Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cla08g01285 ATGGCTGTCAAAACAGCTCAATCATTTAGAGATCGGACGCTGGAATTCCAGAATATAACAGAGAGGCTAAAGAAGTCTTTCTCATCTGGCACGGGACCAACTGGACCAAGTGCTGTTTCAAAATCAGAAGAGCAGCGCTCTTCTGTGGCTCTACAGTCTGAATTCAATAAGAGGGCTTCCAAGATTGGGTTAGGGATACACCAGACATCTCAGAAACTCTCAAAGTTGGCAAAATTGGCAAAGAGGACTTCAGTTTTTGATGACCCAACAATGGAAATCCAGGAGCTAACTGCTCTTATTAAGCAGGACATTACAACATTGAACTCTGCCGTTGTAGATCTTCAGCTTCTCTGCAACTCTAGAAATGAAAATGGAAACATATCCAGTGATACTTCTAGTCATTCAACCACTGTGGTAGATGATCTTAAGAATCGACTGATGAGCACCACAAAAGAATTTAAAGAAGTTCTGACAATGCGAACAGAAAATTTGAAGGTTCATGAGAACAGAAGACAACTATTTTCTTCTACTGCTTCAAAGGAATCTACAAATCCTTTTGTTCGCCAGCGCCCATTAGCATCTAGGTCAGCTGCTGGTGCCCCAAGTGCACCCCCTCCTCCATGGGCCAAGGCGTCTACATCTTTTTCCAAAACATCTCCTGGGAAGCAGGTGGATGGGGAGGGTCAACCATTATTGCAGCAGCAACAGCAACAGCAACAGATGGTTCCATTACAAGATACTTACATGCAGAGCAGAGCTGAAGCTCTTCAAAATGTAGAATCCACCATTCATGAATTGAGCAATATCTTCAATCAGCTGGCAACTCTGGTTTCTGAACAAGGAGAGATTGCTATCAGGATCGATGAGAACATGGACGATACTCTCGCAAATGTGGAGGGAGCGCAGGGAGCTTTGCTCAAATATCTAAGCAGTATATCATCAAACAGGTGGTTGATGATCAAAATTTTCTTTGTACTAATATTCTTCCTCATGGTTTTCCTATTTTTTGTGGCATAG 1017 42.67 MAVKTAQSFRDRTLEFQNITERLKKSFSSGTGPTGPSAVSKSEEQRSSVALQSEFNKRASKIGLGIHQTSQKLSKLAKLAKRTSVFDDPTMEIQELTALIKQDITTLNSAVVDLQLLCNSRNENGNISSDTSSHSTTVVDDLKNRLMSTTKEFKEVLTMRTENLKVHENRRQLFSSTASKESTNPFVRQRPLASRSAAGAPSAPPPPWAKASTSFSKTSPGKQVDGEGQPLLQQQQQQQQMVPLQDTYMQSRAEALQNVESTIHELSNIFNQLATLVSEQGEIAIRIDENMDDTLANVEGAQGALLKYLSSISSNRWLMIKIFFVLIFFLMVFLFFVA 338
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
8 25743861 25749137 + ClCG08G012870.1 Cla08g01285 278940

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cla08g01285 338 SUPERFAMILY t-snare proteins 52 301 IPR010989 GO:0016020|GO:0016192
Cla08g01285 338 Pfam Syntaxin-5 N-terminal, Sly1p-binding domain 6 25 IPR021538 -
Cla08g01285 338 SMART tSNARE_6 241 308 IPR000727 -
Cla08g01285 338 Pfam SNARE domain 282 334 IPR000727 -
Cla08g01285 338 CDD SNARE_syntaxin5 249 327 - -
Cla08g01285 338 MobiDBLite consensus disorder prediction 209 242 - -
Cla08g01285 338 MobiDBLite consensus disorder prediction 170 190 - -
Cla08g01285 338 ProSitePatterns Syntaxin / epimorphin family signature. 252 291 IPR006012 GO:0005484|GO:0006886|GO:0016020
Cla08g01285 338 PANTHER SYNTAXIN-32-LIKE 7 337 - -
Cla08g01285 338 PANTHER SYNTAXIN 7 337 IPR045242 -
Cla08g01285 338 Gene3D - 50 301 - -
Cla08g01285 338 MobiDBLite consensus disorder prediction 24 46 - -
Cla08g01285 338 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 246 308 IPR000727 -
Cla08g01285 338 MobiDBLite consensus disorder prediction 168 242 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cla08g01285 K08490 STX5; syntaxin 5 - csv:101203633 535.028
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cla07g00385 Cla-Chr7:4637040 Cla08g01285 Cla-Chr8:25743861 3.23E-88 dispersed
Cla08g01285 Cla-Chr8:25743861 Cla09g00505 Cla-Chr9:4769104 7.06E-07 dispersed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cla08g01285 . 8 338 SNARE and Associated Proteins AT3G24350 64.8 6.7e-102 367.9
Cla04g00533 . 1 309 SNARE and Associated Proteins AT1G08560 69.6 3.7e-101 365.2
Cla01g01917 . 411 714 SNARE and Associated Proteins AT2G18260 54.7 1.9e-86 316.2
Cla10g01736 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.5e-115 411.8
Cla01g01480 . 26 282 SNARE and Associated Proteins AT3G11820 72.8 9.0e-103 370.5
Cla03g00522 . 31 281 SNARE and Associated Proteins AT3G11820 66.5 1.1e-92 337.0
Cla10g01288 . 573 827 SNARE and Associated Proteins AT3G11820 52.5 5.0e-69 258.5
Cla10g01736 . 1 279 SNARE and Associated Proteins AT3G52400 63.9 5.9e-92 334.7
Cla01g01480 . 33 282 SNARE and Associated Proteins AT3G52400 64.8 2.4e-85 312.8
Cla03g00522 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 3.6e-81 298.9
Cla10g01288 . 575 827 SNARE and Associated Proteins AT3G52400 50.6 5.4e-61 231.9
Cla03g00522 . 1 299 SNARE and Associated Proteins AT4G03330 69.2 3.1e-108 388.7
Cla10g01736 . 1 284 SNARE and Associated Proteins AT4G03330 57.2 3.1e-84 308.9
Cla01g01480 . 1 297 SNARE and Associated Proteins AT4G03330 52.6 3.9e-79 292.0
Cla10g01288 . 564 827 SNARE and Associated Proteins AT4G03330 53.8 1.2e-67 253.8
Cla03g00522 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 1.0e-127 453.4
Cla10g01736 . 1 284 SNARE and Associated Proteins AT1G61290 62.0 2.6e-91 332.4
Cla01g01480 . 1 297 SNARE and Associated Proteins AT1G61290 56.6 1.6e-85 313.2
Cla10g01288 . 579 827 SNARE and Associated Proteins AT1G61290 50.6 1.9e-62 236.5
Cla03g00522 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 1.8e-124 442.6
Cla10g01736 . 1 284 SNARE and Associated Proteins AT1G11250 62.0 1.6e-93 339.7
Cla01g01480 . 1 292 SNARE and Associated Proteins AT1G11250 57.2 1.1e-86 317.0
Cla10g01288 . 563 827 SNARE and Associated Proteins AT1G11250 50.6 4.9e-66 248.4
Cla10g01288 . 548 846 SNARE and Associated Proteins AT3G03800 73.6 6.0e-112 401.0
Cla10g01288 . 548 745 SNARE and Associated Proteins AT5G08080 78.4 2.4e-78 288.9
Cla10g00138 . 48 319 SNARE and Associated Proteins AT5G16830 56.5 5.0e-73 271.6
Cla10g00138 . 48 319 SNARE and Associated Proteins AT5G46860 62.1 4.2e-77 285.0
Cla10g00138 . 48 237 SNARE and Associated Proteins AT4G17730 76.4 1.8e-72 269.6
Cla10g00138 . 112 319 SNARE and Associated Proteins AT1G32270 54.8 4.3e-50 195.7
Cla07g00385 . 1 336 SNARE and Associated Proteins AT5G05760 65.9 3.3e-111 398.7
Cla08g01285 . 8 338 SNARE and Associated Proteins AT3G24350 64.8 6.7e-102 367.9
Cla02g01497 . 1 327 SNARE and Associated Proteins AT5G26980 76.8 4.8e-128 454.5
Cla09g00505 . 1 356 SNARE and Associated Proteins AT5G26980 59.2 1.3e-96 350.1
Cla02g01497 . 1 329 SNARE and Associated Proteins AT4G02195 64.4 3.4e-105 378.6
Cla09g00505 . 1 356 SNARE and Associated Proteins AT4G02195 59.7 5.6e-100 361.3
Cla02g01497 . 1 328 SNARE and Associated Proteins AT3G05710 76.3 4.1e-130 461.5
Cla09g00505 . 1 356 SNARE and Associated Proteins AT3G05710 57.1 5.2e-93 338.2
Cla09g01036 . 86 310 SNARE and Associated Proteins AT1G16240 69.5 5.8e-83 304.3
Cla10g00459 . 19 243 SNARE and Associated Proteins AT1G16240 65.7 3.7e-77 285.0
Cla09g01036 . 85 310 SNARE and Associated Proteins AT1G79590 68.8 1.9e-82 302.8
Cla10g00459 . 19 243 SNARE and Associated Proteins AT1G79590 66.1 9.9e-79 290.4
Cla06g00045 . 170 315 SNARE and Associated Proteins AT1G28490 69.9 9.6e-50 193.7
Cla10g01938 . 118 381 SNARE and Associated Proteins AT3G09740 79.7 2.8e-113 405.2
Cla02g02052 . 1 265 SNARE and Associated Proteins AT3G09740 67.4 9.9e-95 343.6
Cla02g02052 . 1 265 SNARE and Associated Proteins AT3G45280 65.9 7.9e-92 334.0
Cla10g01938 . 118 381 SNARE and Associated Proteins AT3G45280 64.4 9.0e-88 320.5
Cla10g01938 . 118 378 SNARE and Associated Proteins AT3G61450 68.2 7.5e-95 344.0
Cla02g02052 . 1 262 SNARE and Associated Proteins AT3G61450 61.0 2.0e-84 309.3
Cla11g00615 . 65 272 SNARE and Associated Proteins AT1G51740 69.0 9.2e-71 263.8
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0008511 1 1 1 0 1 1 2 1 1 0 1 1 1 1 1 1 1 2 1 1 0 1 1 1 1 1 1 6 1 2 35
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Cla08g01285 Cla_Chr08 FPKM 19.879961 24.412939 14.044213 15.387403 9.037498 8.77605 9.789929 13.050485 13.039021 13.072028