Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Clacu06g0052 ATGTCTAATGTTGAGGGGGTACATGGGTGGGCTAAGCCGAGGTCGTTGCGCGCTCCCGCATCGGTCCCAACATCCATCGGTACGCCCCGTTGCCCTCTCCCTTCACTCCCAACCAGCATTCACCTCTTTCTTCCTCAGATCTACACTCTCCATCGCCCTCACTCTCAGGTTTTCTTCTCCTCTTTCTCCTACATCACTTACAGAATGATTTATTCTGTATTCACGGACATTCGGAACGCCGATTCTCGTTTAGTATCTCGTTCTTGTCCGTCTTTGTTTTGCATTAATCGATTAGCTCCAATTCTAGATCTGGCTTTTCAAGCATTGCAGTTGAAGATGCCATCGGCTCAAGATCCGTTCTATGTTGTAAAAGACGAGATTCAAGAATCTATTGATAAACTGCAATCCAGCTTTCACCAATGGGAAAGGATATCTTCTGATTCAGGAGAGAGAATACAACAAACAAAAGAGTTGCTTGCTTCTTGTGAAAGCATTGAATGGCAGGTGGACGAGTTGGACAAAGCTATTGCTGTGGCAGCTAGAGATCCATCTTGGTATGGCATTGATGATGCAGAACTTGAAAAACGAAGGAGATGGACGAGTACTGCTAGAACACAGGTTGGAAATGTTAAGAAAGTAGTAGGAGCTGGGAAGGAGCAAACGGGAACTGCTAGTGCAAGTGGGATGCGTCGAGAATTGATGAGACTACCTAATGCACATGAAACAGACAGATCAAACTTATATACAGCCAACCAAGCAAATGATGACTTCATCACATCCGAATCAGATAGACAGCTGCTTCTAATAAAGCAGCAGGACGAGGAGTTGGATGAGTTGAGTGCAAGCGTGGAGAGAATTGGAGGTGTTGGGCTTACAATACATGAAGAGCTCCTTGCACAGGATAAAATTATCGACGACCTAGGAATGGAAATGGACAGTACATCAAATCGTCTTGATTTTGTTCAGAAAAAAGTAGCAGTGGTCATGAAGAAGGCCAGCGCCAAGGGGCAGATAATGATGATATTGTTCTTGGTGGCTCTGTTCATCATCCTTTTTGTGTTGGTGTTCCTCACCTAG 1077 44.85 MSNVEGVHGWAKPRSLRAPASVPTSIGTPRCPLPSLPTSIHLFLPQIYTLHRPHSQVFFSSFSYITYRMIYSVFTDIRNADSRLVSRSCPSLFCINRLAPILDLAFQALQLKMPSAQDPFYVVKDEIQESIDKLQSSFHQWERISSDSGERIQQTKELLASCESIEWQVDELDKAIAVAARDPSWYGIDDAELEKRRRWTSTARTQVGNVKKVVGAGKEQTGTASASGMRRELMRLPNAHETDRSNLYTANQANDDFITSESDRQLLLIKQQDEELDELSASVERIGGVGLTIHEELLAQDKIIDDLGMEMDSTSNRLDFVQKKVAVVMKKASAKGQIMMILFLVALFIILFVLVFLT 358
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
6 691193 695495 - ClG42_06g0005200.10 Clacu06g0052 250700

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Clacu06g0052 358 SUPERFAMILY DNA repair protein MutS, domain III 35 153 IPR036187 -
Clacu06g0052 358 CDD SNARE_NTD_AtSYP61-like 117 214 - -
Clacu06g0052 358 SMART tSNARE_6 261 328 IPR000727 -
Clacu06g0052 358 FunFam Syntaxin 10 115 217 - -
Clacu06g0052 358 CDD SNARE_Qc 269 326 - -
Clacu06g0052 358 Gene3D - 273 337 - -
Clacu06g0052 358 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 266 328 IPR000727 -
Clacu06g0052 358 FunFam syntaxin-61 isoform X1 269 330 - -
Clacu06g0052 358 SUPERFAMILY SNARE fusion complex 265 328 - -
Clacu06g0052 358 Gene3D - 114 216 - -
Clacu06g0052 358 Pfam SNARE domain 303 354 IPR000727 -
Clacu06g0052 358 Pfam Syntaxin 6, N-terminal 118 211 IPR015260 GO:0016020(InterPro)|GO:0048193(InterPro)
Clacu06g0052 358 ProSitePatterns Syntaxin / epimorphin family signature. 272 311 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Clacu06g0052 358 PANTHER SYNTAXIN 120 345 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Clacu06g0052 358 SUPERFAMILY t-snare proteins 117 212 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Clacu06g0052 K08500 - - csv:101212527 420.624
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Clacu06g0052 Clacu-Chr6:691193 Clacu10g0465 Clacu-Chr10:5680693 6.40E-06 dispersed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Clacu08g1440 . 8 382 SNARE and Associated Proteins AT3G24350 53.1 2.0e-84 309.7
Clacu04g0566 . 1 309 SNARE and Associated Proteins AT1G08560 69.6 3.5e-101 365.2
Clacu01g2023 . 516 817 SNARE and Associated Proteins AT2G18260 54.4 9.2e-86 313.9
Clacu10g1804 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.3e-115 411.8
Clacu01g1572 . 26 282 SNARE and Associated Proteins AT3G11820 72.8 8.5e-103 370.5
Clacu03g0558 . 31 281 SNARE and Associated Proteins AT3G11820 66.5 1.0e-92 337.0
Clacu10g1344 . 30 284 SNARE and Associated Proteins AT3G11820 52.5 4.7e-69 258.5
Clacu10g1804 . 1 279 SNARE and Associated Proteins AT3G52400 63.9 5.6e-92 334.7
Clacu01g1572 . 33 282 SNARE and Associated Proteins AT3G52400 64.8 2.3e-85 312.8
Clacu03g0558 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 3.4e-81 298.9
Clacu03g0558 . 1 299 SNARE and Associated Proteins AT4G03330 69.2 2.9e-108 388.7
Clacu10g1804 . 1 279 SNARE and Associated Proteins AT4G03330 58.2 1.5e-83 306.6
Clacu01g1572 . 1 297 SNARE and Associated Proteins AT4G03330 52.6 3.7e-79 292.0
Clacu10g1344 . 1 284 SNARE and Associated Proteins AT4G03330 52.1 7.8e-69 257.7
Clacu03g0558 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 9.6e-128 453.4
Clacu10g1804 . 1 279 SNARE and Associated Proteins AT1G61290 63.1 4.2e-91 331.6
Clacu01g1572 . 1 297 SNARE and Associated Proteins AT1G61290 56.6 1.6e-85 313.2
Clacu03g0558 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 1.7e-124 442.6
Clacu10g1804 . 1 279 SNARE and Associated Proteins AT1G11250 62.7 3.4e-93 338.6
Clacu01g1572 . 1 292 SNARE and Associated Proteins AT1G11250 57.2 1.1e-86 317.0
Clacu10g1344 . 1 303 SNARE and Associated Proteins AT3G03800 73.9 4.7e-114 407.9
Clacu02g0875 . 41 327 SNARE and Associated Proteins AT3G03800 55.6 2.0e-80 296.2
Clacu10g1344 . 1 202 SNARE and Associated Proteins AT5G08080 78.8 1.4e-80 296.2
Clacu02g0875 . 27 227 SNARE and Associated Proteins AT5G08080 58.7 1.3e-52 203.4
Clacu10g0141 . 1 253 SNARE and Associated Proteins AT5G16830 59.5 1.9e-74 276.2
Clacu10g0141 . 1 253 SNARE and Associated Proteins AT5G46860 66.0 9.6e-79 290.4
Clacu10g0141 . 1 242 SNARE and Associated Proteins AT4G17730 63.2 4.5e-73 271.6
Clacu10g0141 . 65 253 SNARE and Associated Proteins AT1G32270 59.8 1.1e-50 197.6
Clacu07g0410 . 1 336 SNARE and Associated Proteins AT5G05760 65.9 3.1e-111 398.7
Clacu08g1440 . 8 382 SNARE and Associated Proteins AT3G24350 53.1 2.0e-84 309.7
Clacu02g1560 . 32 358 SNARE and Associated Proteins AT5G26980 76.8 4.6e-128 454.5
Clacu09g0546 . 1 318 SNARE and Associated Proteins AT5G26980 66.2 2.5e-102 369.0
Clacu09g0546 . 1 318 SNARE and Associated Proteins AT4G02195 66.8 1.1e-105 380.2
Clacu02g1560 . 32 360 SNARE and Associated Proteins AT4G02195 64.4 3.2e-105 378.6
Clacu02g1560 . 32 359 SNARE and Associated Proteins AT3G05710 76.3 3.9e-130 461.5
Clacu09g0546 . 1 318 SNARE and Associated Proteins AT3G05710 63.7 1.0e-98 357.1
Clacu09g1107 . 84 316 SNARE and Associated Proteins AT1G16240 72.1 2.3e-89 325.5
Clacu10g0465 . 905 1137 SNARE and Associated Proteins AT1G16240 67.8 3.2e-83 305.1
Clacu09g1107 . 83 316 SNARE and Associated Proteins AT1G79590 71.4 3.8e-88 321.6
Clacu10g0465 . 900 1137 SNARE and Associated Proteins AT1G79590 67.2 1.5e-84 309.7
Clacu06g0052 . 168 358 SNARE and Associated Proteins AT1G28490 71.7 8.2e-67 250.4
Clacu10g2011 . 1 264 SNARE and Associated Proteins AT3G09740 79.7 2.6e-113 405.2
Clacu02g2162 . 1 265 SNARE and Associated Proteins AT3G09740 67.4 9.4e-95 343.6
Clacu02g2162 . 1 265 SNARE and Associated Proteins AT3G45280 65.9 7.5e-92 334.0
Clacu10g2011 . 1 264 SNARE and Associated Proteins AT3G45280 64.4 8.6e-88 320.5
Clacu10g2011 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 7.1e-95 344.0
Clacu02g2162 . 1 262 SNARE and Associated Proteins AT3G61450 61.0 1.9e-84 309.3
Clacu11g0790 . 65 290 SNARE and Associated Proteins AT1G51740 69.3 1.1e-78 290.0
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003549 2 1 2 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 5 4 0 44