Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cla11g00615 ATGGCGAAGTTCAGGGATAGGACTGAAGATTTTAAAGATGTTGTGCGGCACTGTGCTATTTCGTTAGGGTACAATGAGTCCAAGTTGGCGGTTATTATGGCATCTTTCATCATTCAGAAACCGCGGCAAAGGTCACCTTTCATCAAAGCTGCCCTGAAAACGCTTGAAAGCATTGGTGCTCTTGAAGAGTTTATGTTGAAACATCAAAAGGACTATGTAGATATGTATCGCACGACAGATCAAGAGAGAGACAATATTGAACACGAGGTAACTGCCTTCATCAAAGCATGCCAAGAACAACTTGATATCCTAAAAAACAGCATTAACGCGGATGATGCACACTCAAAGGGATGGCGTGGTCGTAGCACTGATGATTCTAATGCTGATACTATTGCACACAAACATGGGGTGGTTCTAATTTTGAGTGAGAAACTCCATTCGGTAACATCACAATTTGATAAGCTAAGAGCCATTCGGTTTCAAGATATCATAAGCAAAGCAGTACCAAGAAGAAAACTGAACCAAGTAAATAAACCACGTTCTGCCAATGCCCCTGAGTATAGTAATACAGAGCTGAGGGAACCTGATGATAATTTTGAGCATCAACCTGTCCGAGCCCAACAACTGTTGGATGATGAAACTCGTGCACTTCAGGTTGAGTTGACTAGTCTTCTTGACACAGTCCAAGAAACAGAAACTAAGATGGTAGAGATGTCTGCTCTAAATCACCTTATGTCTACACACGTTTTGCAGCAAGCACAACAAATTGAACATCTTTATGAACAGGCTGTTGAAGCTACGAAGAATGTCGAGCTTGTTGATGGGACTGATTGTTGTATCACATTTATGTTATACATTCATATAGAAGCAAGAAAAAGAAGAAATCACCGATGGAATTTAGACCACATTTTTGTTACTGCAAGTATTTTCTTTCATATCCAGACTCAAATAGTTACAATGAGTGAACCATCTGCCACTTCAATTTCTCGAAGTTCCCTGCATTTTAGTTGCTGGAGCATGAGGTTTTCCTGA 1032 40.41 MAKFRDRTEDFKDVVRHCAISLGYNESKLAVIMASFIIQKPRQRSPFIKAALKTLESIGALEEFMLKHQKDYVDMYRTTDQERDNIEHEVTAFIKACQEQLDILKNSINADDAHSKGWRGRSTDDSNADTIAHKHGVVLILSEKLHSVTSQFDKLRAIRFQDIISKAVPRRKLNQVNKPRSANAPEYSNTELREPDDNFEHQPVRAQQLLDDETRALQVELTSLLDTVQETETKMVEMSALNHLMSTHVLQQAQQIEHLYEQAVEATKNVELVDGTDCCITFMLYIHIEARKRRNHRWNLDHIFVTASIFFHIQTQIVTMSEPSATSISRSSLHFSCWSMRFS 343
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
11 7029767 7033094 - ClCG11G006420.2 Cla11g00615 284437

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cla11g00615 343 Pfam SNARE-complex protein Syntaxin-18 N-terminus 6 86 IPR019529 -
Cla11g00615 343 SUPERFAMILY t-snare proteins 61 271 IPR010989 GO:0016020|GO:0016192
Cla11g00615 343 Gene3D - 48 271 - -
Cla11g00615 343 PANTHER SYNTAXIN-18 5 271 - -
Cla11g00615 343 MobiDBLite consensus disorder prediction 174 198 - -
Cla11g00615 343 PANTHER SYNTAXIN-18 5 271 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cla11g00615 K08492 STX18; syntaxin 18 - csv:101207161 511.146
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi13g422 . . . . . . . . . . . . . . Sed03g0404 Cpe13g01079 . Bhi04g02346 Tan11g0243 Cmetu03g1342 . Hepe02g3337 . Lcy10g2218 . . . . . . . . . . Cone18ag0421 Lsi03g00333 Csa06g00159 . . . . . . . . . . . Cmo04g03046 Cmo15g00129 Cma04g02924 Cma15g00119 Car04g02811 Car15g00129 . Cpe01g02531 . . . . . . . Cla11g00615 Cam11g0668 Cec11g0667 Cco11g0653 Clacu11g0790 Cmu11g0646 Cre11g1122 . . Chy03g00164 Cme03g00216
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cla08g01285 . 8 338 SNARE and Associated Proteins AT3G24350 64.8 6.7e-102 367.9
Cla04g00533 . 1 309 SNARE and Associated Proteins AT1G08560 69.6 3.7e-101 365.2
Cla01g01917 . 411 714 SNARE and Associated Proteins AT2G18260 54.7 1.9e-86 316.2
Cla10g01736 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.5e-115 411.8
Cla01g01480 . 26 282 SNARE and Associated Proteins AT3G11820 72.8 9.0e-103 370.5
Cla03g00522 . 31 281 SNARE and Associated Proteins AT3G11820 66.5 1.1e-92 337.0
Cla10g01288 . 573 827 SNARE and Associated Proteins AT3G11820 52.5 5.0e-69 258.5
Cla10g01736 . 1 279 SNARE and Associated Proteins AT3G52400 63.9 5.9e-92 334.7
Cla01g01480 . 33 282 SNARE and Associated Proteins AT3G52400 64.8 2.4e-85 312.8
Cla03g00522 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 3.6e-81 298.9
Cla10g01288 . 575 827 SNARE and Associated Proteins AT3G52400 50.6 5.4e-61 231.9
Cla03g00522 . 1 299 SNARE and Associated Proteins AT4G03330 69.2 3.1e-108 388.7
Cla10g01736 . 1 284 SNARE and Associated Proteins AT4G03330 57.2 3.1e-84 308.9
Cla01g01480 . 1 297 SNARE and Associated Proteins AT4G03330 52.6 3.9e-79 292.0
Cla10g01288 . 564 827 SNARE and Associated Proteins AT4G03330 53.8 1.2e-67 253.8
Cla03g00522 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 1.0e-127 453.4
Cla10g01736 . 1 284 SNARE and Associated Proteins AT1G61290 62.0 2.6e-91 332.4
Cla01g01480 . 1 297 SNARE and Associated Proteins AT1G61290 56.6 1.6e-85 313.2
Cla10g01288 . 579 827 SNARE and Associated Proteins AT1G61290 50.6 1.9e-62 236.5
Cla03g00522 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 1.8e-124 442.6
Cla10g01736 . 1 284 SNARE and Associated Proteins AT1G11250 62.0 1.6e-93 339.7
Cla01g01480 . 1 292 SNARE and Associated Proteins AT1G11250 57.2 1.1e-86 317.0
Cla10g01288 . 563 827 SNARE and Associated Proteins AT1G11250 50.6 4.9e-66 248.4
Cla10g01288 . 548 846 SNARE and Associated Proteins AT3G03800 73.6 6.0e-112 401.0
Cla10g01288 . 548 745 SNARE and Associated Proteins AT5G08080 78.4 2.4e-78 288.9
Cla10g00138 . 48 319 SNARE and Associated Proteins AT5G16830 56.5 5.0e-73 271.6
Cla10g00138 . 48 319 SNARE and Associated Proteins AT5G46860 62.1 4.2e-77 285.0
Cla10g00138 . 48 237 SNARE and Associated Proteins AT4G17730 76.4 1.8e-72 269.6
Cla10g00138 . 112 319 SNARE and Associated Proteins AT1G32270 54.8 4.3e-50 195.7
Cla07g00385 . 1 336 SNARE and Associated Proteins AT5G05760 65.9 3.3e-111 398.7
Cla08g01285 . 8 338 SNARE and Associated Proteins AT3G24350 64.8 6.7e-102 367.9
Cla02g01497 . 1 327 SNARE and Associated Proteins AT5G26980 76.8 4.8e-128 454.5
Cla09g00505 . 1 356 SNARE and Associated Proteins AT5G26980 59.2 1.3e-96 350.1
Cla02g01497 . 1 329 SNARE and Associated Proteins AT4G02195 64.4 3.4e-105 378.6
Cla09g00505 . 1 356 SNARE and Associated Proteins AT4G02195 59.7 5.6e-100 361.3
Cla02g01497 . 1 328 SNARE and Associated Proteins AT3G05710 76.3 4.1e-130 461.5
Cla09g00505 . 1 356 SNARE and Associated Proteins AT3G05710 57.1 5.2e-93 338.2
Cla09g01036 . 86 310 SNARE and Associated Proteins AT1G16240 69.5 5.8e-83 304.3
Cla10g00459 . 19 243 SNARE and Associated Proteins AT1G16240 65.7 3.7e-77 285.0
Cla09g01036 . 85 310 SNARE and Associated Proteins AT1G79590 68.8 1.9e-82 302.8
Cla10g00459 . 19 243 SNARE and Associated Proteins AT1G79590 66.1 9.9e-79 290.4
Cla06g00045 . 170 315 SNARE and Associated Proteins AT1G28490 69.9 9.6e-50 193.7
Cla10g01938 . 118 381 SNARE and Associated Proteins AT3G09740 79.7 2.8e-113 405.2
Cla02g02052 . 1 265 SNARE and Associated Proteins AT3G09740 67.4 9.9e-95 343.6
Cla02g02052 . 1 265 SNARE and Associated Proteins AT3G45280 65.9 7.9e-92 334.0
Cla10g01938 . 118 381 SNARE and Associated Proteins AT3G45280 64.4 9.0e-88 320.5
Cla10g01938 . 118 378 SNARE and Associated Proteins AT3G61450 68.2 7.5e-95 344.0
Cla02g02052 . 1 262 SNARE and Associated Proteins AT3G61450 61.0 2.0e-84 309.3
Cla11g00615 . 65 272 SNARE and Associated Proteins AT1G51740 69.0 9.2e-71 263.8
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0011407 0 1 0 1 0 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 2 1 1 1 30
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Cla11g00615 Cla_Chr11 FPKM 10.04857 9.827552 8.139751 6.482596 5.435233 5.625239 5.892928 7.497338 7.348369 9.509022