Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cla09g01036 ATGATGATGATTACACGTGGACATGGGACCCACGGTTTACCTTGTGGAGTTAGGGATTTTCAGTCCAATTTGCTCAGAGCCAAATTCCGTCGTTCTGATTTCCGATTCCGATTGATCGACGAACGTTGGTCGCCGGCGGTGGGGGATTTGTATCGTCTTCCATTTGAATTCAATCAATCCCCATACAATTCCACAGCCGCCCGCTTTTCCGAACGGGGCAATTTTCGGGGTGTTTGTTGGTTTGTTCCATGGTCAATGGCGTATACATTGGAATCGTGGACGAAGGAATACAATGAAGCTTTGAAACTGTCTGAAGATATCAATGGCATGATTTCTGAGAGAAGTTCACTTGCTGCATCTGGACCGGAAGCTCAGCGTCATGGCTCAGCTATACGCAGGAAGATCACAATATTGGGTACCAGACTTGATACCTTGCAGACTCAGTTACCCAAGCTTCAAGGAAAGCAACCAATACCAGAGAAAGAGATGAATCGCCGCAGGGACATGATTGCAAATTTGAGATCAAAAGCTAAGCAGATGGCTTCAACTTTGAACATGTCTAACTTTGCTAACCGGGATAGCTTACTTGGTCCAGAAATAAAGCCAGCTGATGTCATGAACAGAACAGAAGGCTTGGACAACCGAGGCCTAGTTGAGCAAGATGAAGGCCTTGAGAAACTGGAAGGGACTATAATTAGCACAAAACATATTGCATTAGCCGTCAATGAAGAACTTAACCTTCACACGAGACTTATTGATGATTTGGATGAACATGTCGATGTTACAGATTCCCGATTACGGCGAGTGCAGAAGAGGCTGGCAATACTGAACAAGCGGACCAAGGGTGGTTGCACTTGCATGTCAATGATTTTATCAGTTGTTGGGATTGTCGTTCTTATCGCTGTCATATGGCTACTGGTCAAGTATTTGTAA 933 44.91 MMMITRGHGTHGLPCGVRDFQSNLLRAKFRRSDFRFRLIDERWSPAVGDLYRLPFEFNQSPYNSTAARFSERGNFRGVCWFVPWSMAYTLESWTKEYNEALKLSEDINGMISERSSLAASGPEAQRHGSAIRRKITILGTRLDTLQTQLPKLQGKQPIPEKEMNRRRDMIANLRSKAKQMASTLNMSNFANRDSLLGPEIKPADVMNRTEGLDNRGLVEQDEGLEKLEGTIISTKHIALAVNEELNLHTRLIDDLDEHVDVTDSRLRRVQKRLAILNKRTKGGCTCMSMILSVVGIVVLIAVIWLLVKYL 310
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
9 10956463 10959268 + ClCG09G011110.2 Cla09g01036 280456

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cla09g01036 310 Gene3D - 216 278 - -
Cla09g01036 310 PANTHER TARGET SNARE COILED-COIL DOMAIN-CONTAINING PROTEIN-RELATED 91 305 - -
Cla09g01036 310 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 219 276 IPR000727 -
Cla09g01036 310 Pfam SNARE domain 251 301 IPR000727 -
Cla09g01036 310 CDD SNARE_Qc 219 274 - -
Cla09g01036 310 SMART tSNARE_6 208 276 IPR000727 -
Cla09g01036 310 PANTHER SYNTAXIN 91 305 IPR045242 -
Cla09g01036 310 SUPERFAMILY SNARE fusion complex 218 275 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cla09g01036 K08503 SYP5; syntaxin of plants SYP5 - csv:101208669 397.512
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cla09g01036 Cla-Chr9:10956463 Cla10g00459 Cla-Chr10:6069528 6.30E-117 transposed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi19g583 Blo03g00538 . Bda07g00381 Bda09g00411 . Bpe08g01109 . . Cmo16g00959 . Cma01g01111 Cma09g00975 Car01g00980 Car09g00889 Sed07g2705 Cpe06g00787 Cpe02g00792 Bhi09g01700 Tan01g3132 Cmetu01g0482 . Hepe01g1245 Mch11g1220 . . . . . . . . Cone6ag0041 Cone9ag0047 Cone14ag1185 Cone15ag1202 Lsi02g01877 . . . . . Bda05g00693 . . Bpe03g00767 Bma07g01281 Bma14g00320 . Cmo01g01156 Cmo09g00974 . Cma16g00924 . Car16g00895 Cpe14g00748 . . . . . . . . Cla09g01036 Cam09g1092 Cec09g1092 Cco09g1113 . . Cre09g1057 . . Chy01g01059 Cme01g00994
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cla08g01285 . 8 338 SNARE and Associated Proteins AT3G24350 64.8 6.7e-102 367.9
Cla04g00533 . 1 309 SNARE and Associated Proteins AT1G08560 69.6 3.7e-101 365.2
Cla01g01917 . 411 714 SNARE and Associated Proteins AT2G18260 54.7 1.9e-86 316.2
Cla10g01736 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.5e-115 411.8
Cla01g01480 . 26 282 SNARE and Associated Proteins AT3G11820 72.8 9.0e-103 370.5
Cla03g00522 . 31 281 SNARE and Associated Proteins AT3G11820 66.5 1.1e-92 337.0
Cla10g01288 . 573 827 SNARE and Associated Proteins AT3G11820 52.5 5.0e-69 258.5
Cla10g01736 . 1 279 SNARE and Associated Proteins AT3G52400 63.9 5.9e-92 334.7
Cla01g01480 . 33 282 SNARE and Associated Proteins AT3G52400 64.8 2.4e-85 312.8
Cla03g00522 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 3.6e-81 298.9
Cla10g01288 . 575 827 SNARE and Associated Proteins AT3G52400 50.6 5.4e-61 231.9
Cla03g00522 . 1 299 SNARE and Associated Proteins AT4G03330 69.2 3.1e-108 388.7
Cla10g01736 . 1 284 SNARE and Associated Proteins AT4G03330 57.2 3.1e-84 308.9
Cla01g01480 . 1 297 SNARE and Associated Proteins AT4G03330 52.6 3.9e-79 292.0
Cla10g01288 . 564 827 SNARE and Associated Proteins AT4G03330 53.8 1.2e-67 253.8
Cla03g00522 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 1.0e-127 453.4
Cla10g01736 . 1 284 SNARE and Associated Proteins AT1G61290 62.0 2.6e-91 332.4
Cla01g01480 . 1 297 SNARE and Associated Proteins AT1G61290 56.6 1.6e-85 313.2
Cla10g01288 . 579 827 SNARE and Associated Proteins AT1G61290 50.6 1.9e-62 236.5
Cla03g00522 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 1.8e-124 442.6
Cla10g01736 . 1 284 SNARE and Associated Proteins AT1G11250 62.0 1.6e-93 339.7
Cla01g01480 . 1 292 SNARE and Associated Proteins AT1G11250 57.2 1.1e-86 317.0
Cla10g01288 . 563 827 SNARE and Associated Proteins AT1G11250 50.6 4.9e-66 248.4
Cla10g01288 . 548 846 SNARE and Associated Proteins AT3G03800 73.6 6.0e-112 401.0
Cla10g01288 . 548 745 SNARE and Associated Proteins AT5G08080 78.4 2.4e-78 288.9
Cla10g00138 . 48 319 SNARE and Associated Proteins AT5G16830 56.5 5.0e-73 271.6
Cla10g00138 . 48 319 SNARE and Associated Proteins AT5G46860 62.1 4.2e-77 285.0
Cla10g00138 . 48 237 SNARE and Associated Proteins AT4G17730 76.4 1.8e-72 269.6
Cla10g00138 . 112 319 SNARE and Associated Proteins AT1G32270 54.8 4.3e-50 195.7
Cla07g00385 . 1 336 SNARE and Associated Proteins AT5G05760 65.9 3.3e-111 398.7
Cla08g01285 . 8 338 SNARE and Associated Proteins AT3G24350 64.8 6.7e-102 367.9
Cla02g01497 . 1 327 SNARE and Associated Proteins AT5G26980 76.8 4.8e-128 454.5
Cla09g00505 . 1 356 SNARE and Associated Proteins AT5G26980 59.2 1.3e-96 350.1
Cla02g01497 . 1 329 SNARE and Associated Proteins AT4G02195 64.4 3.4e-105 378.6
Cla09g00505 . 1 356 SNARE and Associated Proteins AT4G02195 59.7 5.6e-100 361.3
Cla02g01497 . 1 328 SNARE and Associated Proteins AT3G05710 76.3 4.1e-130 461.5
Cla09g00505 . 1 356 SNARE and Associated Proteins AT3G05710 57.1 5.2e-93 338.2
Cla09g01036 . 86 310 SNARE and Associated Proteins AT1G16240 69.5 5.8e-83 304.3
Cla10g00459 . 19 243 SNARE and Associated Proteins AT1G16240 65.7 3.7e-77 285.0
Cla09g01036 . 85 310 SNARE and Associated Proteins AT1G79590 68.8 1.9e-82 302.8
Cla10g00459 . 19 243 SNARE and Associated Proteins AT1G79590 66.1 9.9e-79 290.4
Cla06g00045 . 170 315 SNARE and Associated Proteins AT1G28490 69.9 9.6e-50 193.7
Cla10g01938 . 118 381 SNARE and Associated Proteins AT3G09740 79.7 2.8e-113 405.2
Cla02g02052 . 1 265 SNARE and Associated Proteins AT3G09740 67.4 9.9e-95 343.6
Cla02g02052 . 1 265 SNARE and Associated Proteins AT3G45280 65.9 7.9e-92 334.0
Cla10g01938 . 118 381 SNARE and Associated Proteins AT3G45280 64.4 9.0e-88 320.5
Cla10g01938 . 118 378 SNARE and Associated Proteins AT3G61450 68.2 7.5e-95 344.0
Cla02g02052 . 1 262 SNARE and Associated Proteins AT3G61450 61.0 2.0e-84 309.3
Cla11g00615 . 65 272 SNARE and Associated Proteins AT1G51740 69.0 9.2e-71 263.8
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002063 3 5 2 3 2 1 3 1 2 1 1 1 3 2 2 3 1 4 3 1 2 2 1 2 2 2 1 5 3 1 65
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Cla09g01036 Cla_Chr09 FPKM 0.560261 0.0 1.883382 1.985887 0.56364 0.0 0.0 1.271187 0.74723 0.837175