 2.0e-118 422.2
Cla09g00144 . 4 243 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 86.3 7.2e-116 413.7
Cla07g01384 . 4 243 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 85.0 2.7e-115 411.8
Cla05g01439 . 33 289 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 83.7 1.0e-120 429.9
Cla01g00515 . 57 324 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 81.3 2.1e-118 422.2
Cla01g00514 . 1 327 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 65.4 5.2e-109 391.0
Cla05g01439 . 33 289 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 84.0 2.0e-121 432.2
Cla01g00515 . 57 324 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 81.3 4.3e-119 424.5
Cla01g00514 . 1 327 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 66.4 1.2e-110 396.4
Cla01g01968 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT2G18020 93.4 8.0e-142 500.0
Cla05g01554 . 1 280 Cytoplasmic Ribosomal Protein Gene Family AT2G18020 84.6 6.6e-136 480.3
Cla01g01968 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT3G51190 84.9 8.7e-128 453.4
Cla05g01554 . 1 280 Cytoplasmic Ribosomal Protein Gene Family AT3G51190 76.5 2.7e-121 431.8
Cla01g01968 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT4G36130 93.8 2.9e-144 508.1
Cla05g01554 . 1 280 Cytoplasmic Ribosomal Protein Gene Family AT4G36130 84.6 9.2e-138 486.5
Cla01g00088 . 191 382 Cytoplasmic Ribosomal Protein Gene Family AT1G33120 85.4 7.0e-90 327.0
Cla01g00088 . 191 382 Cytoplasmic Ribosomal Protein Gene Family AT1G33140 85.4 7.0e-90 327.0
Cla01g00088 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G10450 83.7 3.4e-75 278.1
Cla02g00036 . 90 269 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 58.3 1.3e-52 202.6
Cla07g00993 . 38 216 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 57.5 9.3e-51 196.4
Cla11g00527 . 88 288 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 51.7 5.6e-48 187.2
Cla02g00036 . 90 268 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 87.7 1.2e-91 332.8
Cla07g00993 . 38 220 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 85.8 1.8e-90 328.9
Cla11g00527 . 88 287 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 78.0 5.3e-87 317.4
Cla07g00993 . 1 220 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 86.8 9.7e-112 399.8
Cla02g00036 . 53 272 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 86.4 1.7e-111 399.1
Cla11g00527 . 54 291 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 78.6 1.8e-105 379.0
Cla02g02150 . 126 345 Cytoplasmic Ribosomal Protein Gene Family AT1G08360 86.4 4.7e-103 370.9
Cla01g01209 . 1 215 Cytoplasmic Ribosomal Protein Gene Family AT1G08360 86.5 1.8e-102 369.0
Cla07g00699 . 1 177 Cytoplasmic Ribosomal Protein Gene Family AT1G08360 66.2 6.9e-70 260.8
Cla02g02150 . 126 345 Cytoplasmic Ribosomal Protein Gene Family AT2G27530 85.5 3.4e-101 364.8
Cla01g01209 . 1 215 Cytoplasmic Ribosomal Protein Gene Family AT2G27530 85.6 1.3e-100 362.8
Cla07g00699 . 1 177 Cytoplasmic Ribosomal Protein Gene Family AT2G27530 65.8 5.8e-69 257.7
Cla01g01209 . 1 215 Cytoplasmic Ribosomal Protein Gene Family AT5G22440 87.5 6.2e-103 370.5
Cla02g02150 . 126 345 Cytoplasmic Ribosomal Protein Gene Family AT5G22440 86.9 1.1e-102 369.8
Cla07g00699 . 1 177 Cytoplasmic Ribosomal Protein Gene Family AT5G22440 67.3 5.3e-70 261.2
Cla03g00707 CCT,ECH 1 182 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 96.2 1.1e-97 352.8
Cla07g00249 . 239 420 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 95.6 2.5e-97 351.7
Cla01g02328 CCT,ECH 313 493 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 94.5 8.0e-96 346.7
Cla03g00707 CCT,ECH 1 182 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 96.2 1.1e-97 352.8
Cla07g00249 . 239 420 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 95.6 2.5e-97 351.7
Cla01g02328 CCT,ECH 313 493 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 94.5 8.0e-96 346.7
Cla03g00707 CCT,ECH 1 182 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 96.2 1.1e-97 352.8
Cla07g00249 . 239 420 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 95.6 2.5e-97 351.7
Cla01g02328 CCT,ECH 313 493 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 94.5 8.0e-96 346.7
Cla03g00707 CCT,ECH 1 182 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 96.2 1.1e-97 352.8
Cla07g00249 . 239 420 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 95.6 2.5e-97 351.7
Cla01g02328 CCT,ECH 313 493 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 94.5 8.0e-96 346.7
Cla04g00886 CCT,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT2G37190 89.8 7.9e-82 300.1
Cla02g02063 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT2G37190 89.8 1.0e-81 299.7
Cla10g01932 CCT,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT2G37190 88.6 6.7e-81 297.0
Cla04g00886 CCT,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G53430 89.2 7.9e-82 300.1
Cla02g02063 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G53430 89.2 1.0e-81 299.7
Cla10g01932 CCT,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G53430 88.0 6.7e-81 297.0
Cla02g02063 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT5G60670 91.0 9.3e-83 303.1
Cla04g00886 CCT,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT5G60670 89.2 1.3e-81 299.3
Cla10g01932 CCT,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT5G60670 88.0 1.1e-80 296.2
Cla01g00479 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G49010 82.5 6.5e-94 340.5
Cla07g01645 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT3G49010 81.4 1.3e-57 219.9
Cla01g00479 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G48960 73.3 4.4e-82 301.2
Cla07g01645 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT3G48960 70.7 3.4e-50 195.3
Cla01g00479 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT5G23900 81.6 1.9e-93 339.0
Cla07g01645 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT5G23900 78.6 6.4e-57 217.6
Cla06g00749 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G07110 88.4 7.0e-104 373.6
Cla05g00350 . 1 237 Cytoplasmic Ribosomal Protein Gene Family AT3G07110 76.4 2.3e-99 358.6
Cla06g00749 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G24830 90.8 2.8e-105 378.3
Cla05g00350 . 1 237 Cytoplasmic Ribosomal Protein Gene Family AT3G24830 78.5 3.6e-100 361.3
Cla06g00749 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT4G13170 88.8 3.7e-105 377.9
Cla05g00350 . 1 237 Cytoplasmic Ribosomal Protein Gene Family AT4G13170 75.9 8.8e-99 356.7
Cla06g00749 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT5G48760 90.3 3.9e-107 384.4
Cla05g00350 . 1 237 Cytoplasmic Ribosomal Protein Gene Family AT5G48760 77.6 9.4e-101 363.2
Cla05g00436 CCT 118 245 Cytoplasmic Ribosomal Protein Gene Family AT2G20450 84.4 2.5e-54 208.4
Cla06g00677 CCT 905 1032 Cytoplasmic Ribosomal Protein Gene Family AT2G20450 82.8 5.6e-54 207.2
Cla05g00436 CCT 118 245 Cytoplasmic Ribosomal Protein Gene Family AT4G27090 85.2 6.6e-55 210.3
Cla06g00677 CCT 905 1032 Cytoplasmic Ribosomal Protein Gene Family AT4G27090 83.6 1.5e-54 209.1
Cla07g01606 CCT 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G16720 91.2 1.5e-106 382.5
Cla01g00409 . 1 169 Cytoplasmic Ribosomal Protein Gene Family AT4G16720 94.1 5.1e-91 330.9
Cla07g01606 CCT 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G17390 91.7 1.7e-107 385.6
Cla01g00409 . 1 169 Cytoplasmic Ribosomal Protein Gene Family AT4G17390 94.1 5.1e-91 330.9
Cla08g01012 . 939 1112 Cytoplasmic Ribosomal Protein Gene Family AT1G27400 89.1 4.7e-85 310.8
Cla11g01347 . 16 216 Cytoplasmic Ribosomal Protein Gene Family AT1G27400 73.1 1.1e-73 273.1
Cla08g01012 . 939 1114 Cytoplasmic Ribosomal Protein Gene Family AT1G67430 66.5 7.2e-54 206.8
Cla11g01347 . 16 209 Cytoplasmic Ribosomal Protein Gene Family AT1G67430 55.2 3.3e-43 171.4
Cla02g01506 . 59 243 Cytoplasmic Ribosomal Protein Gene Family AT2G47570 80.6 3.1e-79 291.6
Cla03g01649 . 914 1098 Cytoplasmic Ribosomal Protein Gene Family AT2G47570 77.4 6.5e-77 283.9
Cla02g01506 . 110 243 Cytoplasmic Ribosomal Protein Gene Family AT3G05590 86.6 3.5e-64 241.1
Cla03g01649 . 965 1098 Cytoplasmic Ribosomal Protein Gene Family AT3G05590 87.3 1.7e-63 238.8
Cla02g01506 . 110 243 Cytoplasmic Ribosomal Protein Gene Family AT5G27850 85.8 3.0e-63 238.0
Cla03g01649 . 965 1098 Cytoplasmic Ribosomal Protein Gene Family AT5G27850 85.1 9.5e-62 233.0
Cla01g02396 . 17 215 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 82.4 8.4e-92 333.6
Cla11g01609 . 1 178 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 91.0 1.1e-91 333.2
Cla03g00661 . 1 250 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 64.4 1.0e-81 300.1
Cla11g01609 . 4 178 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 91.4 3.4e-91 331.3
Cla01g02396 . 41 215 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 90.9 1.3e-90 329.3
Cla03g00661 . 4 250 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 64.4 1.9e-81 298.9
Cla10g01063 CCT,ECH 105 317 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 83.1 2.8e-87 318.5
Cla09g00526 CCT,ECH 1 275 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 64.4 5.9e-82 300.8
Cla06g01413 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 71.7 3.2e-59 225.3
Cla10g01063 CCT,ECH 105 306 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 84.2 2.3e-86 315.5
Cla09g00526 CCT,ECH 1 275 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 64.4 7.6e-82 300.4
Cla06g01413 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 68.7 2.0e-58 222.6
Cla10g01063 CCT,ECH 105 316 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 82.5 3.9e-86 314.7
Cla09g00526 CCT,ECH 1 275 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 65.5 8.3e-81 297.0
Cla06g01413 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 71.7 1.8e-59 226.1
Cla10g01689 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G09590 84.8 7.8e-82 300.1
Cla10g01689 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G09690 84.8 7.8e-82 300.1
Cla10g01689 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G57660 83.5 2.3e-81 298.5
Cla10g01689 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G57860 83.5 2.3e-81 298.5
Cla09g00542 . 1 117 Cytoplasmic Ribosomal Protein Gene Family AT1G02830 73.5 1.6e-42 169.1
Cla03g01662 . 1 115 Cytoplasmic Ribosomal Protein Gene Family AT1G02830 71.8 2.0e-40 162.2
Cla03g01662 . 1 124 Cytoplasmic Ribosomal Protein Gene Family AT3G05560 89.5 3.5e-58 221.1
Cla09g00542 . 1 122 Cytoplasmic Ribosomal Protein Gene Family AT3G05560 83.6 1.7e-52 202.2
Cla03g01662 . 1 124 Cytoplasmic Ribosomal Protein Gene Family AT5G27770 88.7 5.0e-57 217.2
Cla09g00542 . 1 121 Cytoplasmic Ribosomal Protein Gene Family AT5G27770 82.6 5.4e-51 197.2
Cla06g00695 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.6 1.9e-76 282.0
Cla06g00135 . 835 969 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.5 1.1e-73 272.7
Cla07g00123 . 1 181 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 75.7 1.3e-69 259.2
Cla06g00135 . 845 969 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 9.8e-69 256.1
Cla06g00695 . 16 140 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 9.8e-69 256.1
Cla07g00123 . 16 181 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 74.7 6.8e-62 233.4
Cla06g00135 . 845 969 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 9.8e-69 256.1
Cla06g00695 . 16 140 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 9.8e-69 256.1
Cla07g00123 . 16 181 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 74.7 6.8e-62 233.4
Cla11g00084 . 1003 1155 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 79.2 1.7e-59 225.7
Cla07g00288 . 1 150 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 78.1 3.6e-57 218.0
Cla09g01968 . 64 184 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 76.9 6.7e-43 170.6
Cla11g00084 . 1006 1155 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 85.3 7.3e-63 236.9
Cla07g00288 . 4 150 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 85.0 6.8e-61 230.3
Cla09g01968 . 64 184 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 84.3 7.3e-47 183.7
Cla10g01858 CCT,ECH 26 185 Cytoplasmic Ribosomal Protein Gene Family AT2G36620 82.5 1.2e-66 249.6
Cla04g00952 CCT,ECH 29 192 Cytoplasmic Ribosomal Protein Gene Family AT2G36620 79.9 1.3e-65 246.1
Cla10g01858 CCT,ECH 26 185 Cytoplasmic Ribosomal Protein Gene Family AT3G53020 83.9 1.0e-65 246.5
Cla04g00952 CCT,ECH 29 192 Cytoplasmic Ribosomal Protein Gene Family AT3G53020 80.6 1.2e-63 239.6
Cla05g01943 . 122 268 Cytoplasmic Ribosomal Protein Gene Family AT2G44860 61.9 1.7e-41 166.0
Cla10g01834 . 575 720 Cytoplasmic Ribosomal Protein Gene Family AT2G44860 61.0 1.6e-39 159.5
Cla01g01719 . 1 144 Cytoplasmic Ribosomal Protein Gene Family AT3G49910 89.6 1.3e-67 252.7
Cla02g01241 . 1 145 Cytoplasmic Ribosomal Protein Gene Family AT3G49910 84.1 7.0e-66 246.9
Cla02g01241 . 1 145 Cytoplasmic Ribosomal Protein Gene Family AT5G67510 82.8 2.9e-64 241.5
Cla01g01719 . 1 144 Cytoplasmic Ribosomal Protein Gene Family AT5G67510 84.7 5.0e-64 240.7
Cla07g01033 CCT 148 281 Cytoplasmic Ribosomal Protein Gene Family AT2G32220 76.9 4.6e-56 214.2
Cla11g01639 CCT 1 135 Cytoplasmic Ribosomal Protein Gene Family AT2G32220 74.1 2.1e-53 205.3
Cla07g01033 CCT 148 281 Cytoplasmic Ribosomal Protein Gene Family AT3G22230 83.6 6.9e-60 226.9
Cla11g01639 CCT 1 135 Cytoplasmic Ribosomal Protein Gene Family AT3G22230 79.3 9.3e-57 216.5
Cla07g01033 CCT 1 123 Cytoplasmic Ribosomal Protein Gene Family AT4G15000 82.9 6.1e-53 203.8
Cla11g01639 CCT 1 123 Cytoplasmic Ribosomal Protein Gene Family AT4G15000 79.7 4.3e-51 197.6
Cla05g02580 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT1G23290 80.8 2.6e-60 228.4
Cla01g01327 . 1 104 Cytoplasmic Ribosomal Protein Gene Family AT1G23290 81.7 1.0e-40 163.3
Cla05g02580 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT1G70600 82.2 6.1e-62 233.8
Cla01g01327 . 1 104 Cytoplasmic Ribosomal Protein Gene Family AT1G70600 83.7 2.4e-42 168.7
Cla07g01291 . 1481 1623 Cytoplasmic Ribosomal Protein Gene Family AT2G19730 74.8 1.6e-54 209.1
Cla11g00168 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT2G19730 73.4 2.1e-54 208.8
Cla07g01291 . 1481 1623 Cytoplasmic Ribosomal Protein Gene Family AT4G29410 75.5 3.7e-56 214.5
Cla11g00168 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT4G29410 72.7 1.2e-54 209.5
Cla03g00843 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G36240 83.9 1.2e-52 202.6
Cla03g00843 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G77940 82.1 4.4e-52 200.7
Cla03g00843 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT3G18740 81.3 3.7e-51 197.6
Cla03g01523 CCT 1147 1265 Cytoplasmic Ribosomal Protein Gene Family AT2G19740 85.7 1.8e-51 198.7
Cla10g01188 . 6 121 Cytoplasmic Ribosomal Protein Gene Family AT2G19740 80.2 1.8e-48 188.7
Cla11g00170 CCT 55 209 Cytoplasmic Ribosomal Protein Gene Family AT2G19740 65.8 2.5e-45 178.3
Cla03g01523 CCT 1151 1265 Cytoplasmic Ribosomal Protein Gene Family AT4G26230 87.8 1.4e-51 199.1
Cla10g01188 . 7 121 Cytoplasmic Ribosomal Protein Gene Family AT4G26230 80.9 6.3e-49 190.3
Cla11g00170 CCT 59 209 Cytoplasmic Ribosomal Protein Gene Family AT4G26230 66.9 1.9e-45 178.7
Cla01g02366 CCT 1 133 Cytoplasmic Ribosomal Protein Gene Family AT4G18100 85.7 6.1e-61 230.3
Cla03g00674 CCT 1 131 Cytoplasmic Ribosomal Protein Gene Family AT4G18100 83.2 2.9e-58 221.5
Cla01g02366 CCT 1 133 Cytoplasmic Ribosomal Protein Gene Family AT5G46430 83.5 3.0e-60 228.0
Cla03g00674 CCT 1 131 Cytoplasmic Ribosomal Protein Gene Family AT5G46430 80.9 1.4e-57 219.2
Cla09g01786 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 91.3 3.8e-44 174.1
Cla09g01721 . 78 169 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 91.3 8.4e-44 172.9
Cla06g01595 . 1 109 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 75.2 2.1e-39 158.3
Cla09g01786 . 1 119 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 92.4 5.3e-56 213.8
Cla09g01721 . 78 196 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 91.6 1.2e-55 212.6
Cla06g01595 . 1 136 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 78.7 3.0e-51 198.0
Cla09g01721 . 78 197 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 90.8 2.7e-55 211.5
Cla09g01786 . 1 120 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 90.8 2.7e-55 211.5
Cla06g01595 . 1 137 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 78.1 6.8e-51 196.8
Cla02g01329 . 64 186 Cytoplasmic Ribosomal Protein Gene Family AT3G09500 91.1 2.8e-52 201.4
Cla09g01972 . 896 1013 Cytoplasmic Ribosomal Protein Gene Family AT3G09500 90.7 1.3e-49 192.6
Cla02g01329 . 64 186 Cytoplasmic Ribosomal Protein Gene Family AT2G39390 91.1 1.7e-52 202.2
Cla09g01972 . 896 1013 Cytoplasmic Ribosomal Protein Gene Family AT2G39390 91.5 2.6e-50 194.9
Cla02g01329 . 64 186 Cytoplasmic Ribosomal Protein Gene Family AT3G55170 90.2 1.1e-51 199.5
Cla09g01972 . 896 1013 Cytoplasmic Ribosomal Protein Gene Family AT3G55170 89.0 1.1e-48 189.5
Cla02g01329 . 64 186 Cytoplasmic Ribosomal Protein Gene Family AT5G02610 76.7 1.3e-48 189.5
Cla09g01972 . 896 1013 Cytoplasmic Ribosomal Protein Gene Family AT5G02610 75.9 6.1e-46 180.6
Cla04g00174 . 1 104 Cytoplasmic Ribosomal Protein Gene Family AT1G07070 83.7 1.6e-49 192.2
Cla04g00174 . 2 104 Cytoplasmic Ribosomal Protein Gene Family AT1G41880 85.4 1.3e-48 189.1
Cla04g00174 . 1 104 Cytoplasmic Ribosomal Protein Gene Family AT1G74270 84.6 3.5e-49 191.0
Cla04g00174 . 2 104 Cytoplasmic Ribosomal Protein Gene Family AT3G55750 84.5 2.2e-48 188.3
Cla01g00437 CCT,ECH 21 118 Cytoplasmic Ribosomal Protein Gene Family AT2G37600 86.7 1.0e-40 162.9
Cla05g00891 CCT,ECH 8 110 Cytoplasmic Ribosomal Protein Gene Family AT2G37600 81.6 5.6e-39 157.1
Cla08g00032 . 8 110 Cytoplasmic Ribosomal Protein Gene Family AT2G37600 78.3 6.2e-38 153.7
Cla01g00437 CCT,ECH 14 123 Cytoplasmic Ribosomal Protein Gene Family AT3G53740 82.1 8.3e-43 169.9
Cla08g00032 . 1 106 Cytoplasmic Ribosomal Protein Gene Family AT3G53740 78.3 1.9e-39 158.7
Cla05g00891 CCT,ECH 1 100 Cytoplasmic Ribosomal Protein Gene Family AT3G53740 83.0 5.6e-39 157.1
Cla01g00437 CCT,ECH 21 123 Cytoplasmic Ribosomal Protein Gene Family AT5G02450 82.5 1.5e-41 165.6
Cla08g00032 . 8 106 Cytoplasmic Ribosomal Protein Gene Family AT5G02450 80.8 1.2e-38 156.0
Cla05g00891 CCT,ECH 8 109 Cytoplasmic Ribosomal Protein Gene Family AT5G02450 80.4 1.6e-38 155.6
Cla09g00421 . 25 129 Cytoplasmic Ribosomal Protein Gene Family AT3G23390 92.4 2.2e-53 204.9
Cla10g01140 . 42 127 Cytoplasmic Ribosomal Protein Gene Family AT3G23390 90.7 9.5e-41 162.9
Cla09g00421 . 25 117 Cytoplasmic Ribosomal Protein Gene Family AT4G14320 91.4 1.9e-45 179.1
Cla10g01140 . 42 127 Cytoplasmic Ribosomal Protein Gene Family AT4G14320 90.7 1.1e-40 163.3
Cla05g00314 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G10950 94.6 2.5e-45 177.9
Cla06g00791 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G10950 94.6 2.5e-45 177.9
Cla05g00314 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G60245 92.4 7.3e-45 176.4
Cla06g00791 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G60245 92.4 7.3e-45 176.4
Cla01g00018 . 1 122 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 97.5 5.7e-64 240.4
Cla07g00937 . 1 115 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 91.0 1.2e-56 216.1
Cla10g00532 CCT 305 381 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 4.6e-37 151.0
Cla01g02163 . 1 77 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 6.0e-37 150.6
Cla03g00464 . 46 122 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 6.0e-37 150.6
Cla05g01530 CCT 77 153 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 6.0e-37 150.6
Cla02g01821 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 100.0 7.8e-37 150.2
Cla05g02554 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 100.0 7.8e-37 150.2
Cla08g01745 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 100.0 7.8e-37 150.2
Cla01g00018 . 1 122 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 97.5 5.7e-64 240.4
Cla07g00937 . 1 115 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 91.0 1.2e-56 216.1
Cla10g00532 CCT 305 381 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 4.6e-37 151.0
Cla01g02163 . 1 77 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 6.0e-37 150.6
Cla03g00464 . 46 122 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 6.0e-37 150.6
Cla05g01530 CCT 77 153 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 6.0e-37 150.6
Cla02g01821 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 100.0 7.8e-37 150.2
Cla05g02554 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 100.0 7.8e-37 150.2
Cla08g01745 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 100.0 7.8e-37 150.2
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0000587 3 3 3 2 4 2 5 5 4 3 3 3 4 4 3 4 3 7 3 3 3 4 5 0 4 3 1 4 4 3 102