Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cma04g01124 ATGGCTTCCGTATATCGTGATCGGACGTCGGAGTTTCGGTCACTGTCGGAGACGCTGAAGAAGATCGGCGGAGCCACAGCCGCCGTCAATTTAGCTCAAAATGAACCATCGGTGTCCACGCCCTCCAGATCGCCGGAAATTTCACGATCGGAATTCAGCAAGAAGGCCTCGCGTATTGGATTGGGAATCCAAGAAACCTCTCAGAAGATTGTGAGGCTTGCTCAGTTGGCAAAAAGATCATCAATGTTTGATGACCCAATCAGGGAAATTCAGGAAATGACTGCTTTGATTAAGAATGATATTACCTCCTTGAATGTAGCTATCACAGATTTGCAAACAATCCAGAACATGGAGATAGCAGAGGGGAATTATTCAGAGGATAGAGTTGTTCATTCAACAGCTGTCTGTGATGACCTGAAGAGCAGACTTATGGGAGCTACAAAACGGCTTCAAGATGTGCTAACTACAAGAACAGAGAATATCAAGGCCAATGAGAGCCGGAGACAAATATTTTCTGCAAATGCAACCAGAGAAAGTCCTTTTCAAAATCAAGCCAAAACTGTAACGCAACCTCCACCTTGGTCAAGTAATACATCTGGAAGTGCCCAATCATCTTTATTATCATCAAATGGAGCTCAAGCTGGGGGTCAATTGAGACGAAGGTTAGCTGTTGAGAACACCCCATCACAGCAAATGGAGTTGTCAATGTTACAGCAGGTGGTTCCTAGGCAGGAAATTTATTCCCAAAGTCGTGCCGTTGCTCTCCATAATGTGGAATCCACTATTTCAGAACTCAGTGGAATTTTTACACATCTTGCCACAATGGTAGCACATCAAGGAGAACTTGCTATTAGGATTGATGACAATATGGATGAATCATTGGCAAACGTAGAAGGTGCTCGGAGTGCTCTTTTAAGGCATCTTAACCAGATATCATCAAATAGATGGCTTCTTATAAAACTATTTGCCATTTTGATAATCTTCTTGATGCTCTTTATTTTCTTGGCGTAA 1011 42.93 MASVYRDRTSEFRSLSETLKKIGGATAAVNLAQNEPSVSTPSRSPEISRSEFSKKASRIGLGIQETSQKIVRLAQLAKRSSMFDDPIREIQEMTALIKNDITSLNVAITDLQTIQNMEIAEGNYSEDRVVHSTAVCDDLKSRLMGATKRLQDVLTTRTENIKANESRRQIFSANATRESPFQNQAKTVTQPPPWSSNTSGSAQSSLLSSNGAQAGGQLRRRLAVENTPSQQMELSMLQQVVPRQEIYSQSRAVALHNVESTISELSGIFTHLATMVAHQGELAIRIDDNMDESLANVEGARSALLRHLNQISSNRWLLIKLFAILIIFLMLFIFLA 336
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
4 5812955 5815855 - CmaCh04G011240.1 Cma04g01124 292205

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cma04g01124 336 CDD SNARE_syntaxin5 248 333 - -
Cma04g01124 336 ProSitePatterns Syntaxin / epimorphin family signature. 251 290 IPR006012 GO:0005484|GO:0006886|GO:0016020
Cma04g01124 336 MobiDBLite consensus disorder prediction 33 47 - -
Cma04g01124 336 Gene3D - 46 300 - -
Cma04g01124 336 SUPERFAMILY t-snare proteins 48 300 IPR010989 GO:0016020|GO:0016192
Cma04g01124 336 MobiDBLite consensus disorder prediction 33 53 - -
Cma04g01124 336 SMART tSNARE_6 240 307 IPR000727 -
Cma04g01124 336 Pfam Syntaxin-5 N-terminal, Sly1p-binding domain 6 21 IPR021538 -
Cma04g01124 336 PANTHER SYNTAXIN-31 4 335 - -
Cma04g01124 336 MobiDBLite consensus disorder prediction 173 211 - -
Cma04g01124 336 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 245 307 IPR000727 -
Cma04g01124 336 PANTHER SYNTAXIN 4 335 IPR045242 -
Cma04g01124 336 Pfam SNARE domain 282 333 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cma04g01124 K08490 STX5; syntaxin 5 - csv:101213786 531.561
       

WGDs- Genes

Select Gene_1 Gene_2 Event_name
Cma04g01124 Cma04g00161 CST
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cma04g01124 Cma-Chr4:5812955 Cma05g00643 Cma-Chr5:3249770 3.56E-92 dispersed
Cma04g00161 Cma-Chr4:797518 Cma04g01124 Cma-Chr4:5812955 0 wgd
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi13g19 . . . . . Bpe15g01148 . . Cmo04g00161 Cmo04g01191 Cma04g01124 Cma04g00161 Car04g00154 . . . Cpe01g00138 . . . . . . . Cla07g00385 Cam07g0410 Cec07g0462 Cco07g0418 Clacu07g0410 Cmu07g0454 Cre07g0761 . Cone5ag0210 . . . . Chy10g00436 Cme10g01057 . Blo04g00243 Bda14g00262 . . . . . . . . . . . . Cpe01g01046 . . . . . . . . . . . . . . . . Csa05g00800 . .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cma05g00643 . 22 353 SNARE and Associated Proteins AT3G24350 65.1 2.7e-103 372.9
Cma12g00301 . 443 750 SNARE and Associated Proteins AT3G24350 62.3 3.1e-91 332.8
Cma07g01172 . 1 308 SNARE and Associated Proteins AT1G08560 67.5 1.5e-99 360.1
Cma03g00248 . 1 312 SNARE and Associated Proteins AT1G08560 67.7 3.0e-95 345.9
Cma03g00740 . 1 303 SNARE and Associated Proteins AT2G18260 53.4 2.6e-83 306.2
Cma14g00365 . 1330 1590 SNARE and Associated Proteins AT3G11820 80.8 4.6e-115 411.8
Cma06g00530 . 19 264 SNARE and Associated Proteins AT3G11820 72.4 1.9e-100 363.2
Cma07g00822 . 21 278 SNARE and Associated Proteins AT3G11820 69.4 1.7e-98 356.7
Cma18g00344 . 31 281 SNARE and Associated Proteins AT3G11820 67.3 2.6e-94 342.8
Cma13g00676 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 2.1e-91 333.2
Cma14g01106 . 67 325 SNARE and Associated Proteins AT3G11820 52.1 6.5e-69 258.5
Cma14g00365 . 1312 1590 SNARE and Associated Proteins AT3G52400 63.9 2.0e-92 336.7
Cma07g00822 . 1 277 SNARE and Associated Proteins AT3G52400 59.4 2.6e-84 309.7
Cma13g00676 . 1 281 SNARE and Associated Proteins AT3G52400 56.5 2.7e-81 299.7
Cma06g00530 . 14 264 SNARE and Associated Proteins AT3G52400 60.7 8.8e-80 294.7
Cma18g00344 . 1 281 SNARE and Associated Proteins AT3G52400 55.3 1.5e-79 293.9
Cma14g01106 . 77 325 SNARE and Associated Proteins AT3G52400 50.2 4.5e-60 229.2
Cma18g00344 . 1 295 SNARE and Associated Proteins AT4G03330 69.8 9.9e-107 384.0
Cma13g00676 . 1 299 SNARE and Associated Proteins AT4G03330 67.5 1.3e-106 383.6
Cma14g00365 . 1312 1591 SNARE and Associated Proteins AT4G03330 57.7 9.9e-83 304.3
Cma07g00822 . 1 278 SNARE and Associated Proteins AT4G03330 52.7 2.0e-75 280.0
Cma06g00530 . 1 269 SNARE and Associated Proteins AT4G03330 54.1 1.3e-74 277.3
Cma14g01106 . 77 325 SNARE and Associated Proteins AT4G03330 55.4 1.8e-68 256.9
Cma18g00344 . 1 303 SNARE and Associated Proteins AT1G61290 78.9 2.6e-128 455.7
Cma13g00676 . 1 303 SNARE and Associated Proteins AT1G61290 77.2 7.2e-126 447.6
Cma14g00365 . 1312 1591 SNARE and Associated Proteins AT1G61290 61.0 7.1e-89 324.7
Cma06g00530 . 1 279 SNARE and Associated Proteins AT1G61290 56.4 1.5e-83 307.0
Cma07g00822 . 1 296 SNARE and Associated Proteins AT1G61290 54.4 6.4e-82 301.6
Cma14g01106 . 75 325 SNARE and Associated Proteins AT1G61290 51.0 4.6e-64 242.3
Cma18g00344 . 1 303 SNARE and Associated Proteins AT1G11250 78.2 3.2e-126 448.7
Cma13g00676 . 1 303 SNARE and Associated Proteins AT1G11250 76.6 4.3e-123 438.3
Cma14g00365 . 1312 1591 SNARE and Associated Proteins AT1G11250 61.8 3.9e-92 335.5
Cma06g00530 . 1 279 SNARE and Associated Proteins AT1G11250 57.5 3.2e-86 315.8
Cma07g00822 . 1 291 SNARE and Associated Proteins AT1G11250 55.0 3.3e-83 305.8
Cma14g01106 . 60 325 SNARE and Associated Proteins AT1G11250 51.1 8.8e-68 254.6
Cma14g01106 . 48 344 SNARE and Associated Proteins AT3G03800 74.4 1.9e-113 406.4
Cma20g00629 . 1 270 SNARE and Associated Proteins AT3G03800 57.3 4.5e-75 278.9
Cma14g01106 . 48 243 SNARE and Associated Proteins AT5G08080 77.6 7.0e-78 287.7
Cma20g00629 . 1 204 SNARE and Associated Proteins AT5G08080 58.8 1.6e-53 206.8
Cma06g00638 CST 1 256 SNARE and Associated Proteins AT5G16830 59.9 1.1e-75 280.8
Cma16g01176 CST 1 256 SNARE and Associated Proteins AT5G16830 59.9 1.1e-75 280.8
Cma06g00638 CST 1 256 SNARE and Associated Proteins AT5G46860 66.8 2.8e-81 299.3
Cma16g01176 CST 1 256 SNARE and Associated Proteins AT5G46860 66.8 1.8e-80 296.6
Cma06g00638 CST 1 256 SNARE and Associated Proteins AT4G17730 61.3 3.2e-74 275.8
Cma16g01176 CST 1 256 SNARE and Associated Proteins AT4G17730 61.7 9.5e-74 274.2
Cma16g01176 CST 65 256 SNARE and Associated Proteins AT1G32270 60.9 7.0e-53 205.3
Cma06g00638 CST 65 256 SNARE and Associated Proteins AT1G32270 60.4 1.3e-51 201.1
Cma04g01124 CST 1 334 SNARE and Associated Proteins AT5G05760 66.0 8.6e-112 401.0
Cma04g00161 CST 1 334 SNARE and Associated Proteins AT5G05760 60.9 1.6e-102 370.2
Cma05g00643 . 22 353 SNARE and Associated Proteins AT3G24350 65.1 2.7e-103 372.9
Cma12g00301 . 443 750 SNARE and Associated Proteins AT3G24350 62.3 3.1e-91 332.8
Cma12g01045 CST 1 327 SNARE and Associated Proteins AT5G26980 74.9 6.5e-125 444.5
Cma05g01087 CST 1 318 SNARE and Associated Proteins AT5G26980 75.5 2.3e-122 436.0
Cma17g01060 . 1 320 SNARE and Associated Proteins AT5G26980 65.2 8.5e-101 364.4
Cma12g01045 CST 1 329 SNARE and Associated Proteins AT4G02195 63.1 1.6e-102 370.2
Cma05g01087 CST 1 318 SNARE and Associated Proteins AT4G02195 63.0 3.5e-102 369.0
Cma17g01060 . 1 320 SNARE and Associated Proteins AT4G02195 64.4 2.9e-101 365.9
Cma12g01045 CST 1 328 SNARE and Associated Proteins AT3G05710 73.9 1.2e-126 450.3
Cma05g01087 CST 1 318 SNARE and Associated Proteins AT3G05710 74.6 1.5e-124 443.4
Cma17g01060 . 1 320 SNARE and Associated Proteins AT3G05710 63.4 2.4e-98 356.3
Cma01g01111 CCT,CST 1 233 SNARE and Associated Proteins AT1G16240 73.4 3.4e-91 332.0
Cma09g00975 CCT,CST 66 294 SNARE and Associated Proteins AT1G16240 70.4 6.2e-85 311.2
Cma16g00924 CCT 3 188 SNARE and Associated Proteins AT1G16240 53.7 6.0e-56 214.9
Cma01g01111 CCT,CST 1 233 SNARE and Associated Proteins AT1G79590 73.0 1.9e-90 329.7
Cma09g00975 CCT,CST 51 294 SNARE and Associated Proteins AT1G79590 68.7 5.4e-85 311.6
Cma16g00924 CCT 2 188 SNARE and Associated Proteins AT1G79590 53.7 1.4e-56 217.2
Cma01g00944 . 5 199 SNARE and Associated Proteins AT1G28490 69.7 1.9e-66 249.6
Cma17g00042 . 162 352 SNARE and Associated Proteins AT1G28490 70.2 1.8e-64 243.0
Cma14g00203 . 1 261 SNARE and Associated Proteins AT3G09740 77.6 2.4e-109 392.5
Cma01g01054 . 1 261 SNARE and Associated Proteins AT3G09740 77.6 9.2e-109 390.6
Cma02g00885 . 1 264 SNARE and Associated Proteins AT3G09740 67.5 4.9e-94 341.7
Cma01g01054 . 1 261 SNARE and Associated Proteins AT3G45280 64.0 2.2e-86 316.2
Cma02g00885 . 1 264 SNARE and Associated Proteins AT3G45280 63.8 3.8e-86 315.5
Cma14g00203 . 1 261 SNARE and Associated Proteins AT3G45280 63.6 1.4e-85 313.5
Cma01g01054 . 1 261 SNARE and Associated Proteins AT3G61450 69.3 2.0e-95 346.3
Cma14g00203 . 1 261 SNARE and Associated Proteins AT3G61450 68.6 4.3e-95 345.1
Cma02g00885 . 1 261 SNARE and Associated Proteins AT3G61450 60.5 2.2e-83 306.2
Cma04g02924 CST 65 309 SNARE and Associated Proteins AT1G51740 73.6 6.5e-93 337.8
Cma15g00119 CST 302 531 SNARE and Associated Proteins AT1G51740 72.7 4.5e-86 315.1
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0006940 1 1 1 1 1 1 2 1 1 1 1 1 2 1 1 2 1 1 2 1 1 1 1 1 1 1 1 3 1 1 36
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Cma04g01124 Cma_Chr04 FPKM 11.12266 13.59965 17.629831 19.266802 7.056755 6.379276 7.723339 26.707726 26.746201 26.158529