Gene search
Sequence information
| Select | Gene | Cds | Cds_length | GC_content | Pep | Pep_length |
|---|---|---|---|---|---|---|
| Cla10g01938 | ATGACGAAAATGGGTTCAAGGGAAGGTGCTCTGCCTCGATCTAGTCAAATGGGAAACAGAGTATGCCCTTCGGTCTGGTCCAGATCTGCAAGTTCGGAAGGTTTTGAACACCAACAAACATCGTTTGGAGCCTTTTTGATTGAGTTATATTTCGGGGACTGGCTAGAGTTTAATAATTTATCCTCTTACGTTTGGAGGGAGAGGAAAGGAAAAGCTCGAGAGACTGATCCGACCGAAATTGAGTTGGGTTGGTTTACGGCATCGCAAACTCGAAATACATATTCACGGAACCACTTTTACTGCCGTACGTCACCGGAAAACCTACCGGGGCGCGGAGGCGAAGAATCAAAGATGAGCGTGATCGACCTTTTGACCAGAGTAGATGCGATTTGCCAGAAGTACGACAAATATGACGTTGAAAAGCAGAGAGATCTCAATGTTTCCGGCGACGATGCCTTCGCTCGACTCTACGCCACTGTCGAAGCTGACATTGAAGCCGCTCTCCAGAAAGCGGAGGATGCTTCTAAAGAGAAGAATAGGGCATCGGTGGTGGCGTTGAATGCGGAGATTCGTCGTACCAAGGCGCGGTTACTGGAGGAGGTCCCCAAGTTGCAGAGATTGGCTGTAAAGAGGGTTAAAGGGCTATCAACCGAAGATCTTACCACCCGAAATGATTTGGTGCTTGCATTGCCAGAGAGGATTCAAGCTATACCAGATGGAACTGCGACTTCCACGAAGAATAATGGGGGTTGGACATCCTCAGCTTCGCGTGCTGAAATCAAATTTGACTCAGATGGGCGATTCGATGATGAGTACTTCCAACACACTGAGGAGTCAAGTCAGTTCAGGCAAGAGTATGAAATGCGGAAAATGAAGCAGGATCAAGGATTGGACATGATATCAGAAGGGTTAGATACTCTGAAGAACATGGCACATGATATGAATGAGGAAATAGATAGGCAAGTCCCTTTGATGGACGAGATTGACACTAAGGTGGACAAGGCTGCATCTGACCTTAAGAACACCAATGTTAGATTAAAAGACACAGTTAACCAGCTAAGGTCCAGCAGAAATTTCTGTATTGATATCATTCTGTTGTGTATAATCTTGGGGATTGCTGCCTATCTATACAATGTGTTGAAGAAGTGA | 1149 | 45.95 | MTKMGSREGALPRSSQMGNRVCPSVWSRSASSEGFEHQQTSFGAFLIELYFGDWLEFNNLSSYVWRERKGKARETDPTEIELGWFTASQTRNTYSRNHFYCRTSPENLPGRGGEESKMSVIDLLTRVDAICQKYDKYDVEKQRDLNVSGDDAFARLYATVEADIEAALQKAEDASKEKNRASVVALNAEIRRTKARLLEEVPKLQRLAVKRVKGLSTEDLTTRNDLVLALPERIQAIPDGTATSTKNNGGWTSSASRAEIKFDSDGRFDDEYFQHTEESSQFRQEYEMRKMKQDQGLDMISEGLDTLKNMAHDMNEEIDRQVPLMDEIDTKVDKAASDLKNTNVRLKDTVNQLRSSRNFCIDIILLCIILGIAAYLYNVLKK | 382 |
Gff information
| Chromosome | Start | End | Strand | Old_gene | Gene | Num |
|---|---|---|---|---|---|---|
| 10 | 35222601 | 35229624 | - | ClCG10G020390.2 | Cla10g01938 | 283597 |
Annotation
| Select | Seq ID | Length | Analysis | Description | Start | End | IPR | GO |
|---|---|---|---|---|---|---|---|---|
| Cla10g01938 | 382 | CDD | SNARE_Qc | 292 | 347 | - | - | |
| Cla10g01938 | 382 | ProSiteProfiles | t-SNARE coiled-coil homology domain profile. | 287 | 349 | IPR000727 | - | |
| Cla10g01938 | 382 | PANTHER | SYNTAXIN | 118 | 378 | IPR045242 | - | |
| Cla10g01938 | 382 | ProSitePatterns | Syntaxin / epimorphin family signature. | 293 | 332 | IPR006012 | GO:0005484|GO:0006886|GO:0016020 | |
| Cla10g01938 | 382 | MobiDBLite | consensus disorder prediction | 1 | 21 | - | - | |
| Cla10g01938 | 382 | SMART | tSNARE_6 | 282 | 349 | IPR000727 | - | |
| Cla10g01938 | 382 | Pfam | SNARE domain | 324 | 373 | IPR000727 | - | |
| Cla10g01938 | 382 | Gene3D | - | 287 | 348 | - | - | |
| Cla10g01938 | 382 | Coils | Coil | 157 | 177 | - | - | |
| Cla10g01938 | 382 | Coils | Coil | 336 | 356 | - | - | |
| Cla10g01938 | 382 | PANTHER | SYNTAXIN-73 | 118 | 378 | - | - | |
| Cla10g01938 | 382 | SUPERFAMILY | SNARE fusion complex | 280 | 347 | - | - |
Pathway
| Select | Query | KO | Definition | Second KO | KEGG Genes ID | GHOSTX Score |
|---|---|---|---|---|---|---|
| Cla10g01938 | K08506 | SYP7; syntaxin of plants SYP7 | - | csv:101215905 | 496.508 |
Dupl-types
| Select | Gene1 | Location1 | Gene2 | Location2 | E-value | Duplicated-type |
|---|---|---|---|---|---|---|
| Cla10g01938 | Cla-Chr10:35222601 | Cla02g02052 | Cla-Chr2:35582092 | 9.71E-118 | wgd |
Deco-Alignment
| Select | Vvi1 | Blo1 | Blo2 | Bda1 | Bda2 | Bpe1 | Bpe2 | Bma1 | Bma2 | Cmo1 | Cmo2 | Cma1 | Cma2 | Car1 | Car2 | Sed1 | Cpe1 | Cpe2 | Bhi1 | Tan1 | Cmetu1 | Lac1 | Hepe1 | Mch1 | Lcy1 | Cla1 | Cam1 | Cec1 | Cco1 | Clacu1 | Cmu1 | Cre1 | Cone1 | Cone2 | Cone3 | Cone4 | Lsi1 | Csa1 | Chy1 | Cme1 | Blo3 | Blo4 | Bda3 | Bda4 | Bpe3 | Bpe4 | Bma3 | Bma4 | Sed2 | Cmo3 | Cmo4 | Cma3 | Cma4 | Car3 | Car4 | Cpe3 | Cpe4 | Bhi2 | Tan2 | Cmetu2 | Lac2 | Hepe2 | Mch2 | Lcy2 | Cla2 | Cam2 | Cec2 | Cco2 | Clacu2 | Cmu2 | Cre2 | Lsi2 | Csa2 | Chy2 | Cme2 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Vvi8g590 | . | . | . | . | Bpe04g01584 | . | . | . | . | Cmo14g00195 | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | . | Cone13ag1275 | Cone19ag1262 | . | . | . | Cme04g02538 | . | . | . | . | . | . | . | . | Sed04g1347 | . | . | . | Cma14g00203 | . | Car14g00181 | Cpe03g00174 | . | Bhi11g02112 | Tan08g1893 | Cmetu04g1845 | Lac10g3026 | Hepe05g0250 | . | . | Cla10g01938 | Cam10g2004 | Cec10g2046 | Cco10g2031 | Clacu10g2011 | Cmu10g2760 | Cre10g2153 | Lsi03g02035 | Csa03g03265 | Chy04g02075 | . |
Syn-Families
| Select | Gene | Event_type | S_start | S_end | Function | Ath_gene | Identity(%) | E-value | Score |
|---|---|---|---|---|---|---|---|---|---|
| Cla08g01285 | . | 8 | 338 | SNARE and Associated Proteins | AT3G24350 | 64.8 | 6.7e-102 | 367.9 | |
| Cla04g00533 | . | 1 | 309 | SNARE and Associated Proteins | AT1G08560 | 69.6 | 3.7e-101 | 365.2 | |
| Cla01g01917 | . | 411 | 714 | SNARE and Associated Proteins | AT2G18260 | 54.7 | 1.9e-86 | 316.2 | |
| Cla10g01736 | . | 19 | 279 | SNARE and Associated Proteins | AT3G11820 | 80.8 | 3.5e-115 | 411.8 | |
| Cla01g01480 | . | 26 | 282 | SNARE and Associated Proteins | AT3G11820 | 72.8 | 9.0e-103 | 370.5 | |
| Cla03g00522 | . | 31 | 281 | SNARE and Associated Proteins | AT3G11820 | 66.5 | 1.1e-92 | 337.0 | |
| Cla10g01288 | . | 573 | 827 | SNARE and Associated Proteins | AT3G11820 | 52.5 | 5.0e-69 | 258.5 | |
| Cla10g01736 | . | 1 | 279 | SNARE and Associated Proteins | AT3G52400 | 63.9 | 5.9e-92 | 334.7 | |
| Cla01g01480 | . | 33 | 282 | SNARE and Associated Proteins | AT3G52400 | 64.8 | 2.4e-85 | 312.8 | |
| Cla03g00522 | . | 1 | 281 | SNARE and Associated Proteins | AT3G52400 | 56.4 | 3.6e-81 | 298.9 | |
| Cla10g01288 | . | 575 | 827 | SNARE and Associated Proteins | AT3G52400 | 50.6 | 5.4e-61 | 231.9 | |
| Cla03g00522 | . | 1 | 299 | SNARE and Associated Proteins | AT4G03330 | 69.2 | 3.1e-108 | 388.7 | |
| Cla10g01736 | . | 1 | 284 | SNARE and Associated Proteins | AT4G03330 | 57.2 | 3.1e-84 | 308.9 | |
| Cla01g01480 | . | 1 | 297 | SNARE and Associated Proteins | AT4G03330 | 52.6 | 3.9e-79 | 292.0 | |
| Cla10g01288 | . | 564 | 827 | SNARE and Associated Proteins | AT4G03330 | 53.8 | 1.2e-67 | 253.8 | |
| Cla03g00522 | . | 1 | 299 | SNARE and Associated Proteins | AT1G61290 | 79.3 | 1.0e-127 | 453.4 | |
| Cla10g01736 | . | 1 | 284 | SNARE and Associated Proteins | AT1G61290 | 62.0 | 2.6e-91 | 332.4 | |
| Cla01g01480 | . | 1 | 297 | SNARE and Associated Proteins | AT1G61290 | 56.6 | 1.6e-85 | 313.2 | |
| Cla10g01288 | . | 579 | 827 | SNARE and Associated Proteins | AT1G61290 | 50.6 | 1.9e-62 | 236.5 | |
| Cla03g00522 | . | 1 | 299 | SNARE and Associated Proteins | AT1G11250 | 78.3 | 1.8e-124 | 442.6 | |
| Cla10g01736 | . | 1 | 284 | SNARE and Associated Proteins | AT1G11250 | 62.0 | 1.6e-93 | 339.7 | |
| Cla01g01480 | . | 1 | 292 | SNARE and Associated Proteins | AT1G11250 | 57.2 | 1.1e-86 | 317.0 | |
| Cla10g01288 | . | 563 | 827 | SNARE and Associated Proteins | AT1G11250 | 50.6 | 4.9e-66 | 248.4 | |
| Cla10g01288 | . | 548 | 846 | SNARE and Associated Proteins | AT3G03800 | 73.6 | 6.0e-112 | 401.0 | |
| Cla10g01288 | . | 548 | 745 | SNARE and Associated Proteins | AT5G08080 | 78.4 | 2.4e-78 | 288.9 | |
| Cla10g00138 | . | 48 | 319 | SNARE and Associated Proteins | AT5G16830 | 56.5 | 5.0e-73 | 271.6 | |
| Cla10g00138 | . | 48 | 319 | SNARE and Associated Proteins | AT5G46860 | 62.1 | 4.2e-77 | 285.0 | |
| Cla10g00138 | . | 48 | 237 | SNARE and Associated Proteins | AT4G17730 | 76.4 | 1.8e-72 | 269.6 | |
| Cla10g00138 | . | 112 | 319 | SNARE and Associated Proteins | AT1G32270 | 54.8 | 4.3e-50 | 195.7 | |
| Cla07g00385 | . | 1 | 336 | SNARE and Associated Proteins | AT5G05760 | 65.9 | 3.3e-111 | 398.7 | |
| Cla08g01285 | . | 8 | 338 | SNARE and Associated Proteins | AT3G24350 | 64.8 | 6.7e-102 | 367.9 | |
| Cla02g01497 | . | 1 | 327 | SNARE and Associated Proteins | AT5G26980 | 76.8 | 4.8e-128 | 454.5 | |
| Cla09g00505 | . | 1 | 356 | SNARE and Associated Proteins | AT5G26980 | 59.2 | 1.3e-96 | 350.1 | |
| Cla02g01497 | . | 1 | 329 | SNARE and Associated Proteins | AT4G02195 | 64.4 | 3.4e-105 | 378.6 | |
| Cla09g00505 | . | 1 | 356 | SNARE and Associated Proteins | AT4G02195 | 59.7 | 5.6e-100 | 361.3 | |
| Cla02g01497 | . | 1 | 328 | SNARE and Associated Proteins | AT3G05710 | 76.3 | 4.1e-130 | 461.5 | |
| Cla09g00505 | . | 1 | 356 | SNARE and Associated Proteins | AT3G05710 | 57.1 | 5.2e-93 | 338.2 | |
| Cla09g01036 | . | 86 | 310 | SNARE and Associated Proteins | AT1G16240 | 69.5 | 5.8e-83 | 304.3 | |
| Cla10g00459 | . | 19 | 243 | SNARE and Associated Proteins | AT1G16240 | 65.7 | 3.7e-77 | 285.0 | |
| Cla09g01036 | . | 85 | 310 | SNARE and Associated Proteins | AT1G79590 | 68.8 | 1.9e-82 | 302.8 | |
| Cla10g00459 | . | 19 | 243 | SNARE and Associated Proteins | AT1G79590 | 66.1 | 9.9e-79 | 290.4 | |
| Cla06g00045 | . | 170 | 315 | SNARE and Associated Proteins | AT1G28490 | 69.9 | 9.6e-50 | 193.7 | |
| Cla10g01938 | . | 118 | 381 | SNARE and Associated Proteins | AT3G09740 | 79.7 | 2.8e-113 | 405.2 | |
| Cla02g02052 | . | 1 | 265 | SNARE and Associated Proteins | AT3G09740 | 67.4 | 9.9e-95 | 343.6 | |
| Cla02g02052 | . | 1 | 265 | SNARE and Associated Proteins | AT3G45280 | 65.9 | 7.9e-92 | 334.0 | |
| Cla10g01938 | . | 118 | 381 | SNARE and Associated Proteins | AT3G45280 | 64.4 | 9.0e-88 | 320.5 | |
| Cla10g01938 | . | 118 | 378 | SNARE and Associated Proteins | AT3G61450 | 68.2 | 7.5e-95 | 344.0 | |
| Cla02g02052 | . | 1 | 262 | SNARE and Associated Proteins | AT3G61450 | 61.0 | 2.0e-84 | 309.3 | |
| Cla11g00615 | . | 65 | 272 | SNARE and Associated Proteins | AT1G51740 | 69.0 | 9.2e-71 | 263.8 |
Syn-Orthogroups
| Select | Orthogroup | Bda | Bhi | Blo | Bma | Bpe | Cam | Car | Cco | Cec | Chy | Cla | Clacu | Cma | Cme | Cmetu | Cmo | Cmu | Cone | Cpe | Cre | Csa | HCH | Hepe | Lac | Lcy | Lsi | Mch | Sed | Tan | Vvi | Total |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| OG0002038 | 1 | 2 | 1 | 1 | 1 | 2 | 3 | 2 | 2 | 2 | 2 | 2 | 3 | 3 | 2 | 3 | 2 | 2 | 3 | 2 | 3 | 2 | 2 | 2 | 2 | 2 | 3 | 2 | 2 | 2 | 63 |