Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cla05g02337 ATGGCTTCCGAGAGCGTTTCCAGATCCAGTTCAGCGGCCGATTCTTATATTGGAAGCTTGATAAGCTTAACTTCCAAGAGTGAGATTAGATACGAAGGTGTTCTTTACAACATCAACACCGAAGAGTCCAGTATCGGACTGAGAAATGTACGGTCATTTGGAACAGAAGGGAGAAAGAAGGATGGACCACAAGTCCCACCAAGTGACAAAGTTTTTGAATACATCTTGTTCCGTGGAAGTGATATCAAGGATCTACAAGTAAAATCTTCTCCTCCTGTTCAGACTACATCCTTGATAAATAATGATCCAGCTATTATTCAGTCTCACTATCCTCGTCCAGCATCGACTTCTTCAAGCTTGCCTCCTCCTGTTAGTGGACCTTTGCCTGATATTAATTCTCAGGCCATGCCTATGGGAATTCCAGGATCTAATTTCCAGGGTGGGTTGCCTTTATATCATCCTGGAGGAAATGTAGGGTCTTGGGGAGCTTCTCCTACGCCATCTCCCCCAAATCCAAGTGGTGGTGGGCTTGCTTTGCCAATGTACTGGCAAGGGTATTATGGCCCCCCTAATGGACTTCCTCATATGCAACAGCAGTCATTACTTCGTCCACCACCTGGCCTGTCATTGCCTTCTTCCTTGCAGCAGCCCCTGCAATATCCTAATCTTAATGCTTCTTTACCCACTGGGGCACCAAATTTATTAGAAGTTCCATCTTCTTTATTCTCTGCTAATCCTACCACTCCTAGTTTATTGTCCACAGCAATGCCACCAGTAACTGTATCTTCGTCACTCCCATCTGTGCTTTCGGCTCCACAGACCTCTGAGATATCATCAAGCTCAGTGGCCAACAAGACAGTAAATTCTGCTCTTCCTCAAGCTCCTCTAAGTACTAATTTGCCATCGCTCTCTCCTTTGACGGCGAGTTCAGATGTCAGCCCTGTTGTGCCTCCAACTACTAACAAAACTACTACAGTTTCTGGTCCAGCATTGTCTTACCAAACTGTCTCTCAATCTACATCCTCTGTTGTTGGAACATCGAACTCTGCTCTCACAGGTGCACCTGCACCTACCCTTGTGACTCCAGGACAGCTGTTGCAAACTACTGTAGCCTCTTCATCTTTGCAAACAGTTCAAAAGGACGTTGAGGTGGTTCAAACATCTTCCTCCTTAGCAGCCGAACAAACTGTTCCAGCAGCCGATACTCAGCCACCATTATTACCGTTACCAGTGGCTTCACAAGCTATTCATAAGCCAAATGGTTCAACTTCGCAAACTCGGTACATCCACAGGGGACGTGGTAGAGGAAGACGATTTGGGAACTCGCATCAAACAGAAAGATTTACAGAAGATTTTGACTTCACGGCAATGAATGAGAAATTTAACAAGGATGAAGTCTGGGGTCATCTTGGCAAGAATACCAAATCTCATCCAAAGTACAATGATGGGGATGAAAAGTTCAGTGATGAAGATGATGTCTATGAGGAAGATGATGGTGAATCTTCAAAGTTGGAGATCAAGCCTGTGTACAATAAGGACGACTTTTTTGATACTCTCTCGTGCAACAATCCTGACAATGAAGCTCAAAATGGAAGGAGGACCAGATACTACGAACAAATCAAGTTGGACACTGAGACATTTGGTGAATTTGCAAGATTCCGAGGTGGTCGTGGTGGATTTTCTTCTGGACGTGGTGGCCGTCGTGGTGGTTATTACGGGAGAGGATACGGCCATGTTGGAAGGGGTCGAGGGCGGGGAATGCATAACTATAATCCCCTACTTACCACTGTACTCTTGGCCGAGCCAAGATCGTTGAGCTGCAGACCGCCTTTCTCTGTCCCCATGGCCGCGGCATTGCCCTCACTCACCCCATTACTCATCTTTGCCAGAATCTTTGGTCTGCTTGTTGCCGTTCTGGTCTTCGTTTGGGCTTTTGCATTCAGTTCCAGCTTCGGCCATCGCTCCCCTGCCCGCGATGACCATCTCTTCGACGTTCTGCATCCTTTGTTCATGGTAATTGGTCTCATTCTCCTCAGCGGGGAAGCAATTTTGGTCCATAGCTGGTTGCCTGGTTCGAGAAATTTGAGGAAATCTGTTCATCTGAGTCTTCAAGGGCTGGCTTTAGCTTCTGGGATTTCCGGAATTTGGACCAAGTTTCATTGGGATCGTGGCTTTTTGGCTAATTTCCACAGTTTACATTCTTGGATGGGTTTGATTGTTGTCACTTTGTTCGGAGCTCAGTGGATGATGGGGTTTCTGAGCTTCTGGCATTGGAGGGAGGTGAGGGCAACAAGAGAAAGAGTGCTGCCATGGCATGTGTTCCTTGGGTTATACAGTTATGCATTGGCAGTGGTAACAGCAGAAACAGGGCTTCTTGAGAAGTTGACATTGTTGCAAACCAAGAGAAATGTCCCTAGGAAGGGTCCTGAAGCCATGGTTGTAAACAGTCTAGGCTTGGCACTGGCTTTGCTTACTGGAACTGTTATGCTCACTGCTATATCTCCTAAATATCCTCCTTCCCTCCCCACCACCAAACAACAACCATTTTTCTCTAATTCAAAGCCCTTACCTTCTTAA 2577 46.29 MASESVSRSSSAADSYIGSLISLTSKSEIRYEGVLYNINTEESSIGLRNVRSFGTEGRKKDGPQVPPSDKVFEYILFRGSDIKDLQVKSSPPVQTTSLINNDPAIIQSHYPRPASTSSSLPPPVSGPLPDINSQAMPMGIPGSNFQGGLPLYHPGGNVGSWGASPTPSPPNPSGGGLALPMYWQGYYGPPNGLPHMQQQSLLRPPPGLSLPSSLQQPLQYPNLNASLPTGAPNLLEVPSSLFSANPTTPSLLSTAMPPVTVSSSLPSVLSAPQTSEISSSSVANKTVNSALPQAPLSTNLPSLSPLTASSDVSPVVPPTTNKTTTVSGPALSYQTVSQSTSSVVGTSNSALTGAPAPTLVTPGQLLQTTVASSSLQTVQKDVEVVQTSSSLAAEQTVPAADTQPPLLPLPVASQAIHKPNGSTSQTRYIHRGRGRGRRFGNSHQTERFTEDFDFTAMNEKFNKDEVWGHLGKNTKSHPKYNDGDEKFSDEDDVYEEDDGESSKLEIKPVYNKDDFFDTLSCNNPDNEAQNGRRTRYYEQIKLDTETFGEFARFRGGRGGFSSGRGGRRGGYYGRGYGHVGRGRGRGMHNYNPLLTTVLLAEPRSLSCRPPFSVPMAAALPSLTPLLIFARIFGLLVAVLVFVWAFAFSSSFGHRSPARDDHLFDVLHPLFMVIGLILLSGEAILVHSWLPGSRNLRKSVHLSLQGLALASGISGIWTKFHWDRGFLANFHSLHSWMGLIVVTLFGAQWMMGFLSFWHWREVRATRERVLPWHVFLGLYSYALAVVTAETGLLEKLTLLQTKRNVPRKGPEAMVVNSLGLALALLTGTVMLTAISPKYPPSLPTTKQQPFFSNSKPLPS 858
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
5 34960582 34969658 - ClCG05G023100.2 Cla05g02337 273827

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cla05g02337 858 Pfam FDF domain 447 549 IPR019050 -
Cla05g02337 858 Pfam Scd6-like Sm domain 16 89 IPR025609 -
Cla05g02337 858 CDD LSm14_N 16 87 IPR025609 -
Cla05g02337 858 PANTHER PROTEIN DECAPPING 5-LIKE 5 585 - -
Cla05g02337 858 SUPERFAMILY Sm-like ribonucleoproteins 15 92 IPR010920 -
Cla05g02337 858 Gene3D - 616 838 - -
Cla05g02337 858 Pfam Eukaryotic cytochrome b561 666 796 IPR006593 -
Cla05g02337 858 ProSiteProfiles DFDF domain profile. 440 476 IPR025762 -
Cla05g02337 858 PANTHER SCD6 PROTEIN-RELATED 5 585 - -
Cla05g02337 858 MobiDBLite consensus disorder prediction 468 486 - -
Cla05g02337 858 Gene3D - 7 92 - -
Cla05g02337 858 ProSiteProfiles Cytochrome b561 domain profile. 628 833 IPR006593 -
Cla05g02337 858 SMART 561_7 666 791 IPR006593 -
Cla05g02337 858 ProSiteProfiles FFD box profile. 508 523 IPR025761 -
Cla05g02337 858 SMART LSM14_2 10 110 IPR025609 -
Cla05g02337 858 ProSiteProfiles TFG box profile. 531 551 IPR025768 -
Cla05g02337 858 CDD Cyt_b561_ACYB-1_like 660 799 - -
Cla05g02337 858 MobiDBLite consensus disorder prediction 468 502 - -
Cla05g02337 858 SMART FDF_2 446 551 IPR019050 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cla05g02337 K18749 LSM14, RAP55, SCD6; protein LSM14 - csv:101205721 905.205
       

WGDs- Genes

Select Gene_1 Gene_2 Event_name
Cla01g00562 Cla05g02337 CCT
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cla05g02337 Cla-Chr5:34960582 Cla09g01236 Cla-Chr9:16407007 4.40E-35 dispersed
Cla01g00562 Cla-Chr1:6241048 Cla05g02337 Cla-Chr5:34960582 0 wgd
Cla11g00506 Cla-Chr11:5738605 Cla05g02337 Cla-Chr5:34960582 3.66E-45 wgd
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi1g247 Blo01g00476 . . . . . Bma14g01693 . Cmo04g01615 Cmo18g01071 . . Car04g01593 . Sed06g1855 Cpe09g00267 Cpe01g01755 Bhi07g01381 Tan04g0909 Cmetu10g0348 Lac13g0448 Hepe10g1862 . . Cla05g02337 Cam05g2511 Cec05g2535 Cco05g2578 Clacu05g2505 Cmu05g2367 Cre05g2484 Cone13ag0863 Cone19ag0863 . . Lsi04g00298 Csa05g02074 . Cme10g00301 . Blo11g00828 . . Bpe11g01686 . . . . . . Cma04g01995 . . Car15g01281 Cpe13g00029 . Bhi12g00822 . . . . . Lcy10g0875 Cla01g00562 Cam01g0585 Cec01g0577 Cco01g0601 Clacu01g0580 Cmu01g0551 Cre09g1956 Lsi09g00611 . . .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cla03g00157 . 187 629 Chloroplast and Mitochondria Gene Families AT2G28800 59.0 4.8e-131 464.9
Cla08g01713 . 72 352 Chloroplast and Mitochondria Gene Families AT2G28800 54.5 5.2e-77 285.4
Cla08g00704 . 3 249 Chloroplast and Mitochondria Gene Families AT1G15820 81.9 5.2e-117 417.5
Cla02g00280 . 1 265 Chloroplast and Mitochondria Gene Families AT3G27690 88.7 1.1e-142 503.1
Cla02g01804 . 2 267 Chloroplast and Mitochondria Gene Families AT3G27690 78.4 6.9e-121 430.6
Cla01g02379 . 2 265 Chloroplast and Mitochondria Gene Families AT3G27690 77.4 3.4e-120 428.3
Cla01g02380 . 46 309 Chloroplast and Mitochondria Gene Families AT3G27690 76.7 2.9e-119 425.2
Cla10g01121 . 1 265 Chloroplast and Mitochondria Gene Families AT3G27690 78.0 6.5e-119 424.1
Cla10g00607 . 5 266 Chloroplast and Mitochondria Gene Families AT3G27690 66.9 1.2e-96 350.1
Cla11g01861 . 113 329 Chloroplast and Mitochondria Gene Families AT3G27690 51.2 1.1e-52 204.1
Cla08g00194 . 118 321 Chloroplast and Mitochondria Gene Families AT3G27690 53.8 6.8e-52 201.4
Cla11g01337 . 3 268 Chloroplast and Mitochondria Gene Families AT3G61470 80.9 1.3e-128 456.1
Cla03g01434 . 56 261 Chloroplast and Mitochondria Gene Families AT3G61470 65.5 2.8e-86 315.5
Cla06g01586 CCT,ECH 368 595 Chloroplast and Mitochondria Gene Families AT3G61470 50.8 8.7e-64 240.7
Cla09g02009 . 1 198 Chloroplast and Mitochondria Gene Families AT3G54890 81.6 5.9e-90 327.4
Cla04g00716 . 105 382 Chloroplast and Mitochondria Gene Families AT3G08940 82.1 7.6e-133 470.3
Cla10g02086 . 76 333 Chloroplast and Mitochondria Gene Families AT3G08940 81.3 1.1e-118 423.3
Cla11g01861 . 48 336 Chloroplast and Mitochondria Gene Families AT1G76570 79.2 4.6e-142 501.1
Cla03g01160 . 1 273 Chloroplast and Mitochondria Gene Families AT1G61520 86.8 8.2e-137 483.4
Cla02g00280 . 1 265 Chloroplast and Mitochondria Gene Families AT2G05070 89.4 3.0e-144 508.1
Cla01g02379 . 5 265 Chloroplast and Mitochondria Gene Families AT2G05070 79.3 1.0e-120 429.9
Cla01g02380 . 49 309 Chloroplast and Mitochondria Gene Families AT2G05070 78.6 5.2e-120 427.6
Cla02g01804 . 7 267 Chloroplast and Mitochondria Gene Families AT2G05070 78.9 6.8e-120 427.2
Cla10g01121 . 27 265 Chloroplast and Mitochondria Gene Families AT2G05070 84.5 1.7e-118 422.5
Cla10g00607 . 7 266 Chloroplast and Mitochondria Gene Families AT2G05070 68.0 3.6e-97 351.7
Cla03g00652 . 27 256 Chloroplast and Mitochondria Gene Families AT2G05070 50.4 2.1e-52 203.0
Cla08g00194 . 118 321 Chloroplast and Mitochondria Gene Families AT2G05070 54.3 4.6e-52 201.8
Cla11g01861 . 113 329 Chloroplast and Mitochondria Gene Families AT2G05070 50.2 3.0e-51 199.1
Cla02g00280 . 1 237 Chloroplast and Mitochondria Gene Families AT2G05100 89.5 1.7e-125 446.0
Cla01g02379 . 5 237 Chloroplast and Mitochondria Gene Families AT2G05100 76.9 5.8e-102 367.9
Cla01g02380 . 49 281 Chloroplast and Mitochondria Gene Families AT2G05100 76.4 1.7e-101 366.3
Cla02g01804 . 7 239 Chloroplast and Mitochondria Gene Families AT2G05100 76.9 5.0e-101 364.8
Cla10g01121 . 27 237 Chloroplast and Mitochondria Gene Families AT2G05100 83.4 1.9e-100 362.8
Cla10g00607 . 7 238 Chloroplast and Mitochondria Gene Families AT2G05100 67.6 5.1e-82 301.6
Cla08g00194 . 118 305 Chloroplast and Mitochondria Gene Families AT2G05100 53.1 1.6e-43 173.7
Cla04g00716 . 105 264 Chloroplast and Mitochondria Gene Families AT2G40100 72.0 9.7e-65 243.4
Cla10g02086 . 76 229 Chloroplast and Mitochondria Gene Families AT2G40100 66.7 2.4e-55 212.2
Cla02g01804 . 1 267 Chloroplast and Mitochondria Gene Families AT1G29930 88.4 1.8e-136 482.3
Cla01g02379 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29930 88.8 4.0e-136 481.1
Cla01g02380 . 45 309 Chloroplast and Mitochondria Gene Families AT1G29930 88.4 6.8e-136 480.3
Cla10g01121 . 4 265 Chloroplast and Mitochondria Gene Families AT1G29930 84.9 1.7e-126 449.1
Cla02g00280 . 3 265 Chloroplast and Mitochondria Gene Families AT1G29930 78.3 3.5e-116 414.8
Cla10g00607 . 1 266 Chloroplast and Mitochondria Gene Families AT1G29930 65.2 1.0e-94 343.6
Cla03g00652 . 1 256 Chloroplast and Mitochondria Gene Families AT1G29930 57.1 1.2e-68 256.9
Cla02g01804 . 1 267 Chloroplast and Mitochondria Gene Families AT1G29920 88.1 6.8e-136 480.3
Cla01g02379 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29920 88.4 1.5e-135 479.2
Cla01g02380 . 45 309 Chloroplast and Mitochondria Gene Families AT1G29920 88.0 2.6e-135 478.4
Cla10g01121 . 4 265 Chloroplast and Mitochondria Gene Families AT1G29920 84.9 2.2e-126 448.7
Cla02g00280 . 3 265 Chloroplast and Mitochondria Gene Families AT1G29920 77.9 2.1e-116 415.6
Cla10g00607 . 1 266 Chloroplast and Mitochondria Gene Families AT1G29920 65.2 1.7e-94 342.8
Cla03g00652 . 1 256 Chloroplast and Mitochondria Gene Families AT1G29920 56.8 4.7e-68 255.0
Cla08g00194 . 101 321 Chloroplast and Mitochondria Gene Families AT1G29920 50.7 7.2e-53 204.5
Cla02g01804 . 1 267 Chloroplast and Mitochondria Gene Families AT1G29910 88.1 6.8e-136 480.3
Cla01g02379 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29910 88.4 1.5e-135 479.2
Cla01g02380 . 45 309 Chloroplast and Mitochondria Gene Families AT1G29910 88.0 2.6e-135 478.4
Cla10g01121 . 4 265 Chloroplast and Mitochondria Gene Families AT1G29910 84.9 2.2e-126 448.7
Cla02g00280 . 3 265 Chloroplast and Mitochondria Gene Families AT1G29910 77.9 2.1e-116 415.6
Cla10g00607 . 1 266 Chloroplast and Mitochondria Gene Families AT1G29910 65.2 1.7e-94 342.8
Cla03g00652 . 1 256 Chloroplast and Mitochondria Gene Families AT1G29910 56.8 4.7e-68 255.0
Cla08g00194 . 101 321 Chloroplast and Mitochondria Gene Families AT1G29910 50.7 7.2e-53 204.5
Cla08g00194 . 56 336 Chloroplast and Mitochondria Gene Families AT4G10340 84.7 5.3e-139 490.7
Cla01g02380 . 81 297 Chloroplast and Mitochondria Gene Families AT4G10340 52.9 3.9e-57 218.8
Cla01g02379 . 37 253 Chloroplast and Mitochondria Gene Families AT4G10340 52.5 6.6e-57 218.0
Cla10g01121 . 49 253 Chloroplast and Mitochondria Gene Families AT4G10340 54.1 8.6e-57 217.6
Cla02g01804 . 51 255 Chloroplast and Mitochondria Gene Families AT4G10340 54.1 1.1e-56 217.2
Cla02g00280 . 49 253 Chloroplast and Mitochondria Gene Families AT4G10340 52.6 3.1e-54 209.1
Cla10g00607 . 48 254 Chloroplast and Mitochondria Gene Families AT4G10340 54.0 3.8e-52 202.2
Cla02g01804 . 1 267 Chloroplast and Mitochondria Gene Families AT2G34420 88.4 1.2e-135 479.6
Cla01g02379 . 1 265 Chloroplast and Mitochondria Gene Families AT2G34420 88.0 1.7e-134 475.7
Cla01g02380 . 45 309 Chloroplast and Mitochondria Gene Families AT2G34420 87.6 2.8e-134 474.9
Cla10g01121 . 4 265 Chloroplast and Mitochondria Gene Families AT2G34420 85.7 3.4e-127 451.4
Cla02g00280 . 3 265 Chloroplast and Mitochondria Gene Families AT2G34420 77.2 7.0e-117 417.2
Cla10g00607 . 24 266 Chloroplast and Mitochondria Gene Families AT2G34420 70.1 8.4e-94 340.5
Cla03g00652 . 1 256 Chloroplast and Mitochondria Gene Families AT2G34420 56.8 5.1e-67 251.5
Cla01g02380 . 45 309 Chloroplast and Mitochondria Gene Families AT2G34430 88.3 8.0e-137 483.4
Cla01g02379 . 1 265 Chloroplast and Mitochondria Gene Families AT2G34430 88.3 3.0e-136 481.5
Cla02g01804 . 1 267 Chloroplast and Mitochondria Gene Families AT2G34430 88.1 2.0e-135 478.8
Cla10g01121 . 4 265 Chloroplast and Mitochondria Gene Families AT2G34430 85.6 4.7e-129 457.6
Cla02g00280 . 31 265 Chloroplast and Mitochondria Gene Families AT2G34430 83.2 1.9e-114 409.1
Cla10g00607 . 36 266 Chloroplast and Mitochondria Gene Families AT2G34430 70.5 8.4e-94 340.5
Cla03g00652 . 1 256 Chloroplast and Mitochondria Gene Families AT2G34430 55.9 2.3e-67 252.7
Cla04g00716 . 105 382 Chloroplast and Mitochondria Gene Families AT5G01530 83.5 6.7e-137 483.8
Cla10g02086 . 73 333 Chloroplast and Mitochondria Gene Families AT5G01530 84.1 2.4e-126 448.7
Cla10g00746 . 269 528 Chloroplast and Mitochondria Gene Families AT5G40810 93.5 2.5e-143 505.0
Cla10g00746 . 233 528 Chloroplast and Mitochondria Gene Families AT3G27240 83.5 6.8e-148 520.4
Cla02g01883 . 5 327 Chloroplast and Mitochondria Gene Families AT2G30160 75.3 7.1e-143 503.8
Cla04g00684 . 100 402 Chloroplast and Mitochondria Gene Families AT2G30160 64.2 9.4e-111 397.1
Cla02g01883 . 5 323 Chloroplast and Mitochondria Gene Families AT1G07030 76.4 3.2e-143 505.0
Cla04g00684 . 96 402 Chloroplast and Mitochondria Gene Families AT1G07030 67.5 1.7e-117 419.5
Cla09g00508 . 1 380 Chloroplast and Mitochondria Gene Families AT2G47490 55.5 1.6e-107 386.3
Cla01g00571 . 9 374 Chloroplast and Mitochondria Gene Families AT2G47490 52.6 4.6e-99 358.2
Cla01g00571 . 10 426 Chloroplast and Mitochondria Gene Families AT1G25380 54.1 9.3e-112 400.6
Cla09g00508 . 73 349 Chloroplast and Mitochondria Gene Families AT1G25380 57.0 8.8e-86 314.3
Cla03g00519 . 597 1172 Chloroplast and Mitochondria Gene Families AT4G21490 75.6 7.3e-260 893.3
Cla02g01697 . 434 1056 Chloroplast and Mitochondria Gene Families AT4G21490 66.2 6.6e-237 817.0
Cla02g00132 . 23 596 Chloroplast and Mitochondria Gene Families AT4G21490 64.7 1.2e-225 779.6
Cla09g00073 . 847 1035 Chloroplast and Mitochondria Gene Families AT1G17530 62.5 2.6e-62 235.3
Cla06g00914 . 4 179 Chloroplast and Mitochondria Gene Families AT1G17530 57.3 1.3e-50 196.4
Cla06g00914 . 12 183 Chloroplast and Mitochondria Gene Families AT3G04800 57.8 1.8e-50 196.1
Cla09g00073 . 871 1035 Chloroplast and Mitochondria Gene Families AT3G04800 53.9 1.5e-41 166.4
Cla09g00073 . 864 1035 Chloroplast and Mitochondria Gene Families AT1G72750 68.4 4.6e-62 234.6
Cla06g00914 . 5 183 Chloroplast and Mitochondria Gene Families AT1G72750 57.1 2.5e-52 202.2
Cla05g02337 CCT 663 837 Chloroplast and Mitochondria Gene Families AT1G26100 69.7 1.6e-67 253.1
Cla11g00506 . 1 278 Chloroplast and Mitochondria Gene Families AT5G38630 57.7 4.4e-83 304.7
Cla09g01236 . 144 351 Chloroplast and Mitochondria Gene Families AT4G25570 69.5 4.9e-84 308.1
Cla01g00658 . 2 225 Chloroplast and Mitochondria Gene Families AT1G14730 50.4 2.7e-61 232.3
Cla01g00764 . 9 356 Chloroplast and Mitochondria Gene Families AT5G14040 82.3 2.3e-169 592.0
Cla05g01339 . 10 395 Chloroplast and Mitochondria Gene Families AT5G14040 69.8 5.0e-153 537.7
Cla06g01777 . 39 329 Chloroplast and Mitochondria Gene Families AT5G14040 86.6 4.4e-149 524.6
Cla02g00337 . 11 297 Chloroplast and Mitochondria Gene Families AT5G14040 52.1 1.2e-82 303.9
Cla01g00764 . 8 356 Chloroplast and Mitochondria Gene Families AT3G48850 72.0 7.6e-146 513.8
Cla05g01339 . 11 401 Chloroplast and Mitochondria Gene Families AT3G48850 65.1 1.8e-139 492.7
Cla06g01777 . 10 329 Chloroplast and Mitochondria Gene Families AT3G48850 67.6 2.3e-134 475.7
Cla02g00337 . 11 297 Chloroplast and Mitochondria Gene Families AT3G48850 50.5 3.7e-84 308.9
Cla02g00337 . 14 308 Chloroplast and Mitochondria Gene Families AT2G17270 76.9 1.1e-132 469.9
Cla01g00764 . 62 352 Chloroplast and Mitochondria Gene Families AT2G17270 52.6 4.8e-85 311.6
Cla06g01777 . 44 328 Chloroplast and Mitochondria Gene Families AT2G17270 50.2 5.5e-81 298.1
Cla11g00459 . 16 343 Chloroplast and Mitochondria Gene Families AT5G15640 68.6 4.7e-120 427.9
Cla05g00729 . 47 341 Chloroplast and Mitochondria Gene Families AT5G15640 50.2 5.9e-78 288.1
Cla05g01857 . 12 345 Chloroplast and Mitochondria Gene Families AT5G26200 66.8 1.2e-124 443.4
Cla09g00079 . 1 344 Chloroplast and Mitochondria Gene Families AT5G26200 57.8 1.8e-104 376.3
Cla09g00079 . 1 348 Chloroplast and Mitochondria Gene Families AT1G72820 75.8 2.3e-147 518.8
Cla05g01857 . 1 346 Chloroplast and Mitochondria Gene Families AT1G72820 68.8 5.1e-131 464.5
Cla01g00235 CCT,ECH 82 285 Chloroplast and Mitochondria Gene Families AT5G52570 52.5 2.3e-50 196.1
Cla05g00912 CCT,ECH 1 219 Chloroplast and Mitochondria Gene Families AT4G25700 63.2 1.2e-69 260.0
Cla01g00235 CCT,ECH 31 204 Chloroplast and Mitochondria Gene Families AT4G25700 62.2 1.5e-56 216.5
Cla02g00146 . 177 355 Chloroplast and Mitochondria Gene Families AT4G03320 52.2 8.8e-57 217.6
Cla10g00609 . 72 359 Chloroplast and Mitochondria Gene Families AT5G54290 79.0 9.1e-120 427.2
Cla06g01286 . 43 546 Chloroplast and Mitochondria Gene Families AT2G18710 83.9 4.7e-240 827.4
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0001922 1 2 3 2 2 2 4 2 2 2 2 2 3 2 2 4 2 2 4 2 2 2 2 2 2 2 1 2 3 1 66