Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Clacu08g1440 ATGGCTGTCAAAACAGCTCAATCATTTAGAGATCGGACGCTGGAATTCCAGAATATAACAGAGAGGCTAAAGAAGTCTTTCTCATCTGGCACGGGACCAACTGGACCAAGTGCTGTTTCAAAATCAGAAGAGCAGCGCTCTTCTGTGGCTCTACAGTCTGAATTCAATAAGAGGGCTTCCAAGATTGGGTTAGGGATACACCAGACATCTCAGAAACTCTCAAAGTTGGCAAAATTGGCAAAGAGGACTTCAGTTTTTGATGACCCAACAATGGAAATCCAGGAGCTAACTGCTCTTATTAAGCAGGACATTACAACATTGAACTCTGCCGTTGTAGATCTTCAGCTTCTCTGCAACTCTAGAAATGAAAATGGAAACATATCCAGTGATACTTCTAGTCATTCAACCACTGTGGTAGATGATCTTAAGAATCGACTGATGAGCACCACAAAAGAATTTAAAGAAGTTCTGACAATGCGAACAGAAAATTTGAAGGTTCATGAGAACAGAAGACAACTATTTTCTTCTACTGCTTCAAAGGAATCTACAAATCCTTTTGTTCGCCAGCGCCCATTAGCATCTAGGTCAGCTGCTGGTGCCCCAAGTGCACCCCCTCCTCCATGGGCCAAGGCGTCTACATCTTTTTCCAAAACATCTCCTGGGAAGCAGGTGGATGGGGAGGGTCAACCATTATTGCAGCAGCAACAGCAACAGCAACAGATGGTTCCATTACAAGATACTTACATGCAGAGCAGAGCTGAAGCTCTTCAAAATGTAGAATCCACCATTCATGAATTGAGCAATATCTTCAATCAGCTGGCAACTCTGGTTTCTGAACAAGGAGAGATTGCTATCAGCTTCATTAAGATGAAAATTTTGGATATTCTTGCTACTTATTCTTATTTTATCTCAGTGATTGATAAAACTGGGGCAGAACAGAGATTAGGAAGGAAAAATAGATCAGGTTGCATGCTCAGGCTGGACAATAGGTGTGCATGGACGCAACAGCCTGTGGAACAGAACATGTCACTGATCGATGAGAACATGGACGATACTCTCGCAAATGTGGAGGGAGCGCAGGGAGCTTTGCTCAAATATCTAAGCAGTATATCATCAAACAGACGGAAGATCTGGATTCTAGTCAAGTATAATGTTGATAATGTGTCAGTTCGTGTTTATGCCTTCAACTTCTCTTCTAATTTTGGGAACGCATCGCTGAAGAACTCAAACGCATCAAATTACTACAGTTTGAAGAGCACTCTTTATCGGTCTCCAGAAGGATGGAATTGCCTTAAATGA 1299 42.26 MAVKTAQSFRDRTLEFQNITERLKKSFSSGTGPTGPSAVSKSEEQRSSVALQSEFNKRASKIGLGIHQTSQKLSKLAKLAKRTSVFDDPTMEIQELTALIKQDITTLNSAVVDLQLLCNSRNENGNISSDTSSHSTTVVDDLKNRLMSTTKEFKEVLTMRTENLKVHENRRQLFSSTASKESTNPFVRQRPLASRSAAGAPSAPPPPWAKASTSFSKTSPGKQVDGEGQPLLQQQQQQQQMVPLQDTYMQSRAEALQNVESTIHELSNIFNQLATLVSEQGEIAISFIKMKILDILATYSYFISVIDKTGAEQRLGRKNRSGCMLRLDNRCAWTQQPVEQNMSLIDENMDDTLANVEGAQGALLKYLSSISSNRRKIWILVKYNVDNVSVRVYAFNFSSNFGNASLKNSNASNYYSLKSTLYRSPEGWNCLK 432
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
8 24442216 24447058 + ClG42_08g0144000.10 Clacu08g1440 255782

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Clacu08g1440 432 MobiDBLite consensus disorder prediction 170 190 - -
Clacu08g1440 432 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 246 283 IPR000727 -
Clacu08g1440 432 SUPERFAMILY t-snare proteins 52 283 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Clacu08g1440 432 PANTHER SYNTAXIN 54 380 IPR045242 GO:0000139(PANTHER)|GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006888(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Clacu08g1440 432 MobiDBLite consensus disorder prediction 24 46 - -
Clacu08g1440 432 MobiDBLite consensus disorder prediction 209 242 - -
Clacu08g1440 432 MobiDBLite consensus disorder prediction 168 242 - -
Clacu08g1440 432 Pfam SNARE domain 345 381 IPR000727 -
Clacu08g1440 432 Pfam Syntaxin-5 N-terminal, Sly1p-binding domain 6 25 IPR021538 -
Clacu08g1440 432 CDD SNARE_syntaxin5 249 382 - -
Clacu08g1440 432 Gene3D - 50 288 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Clacu08g1440 K08490 - - csv:101203633 498.049
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Clacu07g0410 Clacu-Chr7:4666951 Clacu08g1440 Clacu-Chr8:24442216 3.00E-61 dispersed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Clacu08g1440 . 8 382 SNARE and Associated Proteins AT3G24350 53.1 2.0e-84 309.7
Clacu04g0566 . 1 309 SNARE and Associated Proteins AT1G08560 69.6 3.5e-101 365.2
Clacu01g2023 . 516 817 SNARE and Associated Proteins AT2G18260 54.4 9.2e-86 313.9
Clacu10g1804 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.3e-115 411.8
Clacu01g1572 . 26 282 SNARE and Associated Proteins AT3G11820 72.8 8.5e-103 370.5
Clacu03g0558 . 31 281 SNARE and Associated Proteins AT3G11820 66.5 1.0e-92 337.0
Clacu10g1344 . 30 284 SNARE and Associated Proteins AT3G11820 52.5 4.7e-69 258.5
Clacu10g1804 . 1 279 SNARE and Associated Proteins AT3G52400 63.9 5.6e-92 334.7
Clacu01g1572 . 33 282 SNARE and Associated Proteins AT3G52400 64.8 2.3e-85 312.8
Clacu03g0558 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 3.4e-81 298.9
Clacu03g0558 . 1 299 SNARE and Associated Proteins AT4G03330 69.2 2.9e-108 388.7
Clacu10g1804 . 1 279 SNARE and Associated Proteins AT4G03330 58.2 1.5e-83 306.6
Clacu01g1572 . 1 297 SNARE and Associated Proteins AT4G03330 52.6 3.7e-79 292.0
Clacu10g1344 . 1 284 SNARE and Associated Proteins AT4G03330 52.1 7.8e-69 257.7
Clacu03g0558 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 9.6e-128 453.4
Clacu10g1804 . 1 279 SNARE and Associated Proteins AT1G61290 63.1 4.2e-91 331.6
Clacu01g1572 . 1 297 SNARE and Associated Proteins AT1G61290 56.6 1.6e-85 313.2
Clacu03g0558 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 1.7e-124 442.6
Clacu10g1804 . 1 279 SNARE and Associated Proteins AT1G11250 62.7 3.4e-93 338.6
Clacu01g1572 . 1 292 SNARE and Associated Proteins AT1G11250 57.2 1.1e-86 317.0
Clacu10g1344 . 1 303 SNARE and Associated Proteins AT3G03800 73.9 4.7e-114 407.9
Clacu02g0875 . 41 327 SNARE and Associated Proteins AT3G03800 55.6 2.0e-80 296.2
Clacu10g1344 . 1 202 SNARE and Associated Proteins AT5G08080 78.8 1.4e-80 296.2
Clacu02g0875 . 27 227 SNARE and Associated Proteins AT5G08080 58.7 1.3e-52 203.4
Clacu10g0141 . 1 253 SNARE and Associated Proteins AT5G16830 59.5 1.9e-74 276.2
Clacu10g0141 . 1 253 SNARE and Associated Proteins AT5G46860 66.0 9.6e-79 290.4
Clacu10g0141 . 1 242 SNARE and Associated Proteins AT4G17730 63.2 4.5e-73 271.6
Clacu10g0141 . 65 253 SNARE and Associated Proteins AT1G32270 59.8 1.1e-50 197.6
Clacu07g0410 . 1 336 SNARE and Associated Proteins AT5G05760 65.9 3.1e-111 398.7
Clacu08g1440 . 8 382 SNARE and Associated Proteins AT3G24350 53.1 2.0e-84 309.7
Clacu02g1560 . 32 358 SNARE and Associated Proteins AT5G26980 76.8 4.6e-128 454.5
Clacu09g0546 . 1 318 SNARE and Associated Proteins AT5G26980 66.2 2.5e-102 369.0
Clacu09g0546 . 1 318 SNARE and Associated Proteins AT4G02195 66.8 1.1e-105 380.2
Clacu02g1560 . 32 360 SNARE and Associated Proteins AT4G02195 64.4 3.2e-105 378.6
Clacu02g1560 . 32 359 SNARE and Associated Proteins AT3G05710 76.3 3.9e-130 461.5
Clacu09g0546 . 1 318 SNARE and Associated Proteins AT3G05710 63.7 1.0e-98 357.1
Clacu09g1107 . 84 316 SNARE and Associated Proteins AT1G16240 72.1 2.3e-89 325.5
Clacu10g0465 . 905 1137 SNARE and Associated Proteins AT1G16240 67.8 3.2e-83 305.1
Clacu09g1107 . 83 316 SNARE and Associated Proteins AT1G79590 71.4 3.8e-88 321.6
Clacu10g0465 . 900 1137 SNARE and Associated Proteins AT1G79590 67.2 1.5e-84 309.7
Clacu06g0052 . 168 358 SNARE and Associated Proteins AT1G28490 71.7 8.2e-67 250.4
Clacu10g2011 . 1 264 SNARE and Associated Proteins AT3G09740 79.7 2.6e-113 405.2
Clacu02g2162 . 1 265 SNARE and Associated Proteins AT3G09740 67.4 9.4e-95 343.6
Clacu02g2162 . 1 265 SNARE and Associated Proteins AT3G45280 65.9 7.5e-92 334.0
Clacu10g2011 . 1 264 SNARE and Associated Proteins AT3G45280 64.4 8.6e-88 320.5
Clacu10g2011 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 7.1e-95 344.0
Clacu02g2162 . 1 262 SNARE and Associated Proteins AT3G61450 61.0 1.9e-84 309.3
Clacu11g0790 . 65 290 SNARE and Associated Proteins AT1G51740 69.3 1.1e-78 290.0
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0008511 1 1 1 0 1 1 2 1 1 0 1 1 1 1 1 1 1 2 1 1 0 1 1 1 1 1 1 6 1 2 35