Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cla10g02086 ATGAAGTCAAGATCTGACGAATTTCAGAAGTTTCACAGCAAGCAAATGTGTGGCACTGGCACATATCGGATGACGAAAGCATCATGGATACGCTTTCTTCATCCAATGGCCATAATTTTCCTACCCGATTTAATTCCCCAAACAGCAATCAAATTCCCCCTTCCAGCTCTATATTACACCTTCAGACTCCAATCCCTCACAACCACCTACTATCTCTCCGCTATGGCCGCCACCGCATCCTCCTTCATTGGAACTCGTCTTCCTATTGCCCCATCCGGGTCGGGTCGGGTACACGCCAGATTCTCATTCGGCAAACCAAAAAGCGCACCGAAGAAATCGTCAAAAAAGCCCACTTCGGACCGGCCGCTGTGGTACCCGGGGGCCGTGGCGCCGGAGTGGCTGGACGGAAGCTTGGTGGGGGATTACGGGTTCGACCCGTTTGGGCTGGGAAAACCGGCGGAGTACTTGCAGTTCGACTTGGACTCATTGGACCAGAACTTGGCTAAGAATGTGGCTGGTGATGTGATCGGTACTCGGTTCGAGAATGCGGATGTGAAATCGACGCCGTTCCAGCCGTACAGTGAGGTGTTTGGGTTGCAGAGGTTTCGCGAGTGTGAGCTGATCCATGGAAGGTGGGCTATGTTGGCTACACTCGGTGCCCTTACTGTTGAGTGGCTCACTGGTGTAGAGCTGGTGGAAGGATCCTCATATCTTGGGCAGCCACTTCCATTCTCCATATCAACATTGATATGGATAGAGGTTCTAGTAATTGGGTACATTGAGTTTCAAAGGAATGCTGAGCTTGATCCAGAGAAGAGACTTTACCCTGGGGGCAAGTACTTTGATCCCCTTGGCTTAGCGGCCGACCCCGAGAAGAAGGCGACGCTTCAATTGGCCGAGATTAAGCACGCTCGCCTCGCCATGGTCGCGTTCCTCGGTTTTGCTGTTCAAGCTGCTGCCACTGGCAAAGGCCCCCTCAATAACTGGGCAACCCATCTGATCTTCAATTGTTCCGACGCCGTTAAGGAAGAATTCCTCAGGCATTTGGCTCCTCACCGGAAGCTTGCGGTTCCTTTCCTGACCTTCTACTTCACACTTGATATGCATCCATTTGGGGTTACGGTTTCGGATCGTTATGCGAGTGTTGTTCCTATCCGAGGTGCTTCAATGTCTCCCACTTTTAATCCTAGAGCGACTTCTCTGGCAGGACCAGTAACTGGTGACTACGTGCTGGTTGAGAAATTTTGCCTTCAGAAGTATAAATTTTCTCCCGGTGACGTGATTGTTTACCGCTCCCCTTGTAATTACAAGGAGAACCATGTGAAAAGAATTATTGCCTTACCAGGAGATTGGGTTGGAACTCGTCAAACATATGATGTTGTCAAGGTTCCAGAAGGACATTGTTGGGTTGAAGGTGACAATGCAGAATGCAGCATGGACTCGAGATCTTTTGGCCCGGAATGGATTTTGATCTTTTCAGTTTTCACAACTATGGAAAATCTGCTGGATCAAAGTCTTCGATGCGGTCGCTCCTCATTTCCCGCTAGATTTTCATCTCGAAATCGCATCTCAAGCCTACGCTGGGTTCAACCACTAGTCGAGTTATCGAATTTTCGCGTTAGTTATTTGAGAAGTCGCCGAAGACCGCCGCCCGTCAATTTGCAAAACAGCCTTTTATCTCATGGGACAGACGGCAGGTTTGCATTCGCAAGAATTGCTGTTACCAACAATGTACGCCTCTTTTCTTATAATTCACTGAGGTCAGCAACTAGGAATTTTCATCCATCAACCAGAATAGGTGCTGGAGGTTATGGAGTTGTCTACAAAGGAGTTTTAAGGGATGGCACCAATGTTGCAGTCAAATCACTGTCTGCAGAATCAGCTCAGGGAACTCGTGAATTCTTAACCGAGATAAATATGATATCAAATATAAGACATCAACATCTCGTTGAACTGATTGGTTGTTGTGTAGAAGGCACACATCGAATTTTGGTGTATGAATACCTGGAAAACAACAGCCTTGCGAGTACTTTGCTTGGTACAATGAGTAAGCATGTCATTCTGGATTGGCCAAAGAGAGCTAAGATTTGTCTTGGTACAGCTTTGGGTCTTGCATACCTACATGAAGAAGCTGAATATTCTGTTGTTCATAGAGATATCAAGGCTAGCAATATACTTCTTGACAGAAACTTTGATCCTAAAATAGGAGACTTTGGGTTGGCTAAACTTTTCCCAGATAACGTTACTCATGTTAGCACTCGAGTGGCTGGAACTGTTGGATATTTGGCCCCCGAGTATGCACTTTTAGGACAGTTGACCAAGAAGGCAGATGTATACAGTTTTGGTGTGCTCATGCTGGAAATAGTTAGTGGAAGTAGCAGCAGTAAAACAGCATTTGGAGAAGAGTTGTCAATGCTCGTGGAATGGACTTGGAAACTAAGACAAGAAGGACGGCTTGTAGAACTAATCGATCCGGAACTGGTCGATTATCCGAAGGCTGAGGTGATGCGTTTCATCACAGTTGCACTCTTCTGTACCCAAGCAGCTGCAAATCAAAGGCCAACCATGAAGCAGGTTGTGGAAATGCTTTCAAGAGAGGTACACCTTAATGAAAAACTATTGACAGAGCCAGGAGTATACAAAGGACACAAAACTAGGAAGTTAAATGGTGCTGGTACAAGTTCTGAGGGGACTTCATTCTCCCATGGAGACAGAGGTAAAAAAGCTATGAAGTCTACTATATCTTCACCCCAATTTAATAGCTCAAACAGTCTGACTCAAATGCTTCCTAGGTGA 2796 46.6 MKSRSDEFQKFHSKQMCGTGTYRMTKASWIRFLHPMAIIFLPDLIPQTAIKFPLPALYYTFRLQSLTTTYYLSAMAATASSFIGTRLPIAPSGSGRVHARFSFGKPKSAPKKSSKKPTSDRPLWYPGAVAPEWLDGSLVGDYGFDPFGLGKPAEYLQFDLDSLDQNLAKNVAGDVIGTRFENADVKSTPFQPYSEVFGLQRFRECELIHGRWAMLATLGALTVEWLTGVELVEGSSYLGQPLPFSISTLIWIEVLVIGYIEFQRNAELDPEKRLYPGGKYFDPLGLAADPEKKATLQLAEIKHARLAMVAFLGFAVQAAATGKGPLNNWATHLIFNCSDAVKEEFLRHLAPHRKLAVPFLTFYFTLDMHPFGVTVSDRYASVVPIRGASMSPTFNPRATSLAGPVTGDYVLVEKFCLQKYKFSPGDVIVYRSPCNYKENHVKRIIALPGDWVGTRQTYDVVKVPEGHCWVEGDNAECSMDSRSFGPEWILIFSVFTTMENLLDQSLRCGRSSFPARFSSRNRISSLRWVQPLVELSNFRVSYLRSRRRPPPVNLQNSLLSHGTDGRFAFARIAVTNNVRLFSYNSLRSATRNFHPSTRIGAGGYGVVYKGVLRDGTNVAVKSLSAESAQGTREFLTEINMISNIRHQHLVELIGCCVEGTHRILVYEYLENNSLASTLLGTMSKHVILDWPKRAKICLGTALGLAYLHEEAEYSVVHRDIKASNILLDRNFDPKIGDFGLAKLFPDNVTHVSTRVAGTVGYLAPEYALLGQLTKKADVYSFGVLMLEIVSGSSSSKTAFGEELSMLVEWTWKLRQEGRLVELIDPELVDYPKAEVMRFITVALFCTQAAANQRPTMKQVVEMLSREVHLNEKLLTEPGVYKGHKTRKLNGAGTSSEGTSFSHGDRGKKAMKSTISSPQFNSSNSLTQMLPR 931
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
10 36548099 36568429 - ClCG10G022050.2 Cla10g02086 283745

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cla10g02086 931 SUPERFAMILY Chlorophyll a-b binding protein 117 333 - -
Cla10g02086 931 Pfam Chlorophyll A-B binding protein 130 318 IPR022796 -
Cla10g02086 931 CDD STKc_IRAK 599 865 - -
Cla10g02086 931 Gene3D Phosphorylase Kinase; domain 1 569 668 - -
Cla10g02086 931 PRINTS Bacterial leader peptidase 1 (S26A) family signature 440 452 IPR000223 GO:0006508|GO:0008236|GO:0016020
Cla10g02086 931 PRINTS Bacterial leader peptidase 1 (S26A) family signature 378 394 IPR000223 GO:0006508|GO:0008236|GO:0016020
Cla10g02086 931 PRINTS Bacterial leader peptidase 1 (S26A) family signature 463 482 IPR000223 GO:0006508|GO:0008236|GO:0016020
Cla10g02086 931 SMART serkin_6 593 863 IPR000719 GO:0004672|GO:0005524|GO:0006468
Cla10g02086 931 MobiDBLite consensus disorder prediction 911 931 - -
Cla10g02086 931 Pfam Signal peptidase, peptidase S26 380 455 IPR019533 GO:0004252|GO:0006465
Cla10g02086 931 SUPERFAMILY Protein kinase-like (PK-like) 575 863 IPR011009 -
Cla10g02086 931 Gene3D Umud Fragment, subunit A 378 510 - -
Cla10g02086 931 Gene3D Transferase(Phosphotransferase) domain 1 669 876 - -
Cla10g02086 931 SUPERFAMILY LexA/Signal peptidase 381 486 IPR036286 -
Cla10g02086 931 PANTHER LEUCINE-RICH REPEAT RECEPTOR-LIKE SERINE/THREONINE-PROTEIN KINASE-RELATED 574 926 - -
Cla10g02086 931 PANTHER PROMASTIGOTE SURFACE ANTIGEN PROTEIN PSA 574 926 - -
Cla10g02086 931 ProSiteProfiles Protein kinase domain profile. 593 869 IPR000719 GO:0004672|GO:0005524|GO:0006468
Cla10g02086 931 Gene3D Chlorophyll a/b binding protein domain 125 352 - -
Cla10g02086 931 CDD S26_SPase_I 381 486 IPR019533 GO:0004252|GO:0006465
Cla10g02086 931 ProSitePatterns Protein kinases ATP-binding region signature. 599 621 IPR017441 GO:0005524
Cla10g02086 931 ProSitePatterns Serine/Threonine protein kinases active-site signature. 715 727 IPR008271 GO:0004672|GO:0006468
Cla10g02086 931 MobiDBLite consensus disorder prediction 882 931 - -
Cla10g02086 931 MobiDBLite consensus disorder prediction 101 123 - -
Cla10g02086 931 Pfam Protein tyrosine and serine/threonine kinase 597 863 IPR001245 GO:0004672|GO:0006468
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cla10g02086 - - - cmo:103486304 661.373
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cla03g00554 Cla-Chr3:6185640 Cla10g02086 Cla-Chr10:36548099 3.50E-140 dispersed
Cla04g00716 Cla-Chr4:22100950 Cla10g02086 Cla-Chr10:36548099 2.62E-154 dispersed
Cla07g01015 Cla-Chr7:26565312 Cla10g02086 Cla-Chr10:36548099 1.55E-107 dispersed
Cla09g00620 Cla-Chr9:5800438 Cla10g02086 Cla-Chr10:36548099 8.32E-79 dispersed
Cla10g02086 Cla-Chr10:36548099 Cla11g01693 Cla-Chr11:30524384 6.45E-95 transposed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi8g888 . . . . . Bpe03g01006 . Bma10g00327 Cmo06g00225 . . . . . . . Cpe08g01221 . . . . . . . . . . . . . . Cone3ag0418 . Cone13ag1397 Cone19ag1386 . . . Cme04g02714 . . . Bda05g00932 . . . . Sed02g0226 . . Cma06g00231 . Car06g00205 . . . Bhi11g01850 Tan08g2121 Cmetu08g0539 . . . . Cla10g02086 . . . . . . Lsi03g02206 Csa03g03081 Chy04g02247 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cla03g00157 . 187 629 Chloroplast and Mitochondria Gene Families AT2G28800 59.0 4.8e-131 464.9
Cla08g01713 . 72 352 Chloroplast and Mitochondria Gene Families AT2G28800 54.5 5.2e-77 285.4
Cla08g00704 . 3 249 Chloroplast and Mitochondria Gene Families AT1G15820 81.9 5.2e-117 417.5
Cla02g00280 . 1 265 Chloroplast and Mitochondria Gene Families AT3G27690 88.7 1.1e-142 503.1
Cla02g01804 . 2 267 Chloroplast and Mitochondria Gene Families AT3G27690 78.4 6.9e-121 430.6
Cla01g02379 . 2 265 Chloroplast and Mitochondria Gene Families AT3G27690 77.4 3.4e-120 428.3
Cla01g02380 . 46 309 Chloroplast and Mitochondria Gene Families AT3G27690 76.7 2.9e-119 425.2
Cla10g01121 . 1 265 Chloroplast and Mitochondria Gene Families AT3G27690 78.0 6.5e-119 424.1
Cla10g00607 . 5 266 Chloroplast and Mitochondria Gene Families AT3G27690 66.9 1.2e-96 350.1
Cla11g01861 . 113 329 Chloroplast and Mitochondria Gene Families AT3G27690 51.2 1.1e-52 204.1
Cla08g00194 . 118 321 Chloroplast and Mitochondria Gene Families AT3G27690 53.8 6.8e-52 201.4
Cla11g01337 . 3 268 Chloroplast and Mitochondria Gene Families AT3G61470 80.9 1.3e-128 456.1
Cla03g01434 . 56 261 Chloroplast and Mitochondria Gene Families AT3G61470 65.5 2.8e-86 315.5
Cla06g01586 CCT,ECH 368 595 Chloroplast and Mitochondria Gene Families AT3G61470 50.8 8.7e-64 240.7
Cla09g02009 . 1 198 Chloroplast and Mitochondria Gene Families AT3G54890 81.6 5.9e-90 327.4
Cla04g00716 . 105 382 Chloroplast and Mitochondria Gene Families AT3G08940 82.1 7.6e-133 470.3
Cla10g02086 . 76 333 Chloroplast and Mitochondria Gene Families AT3G08940 81.3 1.1e-118 423.3
Cla11g01861 . 48 336 Chloroplast and Mitochondria Gene Families AT1G76570 79.2 4.6e-142 501.1
Cla03g01160 . 1 273 Chloroplast and Mitochondria Gene Families AT1G61520 86.8 8.2e-137 483.4
Cla02g00280 . 1 265 Chloroplast and Mitochondria Gene Families AT2G05070 89.4 3.0e-144 508.1
Cla01g02379 . 5 265 Chloroplast and Mitochondria Gene Families AT2G05070 79.3 1.0e-120 429.9
Cla01g02380 . 49 309 Chloroplast and Mitochondria Gene Families AT2G05070 78.6 5.2e-120 427.6
Cla02g01804 . 7 267 Chloroplast and Mitochondria Gene Families AT2G05070 78.9 6.8e-120 427.2
Cla10g01121 . 27 265 Chloroplast and Mitochondria Gene Families AT2G05070 84.5 1.7e-118 422.5
Cla10g00607 . 7 266 Chloroplast and Mitochondria Gene Families AT2G05070 68.0 3.6e-97 351.7
Cla03g00652 . 27 256 Chloroplast and Mitochondria Gene Families AT2G05070 50.4 2.1e-52 203.0
Cla08g00194 . 118 321 Chloroplast and Mitochondria Gene Families AT2G05070 54.3 4.6e-52 201.8
Cla11g01861 . 113 329 Chloroplast and Mitochondria Gene Families AT2G05070 50.2 3.0e-51 199.1
Cla02g00280 . 1 237 Chloroplast and Mitochondria Gene Families AT2G05100 89.5 1.7e-125 446.0
Cla01g02379 . 5 237 Chloroplast and Mitochondria Gene Families AT2G05100 76.9 5.8e-102 367.9
Cla01g02380 . 49 281 Chloroplast and Mitochondria Gene Families AT2G05100 76.4 1.7e-101 366.3
Cla02g01804 . 7 239 Chloroplast and Mitochondria Gene Families AT2G05100 76.9 5.0e-101 364.8
Cla10g01121 . 27 237 Chloroplast and Mitochondria Gene Families AT2G05100 83.4 1.9e-100 362.8
Cla10g00607 . 7 238 Chloroplast and Mitochondria Gene Families AT2G05100 67.6 5.1e-82 301.6
Cla08g00194 . 118 305 Chloroplast and Mitochondria Gene Families AT2G05100 53.1 1.6e-43 173.7
Cla04g00716 . 105 264 Chloroplast and Mitochondria Gene Families AT2G40100 72.0 9.7e-65 243.4
Cla10g02086 . 76 229 Chloroplast and Mitochondria Gene Families AT2G40100 66.7 2.4e-55 212.2
Cla02g01804 . 1 267 Chloroplast and Mitochondria Gene Families AT1G29930 88.4 1.8e-136 482.3
Cla01g02379 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29930 88.8 4.0e-136 481.1
Cla01g02380 . 45 309 Chloroplast and Mitochondria Gene Families AT1G29930 88.4 6.8e-136 480.3
Cla10g01121 . 4 265 Chloroplast and Mitochondria Gene Families AT1G29930 84.9 1.7e-126 449.1
Cla02g00280 . 3 265 Chloroplast and Mitochondria Gene Families AT1G29930 78.3 3.5e-116 414.8
Cla10g00607 . 1 266 Chloroplast and Mitochondria Gene Families AT1G29930 65.2 1.0e-94 343.6
Cla03g00652 . 1 256 Chloroplast and Mitochondria Gene Families AT1G29930 57.1 1.2e-68 256.9
Cla02g01804 . 1 267 Chloroplast and Mitochondria Gene Families AT1G29920 88.1 6.8e-136 480.3
Cla01g02379 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29920 88.4 1.5e-135 479.2
Cla01g02380 . 45 309 Chloroplast and Mitochondria Gene Families AT1G29920 88.0 2.6e-135 478.4
Cla10g01121 . 4 265 Chloroplast and Mitochondria Gene Families AT1G29920 84.9 2.2e-126 448.7
Cla02g00280 . 3 265 Chloroplast and Mitochondria Gene Families AT1G29920 77.9 2.1e-116 415.6
Cla10g00607 . 1 266 Chloroplast and Mitochondria Gene Families AT1G29920 65.2 1.7e-94 342.8
Cla03g00652 . 1 256 Chloroplast and Mitochondria Gene Families AT1G29920 56.8 4.7e-68 255.0
Cla08g00194 . 101 321 Chloroplast and Mitochondria Gene Families AT1G29920 50.7 7.2e-53 204.5
Cla02g01804 . 1 267 Chloroplast and Mitochondria Gene Families AT1G29910 88.1 6.8e-136 480.3
Cla01g02379 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29910 88.4 1.5e-135 479.2
Cla01g02380 . 45 309 Chloroplast and Mitochondria Gene Families AT1G29910 88.0 2.6e-135 478.4
Cla10g01121 . 4 265 Chloroplast and Mitochondria Gene Families AT1G29910 84.9 2.2e-126 448.7
Cla02g00280 . 3 265 Chloroplast and Mitochondria Gene Families AT1G29910 77.9 2.1e-116 415.6
Cla10g00607 . 1 266 Chloroplast and Mitochondria Gene Families AT1G29910 65.2 1.7e-94 342.8
Cla03g00652 . 1 256 Chloroplast and Mitochondria Gene Families AT1G29910 56.8 4.7e-68 255.0
Cla08g00194 . 101 321 Chloroplast and Mitochondria Gene Families AT1G29910 50.7 7.2e-53 204.5
Cla08g00194 . 56 336 Chloroplast and Mitochondria Gene Families AT4G10340 84.7 5.3e-139 490.7
Cla01g02380 . 81 297 Chloroplast and Mitochondria Gene Families AT4G10340 52.9 3.9e-57 218.8
Cla01g02379 . 37 253 Chloroplast and Mitochondria Gene Families AT4G10340 52.5 6.6e-57 218.0
Cla10g01121 . 49 253 Chloroplast and Mitochondria Gene Families AT4G10340 54.1 8.6e-57 217.6
Cla02g01804 . 51 255 Chloroplast and Mitochondria Gene Families AT4G10340 54.1 1.1e-56 217.2
Cla02g00280 . 49 253 Chloroplast and Mitochondria Gene Families AT4G10340 52.6 3.1e-54 209.1
Cla10g00607 . 48 254 Chloroplast and Mitochondria Gene Families AT4G10340 54.0 3.8e-52 202.2
Cla02g01804 . 1 267 Chloroplast and Mitochondria Gene Families AT2G34420 88.4 1.2e-135 479.6
Cla01g02379 . 1 265 Chloroplast and Mitochondria Gene Families AT2G34420 88.0 1.7e-134 475.7
Cla01g02380 . 45 309 Chloroplast and Mitochondria Gene Families AT2G34420 87.6 2.8e-134 474.9
Cla10g01121 . 4 265 Chloroplast and Mitochondria Gene Families AT2G34420 85.7 3.4e-127 451.4
Cla02g00280 . 3 265 Chloroplast and Mitochondria Gene Families AT2G34420 77.2 7.0e-117 417.2
Cla10g00607 . 24 266 Chloroplast and Mitochondria Gene Families AT2G34420 70.1 8.4e-94 340.5
Cla03g00652 . 1 256 Chloroplast and Mitochondria Gene Families AT2G34420 56.8 5.1e-67 251.5
Cla01g02380 . 45 309 Chloroplast and Mitochondria Gene Families AT2G34430 88.3 8.0e-137 483.4
Cla01g02379 . 1 265 Chloroplast and Mitochondria Gene Families AT2G34430 88.3 3.0e-136 481.5
Cla02g01804 . 1 267 Chloroplast and Mitochondria Gene Families AT2G34430 88.1 2.0e-135 478.8
Cla10g01121 . 4 265 Chloroplast and Mitochondria Gene Families AT2G34430 85.6 4.7e-129 457.6
Cla02g00280 . 31 265 Chloroplast and Mitochondria Gene Families AT2G34430 83.2 1.9e-114 409.1
Cla10g00607 . 36 266 Chloroplast and Mitochondria Gene Families AT2G34430 70.5 8.4e-94 340.5
Cla03g00652 . 1 256 Chloroplast and Mitochondria Gene Families AT2G34430 55.9 2.3e-67 252.7
Cla04g00716 . 105 382 Chloroplast and Mitochondria Gene Families AT5G01530 83.5 6.7e-137 483.8
Cla10g02086 . 73 333 Chloroplast and Mitochondria Gene Families AT5G01530 84.1 2.4e-126 448.7
Cla10g00746 . 269 528 Chloroplast and Mitochondria Gene Families AT5G40810 93.5 2.5e-143 505.0
Cla10g00746 . 233 528 Chloroplast and Mitochondria Gene Families AT3G27240 83.5 6.8e-148 520.4
Cla02g01883 . 5 327 Chloroplast and Mitochondria Gene Families AT2G30160 75.3 7.1e-143 503.8
Cla04g00684 . 100 402 Chloroplast and Mitochondria Gene Families AT2G30160 64.2 9.4e-111 397.1
Cla02g01883 . 5 323 Chloroplast and Mitochondria Gene Families AT1G07030 76.4 3.2e-143 505.0
Cla04g00684 . 96 402 Chloroplast and Mitochondria Gene Families AT1G07030 67.5 1.7e-117 419.5
Cla09g00508 . 1 380 Chloroplast and Mitochondria Gene Families AT2G47490 55.5 1.6e-107 386.3
Cla01g00571 . 9 374 Chloroplast and Mitochondria Gene Families AT2G47490 52.6 4.6e-99 358.2
Cla01g00571 . 10 426 Chloroplast and Mitochondria Gene Families AT1G25380 54.1 9.3e-112 400.6
Cla09g00508 . 73 349 Chloroplast and Mitochondria Gene Families AT1G25380 57.0 8.8e-86 314.3
Cla03g00519 . 597 1172 Chloroplast and Mitochondria Gene Families AT4G21490 75.6 7.3e-260 893.3
Cla02g01697 . 434 1056 Chloroplast and Mitochondria Gene Families AT4G21490 66.2 6.6e-237 817.0
Cla02g00132 . 23 596 Chloroplast and Mitochondria Gene Families AT4G21490 64.7 1.2e-225 779.6
Cla09g00073 . 847 1035 Chloroplast and Mitochondria Gene Families AT1G17530 62.5 2.6e-62 235.3
Cla06g00914 . 4 179 Chloroplast and Mitochondria Gene Families AT1G17530 57.3 1.3e-50 196.4
Cla06g00914 . 12 183 Chloroplast and Mitochondria Gene Families AT3G04800 57.8 1.8e-50 196.1
Cla09g00073 . 871 1035 Chloroplast and Mitochondria Gene Families AT3G04800 53.9 1.5e-41 166.4
Cla09g00073 . 864 1035 Chloroplast and Mitochondria Gene Families AT1G72750 68.4 4.6e-62 234.6
Cla06g00914 . 5 183 Chloroplast and Mitochondria Gene Families AT1G72750 57.1 2.5e-52 202.2
Cla05g02337 CCT 663 837 Chloroplast and Mitochondria Gene Families AT1G26100 69.7 1.6e-67 253.1
Cla11g00506 . 1 278 Chloroplast and Mitochondria Gene Families AT5G38630 57.7 4.4e-83 304.7
Cla09g01236 . 144 351 Chloroplast and Mitochondria Gene Families AT4G25570 69.5 4.9e-84 308.1
Cla01g00658 . 2 225 Chloroplast and Mitochondria Gene Families AT1G14730 50.4 2.7e-61 232.3
Cla01g00764 . 9 356 Chloroplast and Mitochondria Gene Families AT5G14040 82.3 2.3e-169 592.0
Cla05g01339 . 10 395 Chloroplast and Mitochondria Gene Families AT5G14040 69.8 5.0e-153 537.7
Cla06g01777 . 39 329 Chloroplast and Mitochondria Gene Families AT5G14040 86.6 4.4e-149 524.6
Cla02g00337 . 11 297 Chloroplast and Mitochondria Gene Families AT5G14040 52.1 1.2e-82 303.9
Cla01g00764 . 8 356 Chloroplast and Mitochondria Gene Families AT3G48850 72.0 7.6e-146 513.8
Cla05g01339 . 11 401 Chloroplast and Mitochondria Gene Families AT3G48850 65.1 1.8e-139 492.7
Cla06g01777 . 10 329 Chloroplast and Mitochondria Gene Families AT3G48850 67.6 2.3e-134 475.7
Cla02g00337 . 11 297 Chloroplast and Mitochondria Gene Families AT3G48850 50.5 3.7e-84 308.9
Cla02g00337 . 14 308 Chloroplast and Mitochondria Gene Families AT2G17270 76.9 1.1e-132 469.9
Cla01g00764 . 62 352 Chloroplast and Mitochondria Gene Families AT2G17270 52.6 4.8e-85 311.6
Cla06g01777 . 44 328 Chloroplast and Mitochondria Gene Families AT2G17270 50.2 5.5e-81 298.1
Cla11g00459 . 16 343 Chloroplast and Mitochondria Gene Families AT5G15640 68.6 4.7e-120 427.9
Cla05g00729 . 47 341 Chloroplast and Mitochondria Gene Families AT5G15640 50.2 5.9e-78 288.1
Cla05g01857 . 12 345 Chloroplast and Mitochondria Gene Families AT5G26200 66.8 1.2e-124 443.4
Cla09g00079 . 1 344 Chloroplast and Mitochondria Gene Families AT5G26200 57.8 1.8e-104 376.3
Cla09g00079 . 1 348 Chloroplast and Mitochondria Gene Families AT1G72820 75.8 2.3e-147 518.8
Cla05g01857 . 1 346 Chloroplast and Mitochondria Gene Families AT1G72820 68.8 5.1e-131 464.5
Cla01g00235 CCT,ECH 82 285 Chloroplast and Mitochondria Gene Families AT5G52570 52.5 2.3e-50 196.1
Cla05g00912 CCT,ECH 1 219 Chloroplast and Mitochondria Gene Families AT4G25700 63.2 1.2e-69 260.0
Cla01g00235 CCT,ECH 31 204 Chloroplast and Mitochondria Gene Families AT4G25700 62.2 1.5e-56 216.5
Cla02g00146 . 177 355 Chloroplast and Mitochondria Gene Families AT4G03320 52.2 8.8e-57 217.6
Cla10g00609 . 72 359 Chloroplast and Mitochondria Gene Families AT5G54290 79.0 9.1e-120 427.2
Cla06g01286 . 43 546 Chloroplast and Mitochondria Gene Families AT2G18710 83.9 4.7e-240 827.4
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0001438 1 2 3 3 1 0 1 1 1 2 2 1 2 2 1 2 1 0 2 1 2 1 2 0 1 2 2 0 1 2 42
       

Regulatory proteins

Select Gene Hmm_acc Hmm_name Score E-value Regulatory Factors Family
80895 PF07714 PK_Tyr_Ser-Thr 1.20E-45 CL0016 Cla PK